ID: 1115245135

View in Genome Browser
Species Human (GRCh38)
Location 14:31287086-31287108
Sequence CTGCTGTCCATGGACAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115245133_1115245135 8 Left 1115245133 14:31287055-31287077 CCAGAGGGCATGTTACAGTGCTC 0: 19
1: 57
2: 102
3: 143
4: 228
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245126_1115245135 25 Left 1115245126 14:31287038-31287060 CCACAACCCTTGAAGCCCCAGAG No data
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245131_1115245135 10 Left 1115245131 14:31287053-31287075 CCCCAGAGGGCATGTTACAGTGC 0: 14
1: 45
2: 123
3: 155
4: 315
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245132_1115245135 9 Left 1115245132 14:31287054-31287076 CCCAGAGGGCATGTTACAGTGCT 0: 17
1: 53
2: 115
3: 146
4: 298
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245125_1115245135 26 Left 1115245125 14:31287037-31287059 CCCACAACCCTTGAAGCCCCAGA No data
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245130_1115245135 18 Left 1115245130 14:31287045-31287067 CCTTGAAGCCCCAGAGGGCATGT 0: 12
1: 28
2: 101
3: 194
4: 393
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data
1115245129_1115245135 19 Left 1115245129 14:31287044-31287066 CCCTTGAAGCCCCAGAGGGCATG No data
Right 1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115245135 Original CRISPR CTGCTGTCCATGGACAGCTC AGG Intergenic
No off target data available for this crispr