ID: 1115221178

View in Genome Browser
Species Human (GRCh38)
Location 14:31060241-31060263
Sequence ATGCAAAACCCCAGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115221174_1115221178 13 Left 1115221174 14:31060205-31060227 CCACCAAACACAGATGGAAAATA 0: 1
1: 1
2: 14
3: 42
4: 455
Right 1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1115221173_1115221178 14 Left 1115221173 14:31060204-31060226 CCCACCAAACACAGATGGAAAAT 0: 1
1: 3
2: 19
3: 58
4: 420
Right 1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1115221171_1115221178 23 Left 1115221171 14:31060195-31060217 CCTTTTTTTCCCACCAAACACAG 0: 1
1: 0
2: 0
3: 33
4: 372
Right 1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1115221175_1115221178 10 Left 1115221175 14:31060208-31060230 CCAAACACAGATGGAAAATACAG 0: 4
1: 15
2: 38
3: 133
4: 514
Right 1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG 0: 1
1: 0
2: 0
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115221178 Original CRISPR ATGCAAAACCCCAGTTATAT GGG Intronic
902489218 1:16768757-16768779 AAGTAAAAGCCCATTTATATTGG + Intronic
903841413 1:26244206-26244228 ATGGCAGACCCCAGTTATCTCGG + Exonic
907550631 1:55301823-55301845 AGGCAAAAGCCCAGGTGTATGGG - Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
912736322 1:112152478-112152500 GTGCAAAACAGTAGTTATATAGG + Intergenic
916841397 1:168604908-168604930 ATGCATAACCCCAAGTATATAGG + Intergenic
918335510 1:183507340-183507362 ATTGAAAGCCCCAGTTCTATGGG + Intronic
921676473 1:217982261-217982283 ATGAAAAATCACAGATATATAGG - Intergenic
923531219 1:234813768-234813790 AAGTAAAAGCCCATTTATATTGG - Intergenic
923806964 1:237268083-237268105 AAACAAAACCACAGATATATGGG - Intronic
1067121723 10:43478117-43478139 TTTCAAAAACCAAGTTATATAGG + Intronic
1068337589 10:55656406-55656428 ATGCAGAACCTCAGTTGTGTAGG - Intergenic
1068658593 10:59600245-59600267 ATGCAAGAGCCCATTTATAGAGG + Intergenic
1070416584 10:76195968-76195990 ATACAAAACACCATTTAAATTGG + Intronic
1072571318 10:96659938-96659960 CTGGAAAACTCCATTTATATAGG + Intronic
1073826984 10:107335929-107335951 CTGTAAAAACCCAGTGATATTGG - Intergenic
1076119574 10:127924749-127924771 ATACAAATGCCAAGTTATATGGG - Intronic
1077935018 11:6774654-6774676 ATACAAAACTTCAGTTATACGGG - Intergenic
1078607377 11:12788884-12788906 ACCCAAACCCCCAGTTAAATTGG - Intronic
1078734104 11:14003884-14003906 ATACAAAATAACAGTTATATAGG - Intronic
1081415058 11:42804581-42804603 CTGCAAAACCTCATTTATTTGGG + Intergenic
1082990818 11:59205917-59205939 ATGCCAAACCCCAGTTCTGATGG + Exonic
1084928858 11:72537550-72537572 ATGCAAAAGCCCAGCTGTGTTGG - Intergenic
1086019451 11:82208948-82208970 ATACAAAATCTCAGTTAGATAGG + Intergenic
1090500935 11:127260211-127260233 ATGCAAAATTACAGTTAGATGGG + Intergenic
1092759913 12:11800515-11800537 ATACAAAACGTCAGTTAGATGGG - Intronic
1096026708 12:48371044-48371066 ATGCAAAACTTCACTTAGATTGG + Intergenic
1097577543 12:61413612-61413634 ATTCAAGACACCAATTATATTGG + Intergenic
1098355753 12:69610928-69610950 ATGCAATCCCCAAGTTATAATGG - Exonic
1099259599 12:80361087-80361109 ATGCAAAATTTCAGTTAGATAGG - Intronic
1099566546 12:84255460-84255482 ATGGAAGACCCTAGTTAAATTGG + Intergenic
1099954573 12:89340726-89340748 AAACAGAACCTCAGTTATATTGG + Intergenic
1103555908 12:121766374-121766396 ATGGAAATTCCCAGTTACATGGG - Intronic
1104201094 12:126590042-126590064 ATGCAAATCTGCATTTATATTGG - Intergenic
1104493164 12:129212245-129212267 AGGCAACACCCCAGACATATGGG - Intronic
1107626600 13:42292488-42292510 ATGTTAAACCTCAGTTAAATTGG - Exonic
1107918233 13:45175053-45175075 ATGCAAAATTACAGCTATATAGG - Intronic
1108038672 13:46319247-46319269 ATGCAAAACTACAGCTATACAGG + Intergenic
1111797508 13:92941623-92941645 ATACAAAACCTTATTTATATTGG - Intergenic
1112598660 13:100833279-100833301 CTCCAAATCCCCAGTTGTATGGG - Intergenic
1112683342 13:101793128-101793150 ATACAAAGCCTCAGTTAGATAGG - Intronic
1115221178 14:31060241-31060263 ATGCAAAACCCCAGTTATATGGG + Intronic
1117491932 14:56256654-56256676 ATGCAAAACTTCAGTTTTCTTGG + Intronic
1117737818 14:58785471-58785493 ATGGAAAACTCCAGTTAATTTGG - Intergenic
1118969359 14:70620090-70620112 ATTCCAAACCCCAGATATATTGG + Intergenic
1125488129 15:40126583-40126605 ATGCACACCCCCTGTAATATTGG - Intergenic
1125489067 15:40133127-40133149 GTGTACAACCCCTGTTATATTGG - Intergenic
1125677443 15:41510384-41510406 ATGCAAAATGGCAGTTAAATAGG - Intronic
1125705801 15:41734879-41734901 TTTCCAAACCCCAGTAATATTGG + Intronic
1127765515 15:62182468-62182490 ATGCAAAAATACAGTTAGATAGG + Intergenic
1130358531 15:83158483-83158505 AGGCAAAACCACAGTTAAGTGGG - Intronic
1132129698 15:99264585-99264607 ATGCAAACCCCCACATAGATGGG + Intronic
1132361822 15:101222716-101222738 ATCCACAACCCCAGTTTAATCGG - Intronic
1135798180 16:25466201-25466223 ATGAAAAACCCTATTCATATTGG + Intergenic
1137350334 16:47708227-47708249 GTGGAGAATCCCAGTTATATTGG - Intergenic
1138068390 16:53965760-53965782 AGTCAAAACCCCTGTTATCTTGG + Intronic
1140505432 16:75468987-75469009 ATGCAAAACGCCAATTGTAGTGG - Intergenic
1141025608 16:80544227-80544249 ATGAAAACCCCCAGTAAAATAGG - Intronic
1144006494 17:11104961-11104983 ATGCAAAACATGTGTTATATTGG + Intergenic
1144058285 17:11560004-11560026 AGGTAAAACCCCATTTATAAGGG - Exonic
1148537488 17:48452451-48452473 ATGCAGAACCCTAGCTACATGGG + Intergenic
1148919840 17:51021008-51021030 ATGCAGAACCACAGATATAGAGG + Intronic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1151832588 17:76563433-76563455 ATGCTTAACCCCAGTTACACAGG + Intergenic
1153989366 18:10382476-10382498 ATACAAACCTGCAGTTATATAGG - Intergenic
1155378927 18:25195637-25195659 AAGCAACACCCCAGTTATGTTGG - Intronic
1157000853 18:43522621-43522643 ATGCAAAACACCACGTATCTGGG - Intergenic
1159255679 18:65942125-65942147 ATGCAAAATCCCTATTAGATAGG - Intergenic
1159850649 18:73523197-73523219 ATGCAACATTACAGTTATATAGG + Intergenic
1159933590 18:74340893-74340915 ATACAAAATTTCAGTTATATAGG + Intronic
1163128644 19:15258263-15258285 AATCAACACCACAGTTATATGGG - Intronic
1165234125 19:34406755-34406777 ATACAAAACCTCAGTTATTCAGG - Intronic
1165251030 19:34534431-34534453 ATACACAACCTCAGTTAGATGGG - Intergenic
927233879 2:20852073-20852095 ATTAAAAACACCAGTTATCTTGG + Intergenic
927623815 2:24691096-24691118 ATTCAAAACCACAGGTACATTGG - Intronic
928724184 2:34151744-34151766 ATGCAAAATTTCAGTTAGATAGG + Intergenic
929466995 2:42154019-42154041 ATGCAAAAAGCCATTTTTATTGG + Intergenic
930877779 2:56238861-56238883 ATGTATAACCTTAGTTATATGGG + Intronic
932951009 2:76293409-76293431 ATGCAAAAAACCAGTTATTGAGG - Intergenic
933254664 2:80067116-80067138 ATGCAAAATTTCAGTTATATAGG + Intronic
934506512 2:94898594-94898616 ATGTAAATCCCCTGTGATATGGG + Intergenic
936881810 2:117262166-117262188 ATGCAAAACTGCAGTTACGTAGG - Intergenic
937508772 2:122569713-122569735 AATCAAAAGCCCAGTTATCTGGG - Intergenic
939447232 2:142325725-142325747 CTCCAAAACAGCAGTTATATAGG - Intergenic
939638590 2:144612243-144612265 TTGCAAAACTTGAGTTATATAGG + Intergenic
942190829 2:173468479-173468501 ATGCAAAATTTCAGTTAGATAGG - Intergenic
942928367 2:181458884-181458906 ATCCAAAACTCATGTTATATGGG + Intronic
943166166 2:184328352-184328374 TTACAAAACACCAGTTATAAAGG - Intergenic
943342908 2:186702468-186702490 ATGCAAAACGCCAATTAAAGAGG - Intronic
943651871 2:190466128-190466150 TGGAAAAACACCAGTTATATTGG + Intronic
944923921 2:204443395-204443417 ATACAAAATTCCAGTTAGATAGG + Intergenic
945449134 2:209973748-209973770 ATACAGAACTCCATTTATATAGG - Intronic
945643741 2:212463142-212463164 ATGCAAAATCACAGCTAAATAGG + Intronic
945798892 2:214399883-214399905 TTGCAAAGCTCCAGATATATGGG + Intronic
946812231 2:223538082-223538104 ATTCAAAAACCCATTAATATTGG - Intergenic
1175149975 20:56925755-56925777 ATGCAAAACCACCGTTCTCTTGG - Intergenic
1177331073 21:19663943-19663965 GTGCAAATTCCCAGTTATAGGGG + Intergenic
1178084728 21:29101203-29101225 ATGCAAAATGCCATTTACATGGG + Intronic
1178329740 21:31677500-31677522 GTTCAAAAGCCCAGTTACATAGG - Intronic
1181369656 22:22405787-22405809 ATGAAAGCCCCCAGTTCTATTGG - Intergenic
949092095 3:40335-40357 ATGCAAAAGCCCATTGATGTTGG - Intergenic
950784306 3:15421131-15421153 ATGAAAAACCACAGGTCTATAGG + Intronic
954735450 3:52703799-52703821 ATGCAAAACGCCAGTTATCATGG + Intronic
956081366 3:65560092-65560114 ATACAAAACTCCATATATATAGG + Intronic
956373694 3:68591317-68591339 AAGCAAAACCACAGGTATGTAGG - Intergenic
957545973 3:81637384-81637406 AAGCAAAACCACAGATAAATGGG + Intronic
958537653 3:95425067-95425089 CTGCAAAGCCACAGGTATATGGG - Intergenic
958635172 3:96734753-96734775 ATACATATCCCAAGTTATATTGG + Intergenic
965091404 3:164167693-164167715 AAGCAAAACACCAGATATCTTGG + Intergenic
969946127 4:10784843-10784865 ATGCAAAACCCCAGATACAGAGG - Intergenic
971550283 4:27946268-27946290 ATGCAAAATCCCACTGATTTGGG + Intergenic
973884379 4:55305877-55305899 ATGCACAAGCCGAGTTAAATTGG + Intergenic
974313720 4:60248618-60248640 ACTCAAAAACCCAGTAATATAGG + Intergenic
978311542 4:107389348-107389370 ATGCAAAACACCAAATATATGGG - Intergenic
980892256 4:138828438-138828460 ATGCAAAATTTCAGTTAGATAGG + Intergenic
982951218 4:161698399-161698421 ATGCAAAATTACAGTTAGATAGG + Intronic
986190999 5:5495743-5495765 ATGGAAAACCACAGTCACATTGG + Intergenic
986191235 5:5497916-5497938 ATGGAAAACCACAGTCACATTGG + Intergenic
986372205 5:7091429-7091451 ATACATTACCCTAGTTATATTGG - Intergenic
988563573 5:32302112-32302134 ATGCAAAACCTCAGTTGTTTTGG - Intronic
989162956 5:38409282-38409304 TTCCAAAACCCAAGTTTTATAGG - Intronic
992152748 5:73922033-73922055 ATGCAAAACCCCAGATGAAAAGG + Intronic
996825926 5:127680860-127680882 ATGAAAATTCCCAGTTTTATGGG + Intergenic
997684952 5:135782103-135782125 ATGTTCAACCCCTGTTATATTGG - Intergenic
998507003 5:142680070-142680092 ATGCATGACACCAGTTATAGTGG + Intronic
999007409 5:147997638-147997660 ATGCAAAAACCACGGTATATGGG + Intergenic
1003683203 6:8276124-8276146 GTGCAAAACCCCTGTGACATGGG + Intergenic
1005407290 6:25503001-25503023 ATGCAAAATATCAGTTTTATAGG - Intronic
1007895983 6:45358980-45359002 ATGAAAATCCTTAGTTATATGGG - Intronic
1008085024 6:47235373-47235395 ATTAAAGACACCAGTTATATCGG - Intronic
1008460295 6:51761476-51761498 ATACAAAATCTCAGTTAGATAGG + Intronic
1008801995 6:55379769-55379791 ATGCATAACTACAGTTAGATAGG - Intronic
1009224884 6:61012665-61012687 ATGTAAATCCCCTGTGATATTGG + Intergenic
1010020883 6:71158659-71158681 ATGCAAAGCCCCCTTTAGATGGG - Intergenic
1011085089 6:83531197-83531219 ATAAAAAAACCCAGGTATATAGG + Intergenic
1011131544 6:84057145-84057167 ACACAAAACCCCAGATATACAGG + Intronic
1015009550 6:128328318-128328340 ATGCAAAGCCCTTGTTAGATAGG - Intronic
1015488944 6:133803303-133803325 TTGCAAAACCCCCGTTCTGTGGG + Intergenic
1016611046 6:145990053-145990075 CTGCAATAACCCAGTCATATAGG + Intergenic
1017196695 6:151709071-151709093 ATGCAAAACTTCAGTTAAATCGG - Intronic
1022147514 7:27559897-27559919 ATTTAAAACTACAGTTATATTGG - Intronic
1024291290 7:47806410-47806432 ATGCAAGACTACAGTTACATGGG + Intronic
1029343595 7:99963232-99963254 GTGTAAAACCCCTGCTATATTGG - Intergenic
1032771315 7:135060504-135060526 ATACAAAATTCCAGTTAGATAGG - Intronic
1033200413 7:139363321-139363343 AGTCAGACCCCCAGTTATATGGG - Intronic
1033951872 7:146794669-146794691 ATGAAAAAACACAGTTAGATAGG - Intronic
1034608705 7:152344523-152344545 AAGCAAAACCACAGTTAAAGTGG + Intronic
1036582455 8:10088083-10088105 TTGAAAAACCCCAGGTATAGAGG + Intronic
1041691290 8:60690513-60690535 AAGCAAACCTCCAGTTTTATAGG + Intronic
1042553198 8:70012535-70012557 ATACAAAACCCTGGTAATATGGG - Intergenic
1042977297 8:74483743-74483765 ATGCTTAACTCCAGTTATATTGG + Intronic
1046719905 8:117607701-117607723 ATGGAAAACCCTAGTGATTTTGG - Intergenic
1048050118 8:130808610-130808632 ATTCAAAACCCCAGTGCTGTGGG - Intronic
1048156503 8:131960324-131960346 ATTCAAAACCCCACGTATATGGG + Intronic
1050521625 9:6507115-6507137 ATGAAAAACTCCAGAAATATAGG - Intergenic
1051481232 9:17563679-17563701 ATGCAAAACCTCTTTTATAAGGG - Intergenic
1052259763 9:26500561-26500583 ATGCAAAATTTCAGTTAGATAGG + Intergenic
1054354066 9:64044817-64044839 ATGTACAACCCCTGTGATATTGG - Intergenic
1058287986 9:103204396-103204418 ATGCTTAACCCCAGTTACACAGG - Intergenic
1058519593 9:105804981-105805003 ATGCACAATCCCTGTAATATTGG + Intergenic
1059116961 9:111608482-111608504 ATTCAAAACCCCAGTATTACAGG + Intergenic
1060329340 9:122651419-122651441 ATGCAAAATTACAGCTATATAGG - Intergenic
1188366874 X:29326871-29326893 ATGGAAAACCACGGTTATACAGG - Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191978196 X:66896673-66896695 ATACATAACCCCAGTAATGTGGG + Intergenic
1193302970 X:79914642-79914664 ATACAAAACTACAGTTAGATAGG - Intergenic
1193664121 X:84295262-84295284 ATACAAAATTACAGTTATATAGG - Intergenic
1194711521 X:97242185-97242207 ATGCAACACCCCAGATTTACTGG + Intronic
1195429607 X:104773806-104773828 ATGAAAAATTCCAGTTAAATAGG - Intronic
1196126333 X:112104000-112104022 ATACAAAATTTCAGTTATATAGG - Intergenic
1196164516 X:112523927-112523949 ATACAAAATTCCAGTTAGATAGG - Intergenic
1196804560 X:119573239-119573261 CTTCAAAACCCCAGTTATCTCGG + Intergenic
1199174490 X:144769887-144769909 AAGGAAAAACACAGTTATATAGG - Intergenic
1199918225 X:152368243-152368265 ATACAAAATTTCAGTTATATAGG - Intronic
1200299630 X:154959629-154959651 ATGCAAAATTCCAGCTAGATAGG - Intronic