ID: 1115264573

View in Genome Browser
Species Human (GRCh38)
Location 14:31487759-31487781
Sequence CAGTGTTCCCAAGTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115264573_1115264580 -6 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264580 14:31487776-31487798 ACACTGAGCTGCTGGCGCAGGGG 0: 1
1: 0
2: 0
3: 24
4: 203
1115264573_1115264581 -2 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264581 14:31487780-31487802 TGAGCTGCTGGCGCAGGGGAAGG 0: 1
1: 0
2: 8
3: 35
4: 422
1115264573_1115264579 -7 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264579 14:31487775-31487797 AACACTGAGCTGCTGGCGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1115264573_1115264582 5 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264582 14:31487787-31487809 CTGGCGCAGGGGAAGGCCACAGG 0: 1
1: 0
2: 3
3: 36
4: 295
1115264573_1115264583 13 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264583 14:31487795-31487817 GGGGAAGGCCACAGGAGCATCGG 0: 1
1: 0
2: 3
3: 52
4: 455
1115264573_1115264578 -8 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264578 14:31487774-31487796 GAACACTGAGCTGCTGGCGCAGG 0: 1
1: 0
2: 0
3: 17
4: 165
1115264573_1115264584 14 Left 1115264573 14:31487759-31487781 CCCACCTCCACTTGGGAACACTG 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1115264584 14:31487796-31487818 GGGAAGGCCACAGGAGCATCGGG 0: 1
1: 0
2: 1
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115264573 Original CRISPR CAGTGTTCCCAAGTGGAGGT GGG (reversed) Intronic
900006505 1:58106-58128 GAGTGTTCCAATGTGGAGGAAGG - Intergenic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
901245409 1:7726408-7726430 CATTGTTCCCACTTGAAGGTAGG + Intronic
902194139 1:14785275-14785297 CAAAGTTCCCAAGGGAAGGTTGG - Intronic
902218498 1:14949859-14949881 CAGAGTTCCCATGGGGAGATGGG - Intronic
903376251 1:22868078-22868100 CAGAGCTCCCAAATGGATGTAGG - Intronic
908650575 1:66328712-66328734 CAATGGTCACAAGTGCAGGTGGG - Intronic
912312394 1:108636051-108636073 CAGTTTTCCGAAGTGGTGGTGGG + Exonic
913661362 1:121008800-121008822 CAGTATTCCCAAGAGGGGTTCGG - Intergenic
914012729 1:143791980-143792002 CAGTATTCCCAAGAGGGGTTTGG - Intergenic
914165101 1:145169204-145169226 CAGTATTCCCAAGAGGGGTTTGG + Intergenic
914376780 1:147079440-147079462 CAGTATTCCCAAGAGGGGTTCGG + Intergenic
914651354 1:149700589-149700611 CAGTATTCCCAAGAGGGGTTTGG - Intergenic
914894274 1:151654433-151654455 CACTGTTACCAAGCAGAGGTCGG - Intronic
917509415 1:175657996-175658018 CTGGGAACCCAAGTGGAGGTAGG - Intronic
917794658 1:178524190-178524212 CAGTGTTCCCAAGTGTTTGGAGG - Intronic
917826223 1:178823972-178823994 CAGGATTCCCAAGTAGAGATTGG + Intronic
921169237 1:212531483-212531505 CACTGTTCCCAGGTAGAGTTTGG - Intergenic
922286082 1:224171795-224171817 CAGTGAACCCAAGTAGAGGCCGG - Intergenic
923494732 1:234514234-234514256 CAGGGTTCCTAGGTGGAAGTTGG + Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062919818 10:1271328-1271350 CACTGTTTCCATGGGGAGGTTGG - Intronic
1063969569 10:11372122-11372144 CAGTGGTCCCAAGAGGAGGCCGG - Intergenic
1064065487 10:12177556-12177578 CAGCATTGCCAAGAGGAGGTTGG + Intronic
1064352171 10:14586245-14586267 CAGTGTTCTGAAGAGAAGGTGGG - Intronic
1065652806 10:27911098-27911120 CAGTGTTCCTAAGTGCAGGACGG - Intronic
1069957137 10:72059155-72059177 CAGGGTCCCCAAGTGGAGGCGGG + Exonic
1073806321 10:107102430-107102452 AAGTGTTCCCAAGTGAAGACTGG + Intronic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1075058466 10:119237759-119237781 CAGTGTTCCCATGGGGAGTGGGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076413386 10:130267491-130267513 GAGTGCTTCCAAGTGGAGGATGG - Intergenic
1077633647 11:3827351-3827373 CAGTGTTCCCAAGCAGAGGGGGG + Exonic
1078647451 11:13154399-13154421 CAGTGGACCCTATTGGAGGTTGG - Intergenic
1079351585 11:19696262-19696284 CAGTGTTCCCATCTGGAATTAGG + Intronic
1081670813 11:44941534-44941556 CAGTCTTCCCAGGTGTAGTTGGG + Intronic
1083140801 11:60719655-60719677 CAGTGTTCAGTAGTGGAGGTGGG - Intergenic
1083222504 11:61262276-61262298 CAGTTTCCCCAGGTGGAGGTAGG + Intronic
1083242902 11:61403051-61403073 CCATGTTCTGAAGTGGAGGTGGG + Exonic
1083579918 11:63818384-63818406 CAGTGAGCCCCGGTGGAGGTGGG + Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085127393 11:74011109-74011131 CACTGTTTTGAAGTGGAGGTGGG + Intergenic
1088464546 11:110120387-110120409 CAGTGTTCCTAAGTGCAAGAAGG - Intronic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1091694290 12:2617535-2617557 CAGTGTGCCCATGTGGGGGCAGG + Intronic
1092763387 12:11829795-11829817 CTAAGTTTCCAAGTGGAGGTCGG - Intronic
1094142697 12:27197234-27197256 CAGTGTTCCTCAGTAGGGGTTGG - Intergenic
1097546968 12:61015352-61015374 GAGTGAGCCCAAGTGGAGATAGG + Intergenic
1097747278 12:63315251-63315273 CAGTGGTCCCAATTGCAGATTGG + Intergenic
1099917696 12:88915566-88915588 CAGAATTCCCAAGTGAAGGATGG + Intergenic
1100392653 12:94157401-94157423 CACTGTTCCCAAGTCGACTTTGG - Intronic
1100870881 12:98908745-98908767 CATTGTTCCCAAGAGGAAGGTGG + Intronic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1102284252 12:111642447-111642469 CTGTTTTCCCAGGTGGTGGTGGG + Exonic
1102952697 12:117040974-117040996 CAGTGTTCCCAAGTGCTTTTGGG - Intronic
1103163365 12:118749629-118749651 CAGTTCTTCCAGGTGGAGGTTGG - Intergenic
1107176973 13:37410520-37410542 CAGTGCTGCCAAGTGGATATCGG + Intergenic
1114348834 14:21827096-21827118 CAGAGTTCACAATTGCAGGTAGG - Intergenic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1116978947 14:51147317-51147339 CAGTTTTCCAAAGTGGAGGCAGG + Intergenic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1118718902 14:68579974-68579996 CGGTGCCCGCAAGTGGAGGTGGG + Intronic
1119132578 14:72188089-72188111 CAGTGTTCCTAAGTGCAAGAAGG + Intronic
1120279480 14:82420937-82420959 AAGAGTTCCCAAGAGAAGGTAGG + Intergenic
1121278929 14:92686412-92686434 CAGTGATGCCAAGTTGAAGTTGG - Intronic
1121606784 14:95246445-95246467 CACAGTTCCCAAGAGGAGGGGGG - Intronic
1122786749 14:104167502-104167524 CAGTCTTCCCATGTGGAGCGCGG - Intronic
1122875153 14:104660490-104660512 CAGCTTTCCCAAGTGCAGGGGGG - Intergenic
1124619635 15:31266344-31266366 CAGTGTTCCCCAGAGGTGCTGGG - Intergenic
1126479834 15:49105783-49105805 TAGTGTTCCTAAGTGCAGGAAGG + Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1127662980 15:61117955-61117977 CAGAGTTATCAAGTGGAGGAGGG - Intronic
1127940108 15:63686441-63686463 CAGTGTTGCCTAGTGGAGAATGG - Exonic
1128248891 15:66151374-66151396 CAGTGCACCCAAGGGAAGGTGGG + Intronic
1128554340 15:68620931-68620953 CTGTGCTCCCAAGTGGAGCTCGG - Intronic
1129599686 15:76991279-76991301 CTGCGTTCCCCAGCGGAGGTTGG - Intergenic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1130897351 15:88181777-88181799 GAGTGATGCCACGTGGAGGTGGG - Intronic
1131065673 15:89433644-89433666 CAAGGTTCCCAAGTGGAGGTGGG + Intergenic
1132447017 15:101932851-101932873 GAGTGTTCCAATGTGGAGGAAGG + Intergenic
1133725261 16:8531375-8531397 CAGTGTTCCAAGGAGGGGGTTGG - Intergenic
1135192020 16:20362155-20362177 CACTGTGGCCAAGTGGATGTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137815317 16:51392730-51392752 CAGGGTTGGCAAGTGGAGGGAGG - Intergenic
1139640982 16:68291153-68291175 CTTTGTTCCCAAGGAGAGGTTGG + Intronic
1140746454 16:77984784-77984806 CAGCATTGACAAGTGGAGGTAGG - Intergenic
1140942476 16:79734813-79734835 CAGTTTTCCCCAGTGGAGGCTGG + Intergenic
1141121661 16:81363198-81363220 CAGTGTTTTCAAGTTGACGTGGG - Intronic
1141591586 16:85072821-85072843 CAGTGTTTCCAAATGCAGCTGGG - Intronic
1141856286 16:86683361-86683383 CACTGTGCCCACGTGGAGGCGGG + Intergenic
1143019237 17:3908088-3908110 CAGTGTTGCTCAGTGGAGGTGGG - Intronic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1146111619 17:30095021-30095043 CAGAGGTCCCAAGTGGAGTGGGG - Intronic
1147127107 17:38378670-38378692 CAGTGCTCCCAAATGGAGAGAGG - Intronic
1147441304 17:40448871-40448893 CAGAGTGCCCAAGTGCATGTGGG + Intronic
1149711473 17:58746181-58746203 CACTTTTCCCATCTGGAGGTGGG + Intergenic
1152590100 17:81207400-81207422 CAGGGTTCCTCAGTGGAGCTGGG + Intronic
1152603013 17:81274580-81274602 CAGAGCTCCCAAGGGGAGGCAGG + Intronic
1154329595 18:13418595-13418617 CAATGTGCCAAAGTGCAGGTTGG - Intronic
1159023291 18:63160716-63160738 CAGAGTGCCCAAGTGGAGACAGG - Intronic
1159947420 18:74454717-74454739 CTGAGTTGCCAAGTAGAGGTTGG - Intronic
1160331931 18:78001634-78001656 CAGTGATCACAAGAGGAGGGGGG + Intergenic
1160398525 18:78590334-78590356 CTGTGCTCCCTACTGGAGGTAGG + Intergenic
1160638259 19:99682-99704 GAGTGTTCCAATGTGGAGGAAGG - Intergenic
1163638104 19:18446767-18446789 CAGTGTTCCCACGTCCACGTCGG - Exonic
1163834200 19:19563298-19563320 CCGTGGTGACAAGTGGAGGTGGG + Intronic
1165963061 19:39551536-39551558 CAGTGTTCCCAGCTGGAGTGTGG - Intergenic
1168721067 19:58555304-58555326 CTGGGTCCTCAAGTGGAGGTTGG - Intergenic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
931799575 2:65745834-65745856 CAGTGTTCCTAAGTTCAGGACGG - Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
936097621 2:109544540-109544562 CAGGGTTCTCAAGTGGAGCAGGG + Intronic
943714401 2:191134390-191134412 CAGTGTTAGCAAGTCCAGGTGGG - Intronic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
948804225 2:240446591-240446613 CAGGGCTCCCAAGTGCAGTTTGG + Intronic
948906526 2:240982258-240982280 CACTGGTCCCAAGTGGATGATGG + Intronic
1169450414 20:5706112-5706134 TAGAGTTCCCCAGTGGAGGCTGG + Intergenic
1169554859 20:6738499-6738521 CTGTCTTCCCAACTGGAGATAGG + Intergenic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1172935748 20:38618902-38618924 CAGTCCTCCCATGGGGAGGTGGG - Intronic
1173547348 20:43908997-43909019 CAGAATTCCCCAGTGGAGTTAGG + Intergenic
1174502915 20:50998921-50998943 CACAGTTCCCAAGAGGAGGGTGG + Intergenic
1174994527 20:55550986-55551008 CAGTGTTCTCAAGTTTAGGTTGG + Intergenic
1175905965 20:62379621-62379643 CAGTTTTCCCATTTGGAGGCAGG - Intergenic
1176124592 20:63469829-63469851 CAGGCCTCCCAAGTGGAGGTGGG + Intronic
1183664301 22:39238555-39238577 CAGTGTTCTCATCTGGAGGATGG - Intronic
1184367404 22:44061077-44061099 TAGTGTTCCCAAGTGCAAGAAGG - Intronic
1184977377 22:48072137-48072159 CAGTGGGCCCCAGTGCAGGTGGG - Intergenic
951056945 3:18158242-18158264 CAGTCTTCCCATGTGTAGATGGG + Intronic
953220643 3:40969019-40969041 CAGTGTTCACAGGTTCAGGTGGG + Intergenic
953364672 3:42333613-42333635 CAGTGCTCTAAAGAGGAGGTTGG + Intergenic
954290666 3:49648336-49648358 CAGGGCTCCAAAGTGGAGTTAGG + Intronic
956776413 3:72569015-72569037 TAGTTATCCCAAGTGGGGGTGGG - Intergenic
957960683 3:87247377-87247399 CAGTGTTCCTAAGTGAAAGAAGG - Intronic
959158067 3:102690926-102690948 CATTGTTACATAGTGGAGGTTGG - Intergenic
961088687 3:124091508-124091530 CAGTGTTTTCAAGTTGGGGTGGG + Intronic
962797762 3:138863683-138863705 CTGTGTTTCCAAGTCGAGTTAGG - Intergenic
964483094 3:157161191-157161213 CACTTTTCCCAAGTGCAGGGAGG + Intergenic
968761433 4:2444366-2444388 CAGTGCTCCCAACTTGAGGCAGG - Intronic
969495127 4:7522188-7522210 CCGTGTTCGCAAGTGGGAGTGGG + Intronic
973762058 4:54126837-54126859 CTGTGTTCTCAAGTGGTGGAAGG + Intronic
974030328 4:56770840-56770862 CCGTGTTCTCACGTGGTGGTAGG - Intergenic
980817394 4:137966189-137966211 CAGGGATCCCAAGTAGAGATGGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
982303260 4:153901532-153901554 CAGTGTGCCTAGGTGGAGGTGGG + Intergenic
985888687 5:2699556-2699578 CAGTATTCCCTACTGGAGGGTGG - Intergenic
986301733 5:6482949-6482971 CAGTTTTCCCACTTGGAGCTGGG - Intronic
986327367 5:6686214-6686236 CAGTGCTCCAAAGTTGAGGGTGG + Intergenic
986687469 5:10287165-10287187 CAATGTACCAAAGTGGAGGTGGG + Intronic
987121586 5:14772959-14772981 CAGTGGTCCCACTTGGAGGCAGG - Intronic
989983968 5:50674363-50674385 CAGTGTTTCAAAGTAGAGGTTGG - Intronic
990000172 5:50883349-50883371 TAGTGTTCCCAAATGAAGGTTGG + Intergenic
990868465 5:60405273-60405295 CAGTTTTCCCAAGAGGAGCAAGG + Intronic
992183732 5:74223278-74223300 CAGTGGTCCTCATTGGAGGTAGG - Intergenic
1000965418 5:167650017-167650039 CTATCTTCCAAAGTGGAGGTGGG - Intronic
1001224752 5:169934141-169934163 GAGTGTTCCCAATTAGGGGTTGG + Intronic
1001281799 5:170391354-170391376 CATTCTTCCCAAGGGAAGGTGGG + Intronic
1001417419 5:171555708-171555730 GAGTGTCCCCTGGTGGAGGTCGG - Intergenic
1001534766 5:172490721-172490743 AAATGCTCCTAAGTGGAGGTGGG + Intergenic
1002706696 5:181165331-181165353 CTGTGTTCCTGAGTAGAGGTTGG + Intergenic
1003965309 6:11247065-11247087 CAGTGTTTTCAAGGGGAGATGGG - Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1008334159 6:50280141-50280163 CACACTTTCCAAGTGGAGGTAGG - Intergenic
1008906318 6:56681267-56681289 CTGTGTTACCAATTGGATGTGGG - Intronic
1016907786 6:149168922-149168944 CACAGTTCCCAAGGGGAGGAGGG + Intergenic
1021284045 7:18757370-18757392 GAGTTTTCCCCAGTGGAGGCAGG + Intronic
1022505804 7:30908123-30908145 CAGGGTTCAGAAGTGGGGGTGGG + Intergenic
1023468340 7:40484431-40484453 CAGTGCTCCCAAGTGGCCTTGGG + Intronic
1024971595 7:55076680-55076702 CAGTATTCCTCAGTGGGGGTGGG - Intronic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1030673022 7:112357597-112357619 CAGTGCTCCCAAATGTAGGGTGG + Intergenic
1032058946 7:128707576-128707598 CTGTGTTCCCAGGCTGAGGTGGG - Intergenic
1039396162 8:37227077-37227099 CAGTGTTCTCATCTGTAGGTTGG - Intergenic
1039877762 8:41602206-41602228 CAGTCTTCCAAAGTGGTGCTGGG + Intronic
1041071661 8:54131440-54131462 CAATATTCCTAAGTGAAGGTGGG - Intergenic
1044552235 8:93525186-93525208 CAGTGGTCCCAAGGGCAGGCTGG - Intergenic
1048013888 8:130480747-130480769 CATTGTTTCCTAGTGGAGGATGG - Intergenic
1048509405 8:135048794-135048816 CAGTGTGCCCCAGGGGAGATAGG - Intergenic
1050077234 9:1877833-1877855 CAGAGTTCCCAAGTGTAGCTTGG + Intergenic
1050283047 9:4072384-4072406 CAATGTTCCCATGTGGTGGGTGG + Intronic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1053128816 9:35604298-35604320 CCGTGTTCCTACGTGGAGGGCGG + Intergenic
1056469799 9:86894289-86894311 CAGCGTTCCCAAAAGGAGCTGGG - Intergenic
1056480135 9:86994930-86994952 CAGTTATGCCAAGGGGAGGTGGG - Intergenic
1057716041 9:97497069-97497091 CAGTGGTCCAAAGATGAGGTGGG + Intergenic
1058730343 9:107844073-107844095 CTGTGTTCCCAACTGGGGATGGG + Intergenic
1058880387 9:109280613-109280635 CAGTTTTCCCAAGGAGAGGTGGG - Intronic
1059330705 9:113533764-113533786 CAGTGTTCCCATGTAAAGGTGGG - Intronic
1059454741 9:114392759-114392781 CAGTTTTCCCAAGTGGAGGGAGG + Intronic
1059554607 9:115266836-115266858 GAGGGTTCTCAAGAGGAGGTAGG - Intronic
1059758461 9:117316331-117316353 CAGTGTTGAGAATTGGAGGTGGG + Intronic
1185593133 X:1291711-1291733 CACTGGGTCCAAGTGGAGGTGGG - Intronic
1186414070 X:9368326-9368348 CTGTGTTCTCATCTGGAGGTCGG - Intergenic
1189334653 X:40163621-40163643 CACTCCTCCCAAGTGGAAGTAGG + Intronic
1199621651 X:149706708-149706730 CAGTCTTCCCAACTGGGGCTTGG - Intronic