ID: 1115223315

View in Genome Browser
Species Human (GRCh38)
Location 14:31078772-31078794
Sequence GTGATTATGCAGGACTTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115223309_1115223315 22 Left 1115223309 14:31078727-31078749 CCACATAAACCACGAAAGTAAAG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG 0: 1
1: 0
2: 0
3: 14
4: 142
1115223310_1115223315 13 Left 1115223310 14:31078736-31078758 CCACGAAAGTAAAGATTAGAATT 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG 0: 1
1: 0
2: 0
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115223315 Original CRISPR GTGATTATGCAGGACTTGGA CGG Intronic
904591886 1:31619468-31619490 CTGATTAGGCAGAACTAGGATGG + Intronic
904799090 1:33080478-33080500 GACATTATACAGGACTTTGATGG + Intronic
904956952 1:34292589-34292611 CGGATTATACAGGCCTTGGAGGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905587953 1:39136365-39136387 GTGCTTATGCTGGACATGGGTGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
908791767 1:67789853-67789875 GTGAATGTGCAGGTCTTGGAGGG - Intronic
913686391 1:121236030-121236052 GTGATCCTGTTGGACTTGGATGG + Intronic
914038242 1:144023667-144023689 GTGATCCTGTTGGACTTGGATGG + Intergenic
914151213 1:145044240-145044262 GTGATCCTGTTGGACTTGGATGG - Intronic
914740098 1:150457353-150457375 GTGATTCTTCAGGATCTGGAAGG - Exonic
914979374 1:152399185-152399207 GTGATTTTGCTGGAATAGGAAGG - Intergenic
919138932 1:193545690-193545712 GTCATTATACAGGTATTGGATGG - Intergenic
920473713 1:206254584-206254606 GTGATCCTGTTGGACTTGGATGG + Intronic
921806199 1:219458405-219458427 GTAATTATGCAGAACTTTGAAGG - Intergenic
922716785 1:227880347-227880369 GTGATGATGTAGGACTTCTAAGG + Intergenic
923569897 1:235103940-235103962 GTGATTCTACAGAACTGGGAAGG + Intergenic
924229999 1:241955117-241955139 GTGATAAGGCAGGAATTGAAGGG + Intergenic
1063407598 10:5812715-5812737 GTGATTATCCAAGACTTGTCAGG + Intronic
1063472679 10:6300883-6300905 GTAATTACGCAGGATTTGAAAGG + Intergenic
1064603951 10:17019046-17019068 GTGATTCTGTAGGCCTGGGATGG + Intronic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1066242246 10:33549593-33549615 GAGATTATGCAGGAAGTGGTGGG - Intergenic
1067247792 10:44560802-44560824 GGGATTGAACAGGACTTGGATGG + Intergenic
1071863466 10:89700274-89700296 TTGATTGTGCAGGACCTGGGAGG + Intergenic
1073586900 10:104719169-104719191 GTAATTACGGAGCACTTGGAAGG - Intronic
1075979919 10:126729295-126729317 GTGAATATGCAGTAATGGGATGG + Intergenic
1076614923 10:131748967-131748989 GGGATTATGCAGGATCAGGAAGG + Intergenic
1077661205 11:4070139-4070161 AAGATGATGAAGGACTTGGAGGG + Exonic
1078620968 11:12907576-12907598 GTGATTTTGCAGGAATGGAAGGG + Intronic
1079097168 11:17518463-17518485 GTGGTTATGCAGGAGTTGCCAGG - Intronic
1079704577 11:23598233-23598255 GTGAATTTGCAGGATATGGAAGG + Intergenic
1080014167 11:27487344-27487366 TGGATTATGCAGGGCTTGGTGGG + Intergenic
1084494408 11:69495711-69495733 GTGTTTATGCTGGACATGAATGG - Intergenic
1084892538 11:72243740-72243762 GGGATTCTGCAGGAATTGGAGGG + Intronic
1085787135 11:79463263-79463285 ATGCTTTTGCATGACTTGGAAGG + Intergenic
1088565993 11:111173635-111173657 GTGATTTTGGAAGAATTGGATGG + Intergenic
1090947128 11:131440569-131440591 CTGATTCTGTAGGTCTTGGATGG + Intronic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1091808319 12:3373672-3373694 GTGTTTATGGAGGTCTGGGAGGG + Intergenic
1094413060 12:30188730-30188752 GTGATAATGAAGGAATTCGAAGG + Intergenic
1096248014 12:50006384-50006406 GTGATGATGCAGGAGGGGGAAGG - Intronic
1096850673 12:54433843-54433865 AAGCTTATGCAGGGCTTGGATGG - Intergenic
1097301726 12:58026294-58026316 CTGATTCAGCAGGACTGGGATGG + Intergenic
1104370262 12:128218084-128218106 CTGAATATGCAGGACATGAAGGG + Intergenic
1106853933 13:33827365-33827387 GTGACTAAGCAGTACTTGGTAGG - Intronic
1109763434 13:66861290-66861312 GTGATAAATCAGAACTTGGAAGG + Intronic
1110177138 13:72570302-72570324 ATATTTATGCAGTACTTGGAGGG - Intergenic
1113605097 13:111599399-111599421 GTTATTAGGAGGGACTTGGATGG - Intronic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1117247683 14:53902034-53902056 CTGATTCTGCAGGTCTTGGGTGG - Intergenic
1118412887 14:65501267-65501289 GGGATTATACAGGTATTGGAGGG + Intronic
1127888393 15:63224791-63224813 CAGATTATGGAGGACTTGGGAGG - Intronic
1129915403 15:79265727-79265749 GTGTTTACTCAGGACTGGGAGGG + Intergenic
1132496323 16:265159-265181 GTGATCATGGAGGACTGGTAAGG - Exonic
1136534583 16:30892449-30892471 GAGATTCTGCAGGAGTCGGAAGG + Intronic
1138019707 16:53467146-53467168 CTGATACTGGAGGACTTGGAAGG + Exonic
1142292609 16:89199906-89199928 GGGATTGAGCAGGACATGGAGGG - Intronic
1142311517 16:89316899-89316921 GTGAGCATGCAGGGCTGGGAGGG + Intronic
1142354678 16:89596867-89596889 GAGATCATGAGGGACTTGGAGGG + Exonic
1144568248 17:16378434-16378456 GTGATTTTGAACGACTTGGGAGG - Intergenic
1151096074 17:71499836-71499858 GTGGTTATGAGGGGCTTGGAGGG + Intergenic
1151336991 17:73445883-73445905 GTGACTAGGCAGGGCTTGGGTGG + Intronic
1152257592 17:79249130-79249152 ATGGTTTTGCAGGGCTTGGAAGG - Intronic
1155124467 18:22858223-22858245 GTGTGTATGAATGACTTGGAAGG - Intronic
1164214416 19:23131745-23131767 GTGATTCTGCAGGTTTTGAAAGG - Intronic
1164310356 19:24040979-24041001 GTGATTCTGCAGGTTTTGGAGGG - Intronic
927217787 2:20678565-20678587 CTGTTTAAGCAGGACTTGGGTGG + Intergenic
927611744 2:24548457-24548479 GTGAGGATGCAAGATTTGGAGGG - Intronic
928316596 2:30251232-30251254 GTGACTATGGAGCACTTGAAAGG - Intronic
930939401 2:56996593-56996615 GAGATAATGCAGGAATTGAAGGG - Intergenic
931795348 2:65703050-65703072 GTCAGGATCCAGGACTTGGAAGG - Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932549517 2:72753702-72753724 GAGATAATGCTGGACATGGAGGG - Intronic
933936973 2:87213981-87214003 GTGTTTTTGCAGCACTTAGAAGG + Intergenic
934972971 2:98778113-98778135 ATGATTATTAAGGCCTTGGAAGG - Intergenic
935823805 2:106921290-106921312 GTGATTTTTCAGGAGTTGGGGGG - Intergenic
939418842 2:141938975-141938997 GTGGTTATCAAGGGCTTGGAGGG + Intronic
939960356 2:148560583-148560605 GTGATTAAGCAGGAATCGAAGGG + Intergenic
940004766 2:149000290-149000312 GTAATTCTGCAGGATTTGGAGGG - Intronic
944952261 2:204765260-204765282 CTGATTCAGCAGGTCTTGGATGG - Intronic
947203310 2:227636341-227636363 ATGATTGTGCAGGACTTTGGTGG + Intergenic
948607569 2:239145924-239145946 GTTTTTCTGCAGGTCTTGGAAGG + Intronic
948628653 2:239286504-239286526 CTGACTCTGCAGGACTGGGAAGG + Intronic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1172948823 20:38708836-38708858 GAGATTATTCAGCACTTGTAAGG - Intergenic
1175625333 20:60484562-60484584 GAGATGATGCAGGGCTTGGAGGG - Intergenic
1175636709 20:60590453-60590475 GTGAAAATGCTGGATTTGGAAGG + Intergenic
1177033334 21:16010924-16010946 GTGATAAGTCAGGACTTGGAAGG + Intergenic
1178096706 21:29223058-29223080 GTGGTGATGCAGGCATTGGAGGG + Intronic
1178759925 21:35392579-35392601 GTGAGTGTGCAGGAGTTGGGAGG + Intronic
1183736738 22:39648598-39648620 GTGCTTATTCAGGGCTTGGGAGG + Intronic
949183592 3:1164579-1164601 GTGAATATGGAGGCTTTGGAGGG + Intronic
951106166 3:18745786-18745808 TTGATTCTGGAGGTCTTGGATGG + Intergenic
951781304 3:26365651-26365673 GTAATTATGTAGAACTTGTATGG - Intergenic
952212145 3:31238815-31238837 CTGATTCTGCAGGTCTGGGATGG - Intergenic
953598603 3:44340758-44340780 CTGATTCTGCAGGACTCGGATGG + Intronic
955026852 3:55175999-55176021 GGGCTAATGCAGGACTTTGAAGG - Intergenic
966061890 3:175767915-175767937 GTCATCATGCAGGATTTGGAAGG - Intronic
966163631 3:176992704-176992726 GTGATTAGGCAGAACTGGCATGG + Intergenic
969923500 4:10562776-10562798 ATGATAATGCAGGACAAGGAAGG - Intronic
972046138 4:34666735-34666757 TTGATTATGGAGGCCATGGAGGG + Intergenic
973110988 4:46397645-46397667 GTGCTTATGCTGCACATGGATGG + Intronic
973128266 4:46616243-46616265 ATGATCATGGATGACTTGGAGGG + Intergenic
973916219 4:55636815-55636837 GTGATTTTGCAGGAATTTGGGGG - Intergenic
974896358 4:67944366-67944388 CTGATTAAGCAGGTCTGGGATGG + Intronic
976544012 4:86312400-86312422 GTGAGTAAGGAGCACTTGGAAGG - Intronic
980888663 4:138790474-138790496 GTCATGATGCTGGAGTTGGAGGG - Intergenic
984386622 4:179067907-179067929 TTGATGAAGCAGGACCTGGAAGG + Intergenic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
990504684 5:56432676-56432698 GTGATGAGGCAGGGCTTGGCTGG + Intergenic
996125074 5:119716344-119716366 GGCATTATGCAGCAATTGGAAGG + Intergenic
997389864 5:133505543-133505565 TTGATTAAGAAGGACTTGTAAGG - Intronic
997705528 5:135948442-135948464 GTGGTTATGCAGCACTTGAAAGG + Intronic
1001097343 5:168786092-168786114 GGGATTAGGCAGGCCGTGGAAGG - Intronic
1001340886 5:170844369-170844391 GTGATTGTCCATGACTTGGCAGG - Intergenic
1004320824 6:14630267-14630289 ATGATTATAGAGGACTTTGAAGG - Intergenic
1007093621 6:39200000-39200022 GGGATTATGCAGGAAGAGGAGGG + Intronic
1010447471 6:75964185-75964207 GTGCTTTTGCAGAACTTTGAAGG - Intronic
1010645425 6:78382061-78382083 GTGGTTTTGCATGACTTGCAGGG - Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1013056932 6:106592095-106592117 TTGATTATGCAGGTCTGAGATGG - Intronic
1014969595 6:127797880-127797902 CTGTGTATGCAGGACTTGGAAGG - Intronic
1015764053 6:136697008-136697030 GTGATTGTGAAAGACTTGTATGG - Intronic
1016701480 6:147059102-147059124 GTGATTTTCCAGGGCTAGGAAGG - Intergenic
1019881589 7:3865909-3865931 GTGTTTATGTAGGACTACGAGGG - Intronic
1022272664 7:28825277-28825299 GTGATTTAGCAGAACTTAGAAGG - Exonic
1022342831 7:29485238-29485260 TTGATTATGCAGGACTGGGCAGG + Intronic
1023735372 7:43231541-43231563 GTGACTATGTAGACCTTGGATGG + Intronic
1024235270 7:47392888-47392910 GGGATTCTGCAGAACTTTGATGG + Intronic
1033781233 7:144671722-144671744 GGGAATATGCAGGAATTGGGAGG - Intronic
1035096136 7:156357417-156357439 GTGATGATCCAGGATGTGGATGG + Intergenic
1039037020 8:33371108-33371130 GTGATTGGGCTGGTCTTGGAAGG - Exonic
1039492208 8:37956305-37956327 GAGATCATGCTGGACTAGGATGG + Intergenic
1040793499 8:51262879-51262901 GTAATTACACAGGACGTGGATGG - Intergenic
1043306567 8:78803787-78803809 GTAATTATGGAGGACTTCTAAGG - Intronic
1043354057 8:79391908-79391930 GTGATTCTTCTGGCCTTGGAGGG - Intergenic
1044621223 8:94192312-94192334 GGCTTTATGCAGGAGTTGGAGGG + Intronic
1048333264 8:133485479-133485501 GTGCTTATGAAGTTCTTGGAAGG - Intronic
1052220373 9:26014732-26014754 GTGTTTAAGCAGGCTTTGGAGGG - Intergenic
1052679087 9:31665555-31665577 GAGATGATGCAGGAATTGGGTGG - Intergenic
1055570873 9:77615809-77615831 ATGATTCTGTTGGACTTGGAAGG - Intronic
1059445937 9:114337809-114337831 GGGATTCTGCAGGAGTGGGAGGG + Intronic
1060157481 9:121329764-121329786 GCCATTATGTAGGACTTGGCAGG + Intronic
1186881388 X:13870094-13870116 GGGGTTATGCATCACTTGGAAGG + Intronic
1188629996 X:32343928-32343950 GTGGCTATGCAAGCCTTGGAAGG - Intronic
1189867528 X:45346584-45346606 GTGATTCAGTAGGTCTTGGATGG + Intergenic
1195311150 X:103633204-103633226 GTGCTTAGGCAGGAGGTGGAAGG + Intergenic
1195314592 X:103665545-103665567 GTGCTTAGGCAGGAGGTGGAAGG + Intergenic
1196912898 X:120501808-120501830 GTGTTTATGTTGGAATTGGAAGG + Intergenic
1197209555 X:123817597-123817619 GTTATTATGGAGGACTTGGTGGG + Intergenic
1197952829 X:131916628-131916650 ATGATCATGAAAGACTTGGAAGG - Intergenic
1202361616 Y:24116227-24116249 GAGATTATGCAGTAGTTAGATGG - Intergenic
1202363457 Y:24136873-24136895 GAGATTATGCAGTAGTTAGATGG + Intergenic
1202507323 Y:25533244-25533266 GAGATTATGCAGTAGTTAGATGG - Intergenic
1202509162 Y:25553892-25553914 GAGATTATGCAGTAGTTAGATGG + Intergenic