ID: 1115243021

View in Genome Browser
Species Human (GRCh38)
Location 14:31267926-31267948
Sequence GTTCAGTTTCACCTCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115243019_1115243021 -3 Left 1115243019 14:31267906-31267928 CCACACATAAGGGGTGGGGAGTT No data
Right 1115243021 14:31267926-31267948 GTTCAGTTTCACCTCCTTGAGGG No data
1115243011_1115243021 8 Left 1115243011 14:31267895-31267917 CCATGTGCAACCCACACATAAGG No data
Right 1115243021 14:31267926-31267948 GTTCAGTTTCACCTCCTTGAGGG No data
1115243018_1115243021 -2 Left 1115243018 14:31267905-31267927 CCCACACATAAGGGGTGGGGAGT No data
Right 1115243021 14:31267926-31267948 GTTCAGTTTCACCTCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115243021 Original CRISPR GTTCAGTTTCACCTCCTTGA GGG Intergenic
No off target data available for this crispr