ID: 1115257054

View in Genome Browser
Species Human (GRCh38)
Location 14:31414561-31414583
Sequence CTGATGTGCTGGAGGAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115257054_1115257060 -8 Left 1115257054 14:31414561-31414583 CCATTATTCCTCCAGCACATCAG 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1115257060 14:31414576-31414598 CACATCAGGGTTTACAGGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115257054 Original CRISPR CTGATGTGCTGGAGGAATAA TGG (reversed) Intronic
900545166 1:3224681-3224703 ATGATGAGGTGGAGGAATGAGGG + Intronic
903668788 1:25023313-25023335 CTGAGGTTTTGGAGGAATCAGGG - Intergenic
909720687 1:78766409-78766431 TTAAAGTGCTGGAGGAAAAAAGG - Intergenic
910358710 1:86393668-86393690 TTGATGGGCTGGAGAAATCAGGG - Intronic
910942502 1:92552090-92552112 CAGATGTGTTCGAGGACTAATGG + Intronic
914932305 1:151946029-151946051 CTGATGTACTGCAGGAACCAAGG - Intergenic
915889094 1:159754343-159754365 CCGGCGTGTTGGAGGAATAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919006403 1:191904210-191904232 CTGATGTGCAGCAGGAAAAATGG + Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921376603 1:214480798-214480820 ATTATGTGCTGTGGGAATAATGG - Intronic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
1063006217 10:1973001-1973023 CTGCTGTGGGGGAAGAATAATGG + Intergenic
1063756221 10:9012211-9012233 CTAATGTTCTGAAAGAATAAAGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1067370978 10:45682073-45682095 GTGATGTGATGGAGGAGTCATGG + Intergenic
1067388803 10:45844071-45844093 GTGATGTGATGGAGGAGTCATGG - Intronic
1067417262 10:46112880-46112902 GTGATGTGATGGAGGAGTCATGG + Intergenic
1067502675 10:46819769-46819791 GTGATGTGATGGAGGAGTCATGG + Intergenic
1071453876 10:85826755-85826777 CTGCTGTGCTGGAGGAACTGAGG - Intronic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1073544676 10:104338206-104338228 CTAGTGTGCTGAAGGAAGAAGGG - Intronic
1074399871 10:113133251-113133273 GTGTTGAGATGGAGGAATAAAGG - Intronic
1074486217 10:113883992-113884014 CAGATCTGCTGGAGGCATGATGG + Intronic
1074849404 10:117427077-117427099 CTGAGATGCAGGAGGAATGAGGG + Intergenic
1077310306 11:1885766-1885788 CTGATTGGATGGAGGAATACTGG - Intronic
1079134650 11:17769530-17769552 ATGATGTGCTGGTGAAAGAAAGG + Intronic
1082010587 11:47447580-47447602 GTGACTTCCTGGAGGAATAATGG - Intronic
1084352930 11:68616326-68616348 ATGACGTGCAGTAGGAATAAAGG - Intergenic
1085853644 11:80151049-80151071 CTGATTTCTTGGAGGAATGATGG - Intergenic
1088458525 11:110058535-110058557 TTAATGTGCTGAGGGAATAAGGG - Intergenic
1088797222 11:113274147-113274169 CTGATGTGCAGGAAGAAAAGAGG + Intronic
1090550387 11:127813198-127813220 CTCATGTTCTGAAGGAATACTGG + Intergenic
1094523426 12:31216315-31216337 CTGATGTGCTGGAGGGACCAAGG - Intergenic
1095343386 12:41119379-41119401 GTGATGAGCAGGAGTAATAAAGG - Intergenic
1095669049 12:44836533-44836555 CTGAAATTCTGAAGGAATAAAGG + Intronic
1096452095 12:51751929-51751951 CTGATTTGCTGGAGCAATGCAGG - Intronic
1096759887 12:53832347-53832369 CAGGTGAGCTGCAGGAATAATGG + Intergenic
1097030482 12:56086156-56086178 CCTATGAGCTGGAGGAATATAGG + Intronic
1097383627 12:58923335-58923357 CTGATGTGCTGGAAGTATACTGG - Intergenic
1098236670 12:68424425-68424447 CTGATGTGTTGGAGGAAGTCAGG + Intergenic
1099772708 12:87082766-87082788 CAGATATGCTTGAGAAATAAAGG - Intergenic
1101941757 12:109104514-109104536 CTGATGGGATGGAGGATTCAAGG - Intronic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1102580603 12:113884391-113884413 CAGATGTCCTGCAGGAATAGAGG - Intronic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1104225399 12:126827800-126827822 GTGATGTGTTGTAGGAAAAAAGG + Intergenic
1104648042 12:130510947-130510969 CTGATTTCCTGGATGTATAATGG + Intronic
1107157569 13:37187182-37187204 CTGCTTTGCTGGAGGAAGTATGG + Intergenic
1109348313 13:61144715-61144737 CTGATTATCTGTAGGAATAAAGG + Intergenic
1111170332 13:84518779-84518801 CTGGTGGGCTGGATGAATACAGG + Intergenic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1114951191 14:27756117-27756139 GTTAGGTGCTGTAGGAATAAGGG + Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115404609 14:33000421-33000443 CTGATGTGCTGGATAAACCAGGG + Intronic
1116224829 14:42137058-42137080 CTGATATGGTAGAGGAATACAGG - Intergenic
1117324028 14:54652416-54652438 CCGATGAGGTGGAGGAATACTGG + Intronic
1126070857 15:44863746-44863768 AGGTTGTGCTGGAGGCATAAAGG + Intergenic
1126221886 15:46223643-46223665 CTCATGTGCTGGAGGCAAACAGG - Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1131937134 15:97519111-97519133 TAGATGGGTTGGAGGAATAATGG + Intergenic
1134612380 16:15619515-15619537 CTGAAGTGCTGGAGGAAGGAGGG - Intronic
1135223922 16:20639095-20639117 TTTATGTGCTAGAGGGATAATGG + Intronic
1138245334 16:55463020-55463042 CTGATGCAGTGGAGGAATGAAGG - Intronic
1138354603 16:56367198-56367220 CTCATGTGCTGGAAGAGAAAGGG - Intronic
1138731012 16:59195273-59195295 CTTATGCTCTGGAGGGATAATGG - Intergenic
1203142819 16_KI270728v1_random:1779783-1779805 CTGATGACCTGCAGGAACAACGG + Intergenic
1150880125 17:69015070-69015092 CTGCTATGCTGGAGGCAGAATGG - Intronic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1153988687 18:10376101-10376123 ATGATATACTGGAGGAAAAAAGG - Intergenic
1155272515 18:24154319-24154341 CAGATGTGCTGGTGGATAAAAGG + Intronic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1156189517 18:34702124-34702146 CTGGTGTGATGGAGGAATGCAGG - Intronic
1159748618 18:72271757-72271779 CTCATGTGGTGGACGAACAAGGG + Intergenic
1160051737 18:75440054-75440076 GTGTTCTGCTGGAGGAGTAATGG + Intergenic
1160629831 18:80239123-80239145 CTGATGTGAAGGGAGAATAAGGG + Intronic
1161206877 19:3046233-3046255 CTGCAGTGCTGGTGGAATTAGGG - Intronic
1161345437 19:3766825-3766847 CTGGTGTGCTGGAGGAACAGCGG + Intronic
1163050959 19:14683178-14683200 TTGATTTGTTGGAGGGATAAGGG + Intronic
1163288364 19:16363494-16363516 CTGATCTGCTGGGGGAACAGAGG - Intronic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1165558564 19:36657867-36657889 GTGATAGGCTGGAGTAATAAAGG - Intronic
1166476875 19:43134185-43134207 CTCATTGGCTGGAGGAATGATGG + Intronic
1166935734 19:46331271-46331293 CTGGTGTGTTGGGGGATTAATGG + Exonic
925306934 2:2854451-2854473 CTGATGTACTGAAGGAACAAAGG + Intergenic
927301305 2:21518963-21518985 CTGATTTACTTGAGAAATAAAGG - Intergenic
929323365 2:40574551-40574573 TTGATTTGCTGTGGGAATAATGG + Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
932098120 2:68870396-68870418 ATGATGAGCTGGATGATTAATGG + Intronic
933056303 2:77671660-77671682 TTGATCTGTTGGAGGAATACAGG - Intergenic
933109342 2:78377679-78377701 GTGAGGTGATGGAGAAATAAAGG - Intergenic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
933634939 2:84698563-84698585 CTGATGTGATGGAGGACACATGG - Intronic
933927857 2:87115975-87115997 TTGATCTGTTGGAGGAATACAGG - Intergenic
934567802 2:95350178-95350200 CTGATGTGCTGGTGACATAAAGG + Intronic
935368336 2:102318337-102318359 TTGATGTGCTGGAGAAAGAGAGG + Intronic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
939712254 2:145536806-145536828 CTGCAGTCCTGGAGGAATGAAGG - Intergenic
941253152 2:163192406-163192428 CTCATATGCTGGTGGAATATGGG - Intergenic
941265305 2:163353961-163353983 CTGATGAACTAGAGGAAGAATGG - Intergenic
942879800 2:180845414-180845436 CTGATGAGGTTGAGGAATAGTGG + Intergenic
943826422 2:192399500-192399522 TCAATGTTCTGGAGGAATAATGG + Intergenic
944199862 2:197095061-197095083 CTGATTAGTTGGAGAAATAATGG - Intronic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
948372489 2:237498464-237498486 CTGATATGCTGGAGGAAGGAGGG + Intronic
1172518272 20:35550948-35550970 CTGATGGGCATGAGGGATAAAGG + Intronic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173171993 20:40734059-40734081 CTGATATGTTCAAGGAATAATGG + Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1176375113 21:6083211-6083233 CTGAAATGCTGGAGCAATCAGGG + Intergenic
1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG + Intronic
1179748361 21:43455033-43455055 CTGAAATGCTGGAGCAATCAGGG - Intergenic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1183226705 22:36555266-36555288 CTCATGTGCTATAGGAAGAAAGG - Intergenic
949818222 3:8085309-8085331 ATGAAGTGTTGGAGAAATAAGGG + Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950267903 3:11588764-11588786 GTGAAGTGCTGGAAGAACAATGG + Intronic
952711948 3:36440406-36440428 CTGCTGTCCTGCAGGCATAAGGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
955040713 3:55315001-55315023 CTGATGACCTGGAGGCATATTGG + Intergenic
955881157 3:63547482-63547504 GTGAGGTGCTGGTGGCATAAAGG + Intronic
956482541 3:69687613-69687635 CTTGTGTGATGGAGGAGTAAAGG + Intergenic
958448794 3:94247550-94247572 CAGACATGCTGGAGGAATAGAGG - Intergenic
961747891 3:129077193-129077215 CTAAAGTGCTGGATGAAGAAAGG + Intergenic
962010012 3:131383082-131383104 CTGATCTGCTGGAGAAAGGATGG + Exonic
964303480 3:155315347-155315369 CTTATGTGCTGGGGGAATGTAGG - Intergenic
969154665 4:5200008-5200030 ATGAGGTGCTGTAGGAACAAAGG + Intronic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
973974963 4:56253908-56253930 CTCATGTGATGTAGGAGTAAAGG - Intronic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976455071 4:85236966-85236988 CTAATGTGCAGGAGCAACAAAGG - Intergenic
977317943 4:95474776-95474798 TCTATGTGCTGGATGAATAATGG - Intronic
977767824 4:100821404-100821426 GTGATGTGCTGAAGGAGCAAGGG - Intronic
977923602 4:102673024-102673046 CTGATGTGCACTAGGAATATAGG - Intronic
979345705 4:119584427-119584449 TTGATTTGATGGAGGAATGAGGG - Intronic
982819225 4:159925895-159925917 CTGAAGTGTTGCAGGAATGAAGG + Intergenic
983854796 4:172630688-172630710 ATGTTGAGTTGGAGGAATAAAGG - Intronic
984256867 4:177400009-177400031 CTCATGTGCTGGAGGGAGAAAGG - Intergenic
984339851 4:178443123-178443145 CTGATGTATTGGAGGAAAATAGG + Intergenic
984651571 4:182275987-182276009 GTTATGTGTTAGAGGAATAAGGG + Intronic
988651434 5:33156183-33156205 CTGGTGAGGTTGAGGAATAAAGG - Intergenic
992875481 5:81050289-81050311 CTGATCTGCTGAAGGAATTCCGG + Intronic
993053710 5:82955318-82955340 CTGAGGATCTGGGGGAATAAAGG + Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
993944191 5:94097968-94097990 CTGCTGTGCTGGAGGAGTTGAGG - Intronic
995969376 5:117949254-117949276 GTGATGTGTTGAAGGAATATGGG + Intergenic
996329990 5:122317842-122317864 CTGATTAGGTGGAGGAAGAAAGG - Intronic
998786270 5:145712112-145712134 CTGGTGTGCTGGAGCCATCAAGG + Intronic
1001218332 5:169876539-169876561 CTGATGGCCTGGAAGAACAAGGG + Intronic
1006239856 6:32668230-32668252 CTGCTGTGATGGACGCATAAAGG + Intronic
1007624173 6:43233615-43233637 GTGATGGGATGGAGGAATGAGGG + Intergenic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1009815265 6:68725180-68725202 CTGGTTTGTTGGAGGAACAATGG + Intronic
1010317274 6:74466143-74466165 CTGCTGTGCTGGAGGGGTCAAGG + Intergenic
1011309970 6:85970935-85970957 ATGTTTTGCTGGAGAAATAAGGG - Intergenic
1014148022 6:118020884-118020906 CTGGTGTGGTGAAGGAATACTGG + Intronic
1014156440 6:118115382-118115404 GTGAGGTGATGGAGGAATCAAGG + Intronic
1014291907 6:119568433-119568455 GAGATGTGCTGGAAGAAAAAGGG - Intergenic
1014884717 6:126765509-126765531 CTGATATTCTGGAGATATAAAGG + Intergenic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1017251216 6:152281948-152281970 ATGATCAGCTGGAGGAACAAAGG - Exonic
1018182104 6:161232904-161232926 CTCATGTGCTGGAGAAACAGTGG - Intronic
1018290867 6:162291499-162291521 GTGAAGTGCTGGAGGGATACTGG - Intronic
1019923210 7:4175695-4175717 GTGATGTGCGGCAGGAACAAGGG - Intronic
1020090133 7:5334112-5334134 CTCCTGTGCTGGAGGATTTAAGG - Intronic
1022178447 7:27895138-27895160 GTGATGTGCTGGGGGCAGAAAGG - Intronic
1023535287 7:41202492-41202514 CAAATGTGCAGGAAGAATAATGG + Intergenic
1023824241 7:43997969-43997991 CTGGTTTGATGGAGGAATAGGGG - Intergenic
1026663211 7:72320348-72320370 CTGAAGTGCGGGAGGATTCAGGG + Intronic
1027200034 7:76058169-76058191 CTGATGTGCTGGGGGGATGGGGG + Intronic
1027327855 7:77062465-77062487 CTGGTTTGATGGAGGAATAGGGG + Intergenic
1027554578 7:79647816-79647838 CTGCTGCGCTGGAGGAGTCAAGG + Intergenic
1028446612 7:90931587-90931609 CTGATGTGATGGGGGAAGGAAGG + Intronic
1028821777 7:95219910-95219932 GTGTTGTCCTGGAGAAATAAGGG + Intronic
1029752506 7:102551298-102551320 CTGGTTTGATGGAGGAATAGGGG - Intronic
1029770457 7:102650391-102650413 CTGGTTTGATGGAGGAATAGGGG - Intronic
1030464318 7:109880687-109880709 GTGATGAGCTGGAGGAAGAGCGG + Intergenic
1031311724 7:120207285-120207307 CTGCTGTGCTGGAGGGGTCAAGG - Intergenic
1031619009 7:123913544-123913566 CTAATGGGCTGCAGGAATTAGGG - Intergenic
1032574060 7:133033861-133033883 CTGATGTCCTAGAGGGATGAGGG + Intronic
1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG + Intronic
1034077394 7:148245424-148245446 CTGATGTGGAGGAGGATGAAGGG + Intronic
1035408577 7:158618489-158618511 CTGAACTTCTGGTGGAATAATGG + Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037345358 8:17893825-17893847 CAGATGTGCAGAAGAAATAATGG - Intronic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1038990320 8:32860190-32860212 CTGCTGTGCTAGAGGCATCAAGG - Intergenic
1039609512 8:38908131-38908153 CTCATGTGTTGTAGGAATAGAGG + Intronic
1041926520 8:63242664-63242686 CTGATTTGCTGTAGGCAGAAGGG + Intergenic
1048163240 8:132039705-132039727 CTGTTGTGGTTGAGAAATAAGGG - Intronic
1050102050 9:2129510-2129532 CTGATGAGCTGGAGGACTGATGG - Intronic
1050387841 9:5110030-5110052 CTCATGTGTTGGAGGAAAAGAGG - Intronic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1050729144 9:8688208-8688230 CTTATGTACTGAAAGAATAATGG - Intronic
1050761685 9:9079890-9079912 ATGATGTGTTGCTGGAATAAGGG + Intronic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1051681324 9:19610936-19610958 CTGCTCTGTTGGAGGAATAAGGG + Intronic
1054959703 9:70954246-70954268 CCACTGGGCTGGAGGAATAATGG - Intronic
1055541543 9:77311282-77311304 CTTATGGGCTGGAGGAAGAAGGG - Intronic
1056812934 9:89778228-89778250 CTGAGGTGCTGGAGACATAATGG - Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1060235466 9:121859701-121859723 CAGATGGGCTGGAGCAAAAAGGG - Intronic
1060679134 9:125545864-125545886 ATTGTGTGGTGGAGGAATAAAGG + Intronic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061450103 9:130663151-130663173 ATGATGGGCAGGAGGAATAGAGG + Intergenic
1061578398 9:131522187-131522209 CTGATGTGCTGCAGGACCACAGG - Exonic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187644247 X:21329076-21329098 TTGCTGTGCTGGAGGGATCAAGG - Intergenic
1188630969 X:32359581-32359603 CTGAAGTGCTGGAGGTTTTAGGG - Intronic
1189710894 X:43810801-43810823 TGGATGTACTGTAGGAATAATGG + Intronic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1195079155 X:101354970-101354992 CTGATATGCTGAAAGAATTAAGG + Intronic
1197638264 X:128940704-128940726 CTTATATGCTGTGGGAATAAAGG - Intergenic
1200059050 X:153475990-153476012 CAGATGTACTGGGGGCATAAGGG - Intronic
1200107500 X:153723414-153723436 CTGATGCGCTGGCGGAAGCAGGG + Intronic