ID: 1115243011

View in Genome Browser
Species Human (GRCh38)
Location 14:31267895-31267917
Sequence CCTTATGTGTGGGTTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115243011_1115243021 8 Left 1115243011 14:31267895-31267917 CCATGTGCAACCCACACATAAGG No data
Right 1115243021 14:31267926-31267948 GTTCAGTTTCACCTCCTTGAGGG No data
1115243011_1115243020 7 Left 1115243011 14:31267895-31267917 CCATGTGCAACCCACACATAAGG No data
Right 1115243020 14:31267925-31267947 AGTTCAGTTTCACCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115243011 Original CRISPR CCTTATGTGTGGGTTGCACA TGG (reversed) Intergenic
No off target data available for this crispr