ID: 1115265201

View in Genome Browser
Species Human (GRCh38)
Location 14:31493269-31493291
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 8, 1: 96, 2: 144, 3: 155, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115265198_1115265201 4 Left 1115265198 14:31493242-31493264 CCCACTCACTGCTGGTTCCTCTT 0: 1
1: 0
2: 10
3: 55
4: 315
Right 1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG 0: 8
1: 96
2: 144
3: 155
4: 237
1115265197_1115265201 5 Left 1115265197 14:31493241-31493263 CCCCACTCACTGCTGGTTCCTCT 0: 1
1: 3
2: 20
3: 76
4: 466
Right 1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG 0: 8
1: 96
2: 144
3: 155
4: 237
1115265199_1115265201 3 Left 1115265199 14:31493243-31493265 CCACTCACTGCTGGTTCCTCTTC 0: 1
1: 0
2: 10
3: 72
4: 630
Right 1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG 0: 8
1: 96
2: 144
3: 155
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902617793 1:17633267-17633289 AAACCACAGCTGAAGTTCTCAGG - Intronic
905343074 1:37292683-37292705 TTTCCACAGATCAAGCTCTCAGG - Intergenic
906053931 1:42899778-42899800 CTGCCACAGCAGATGCTCTCTGG - Intergenic
906877126 1:49551795-49551817 CTACCACAGCTGATGCTCTCTGG - Intronic
908036430 1:60059350-60059372 TGACCTCAGCTGCTGCTCTGGGG + Intronic
908175080 1:61547501-61547523 CTACTACAGCTGATGCTTTCTGG - Intergenic
909673616 1:78214700-78214722 ATACCACAGCTGATGCTCTTTGG + Intergenic
910077644 1:83299180-83299202 CTACTACAGCTGATGCTTTCTGG + Intergenic
910738955 1:90494522-90494544 TTACCACAGCTGATGCTCTCTGG - Intergenic
912616111 1:111101914-111101936 CTACCACAGCTGATGCTGTCTGG - Intergenic
913143165 1:115962055-115962077 CTACCATAGCTGATGCTCTCTGG + Intergenic
913151356 1:116047060-116047082 CTACCATAGCTGGTGCTCTCTGG + Intronic
913973011 1:143430389-143430411 CTACTACAGCTGATGCTTTCTGG - Intergenic
914067395 1:144255996-144256018 CTACTACAGCTGATGCTTTCTGG - Intergenic
914111758 1:144710358-144710380 CTACTACAGCTGATGCTTTCTGG + Intergenic
914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG + Intergenic
914455512 1:147833154-147833176 CTATCACAGTTGATGCTCTCTGG - Intergenic
914927206 1:151898578-151898600 CTGCTACAGCTGATGCTTTCTGG + Intronic
914968003 1:152278161-152278183 ACACTACAGCTGATGCTTTCTGG + Intergenic
915055452 1:153124579-153124601 CTACTGCAGCTGATGCTGTCTGG + Intergenic
916263792 1:162869351-162869373 CTACCACAACTGATGCTTTCTGG + Intergenic
916579962 1:166097872-166097894 ATACCACAGCTGATGCTCTCTGG + Intronic
917057848 1:171003742-171003764 CTACTACAGCTGATGATTTCTGG - Intronic
917319020 1:173759373-173759395 CTACTACAGCTGATGTTTTCTGG + Intronic
917898463 1:179516954-179516976 CTATCACAGCTGATGCTCTTTGG - Intronic
919115493 1:193275985-193276007 CTACCACCGCTGATGCTCTCTGG - Intergenic
919277935 1:195445147-195445169 CTGCCACAGCTGATGCTCTCTGG + Intergenic
919549456 1:198966392-198966414 ATACTACAGCTGATGCTTTCTGG - Intergenic
919823915 1:201490413-201490435 TTCTTACAGCTGAAGCTCTCTGG + Intronic
920941122 1:210483891-210483913 TGACCACAGCTTTTGCTCTGTGG - Intronic
921409771 1:214823376-214823398 ATACCACAGCTGAAGCTCTCTGG - Intergenic
922657945 1:227402142-227402164 CTACCACAGCTGACGCTCTCTGG + Intergenic
923046669 1:230361039-230361061 TAACCACAGCAGGTGCACTCAGG - Intronic
923648257 1:235845979-235846001 CTACTACAGCTGATGCTTTCTGG + Intronic
923808613 1:237288312-237288334 CTACCAGAGCTGATGCTCTCTGG - Intronic
923874724 1:238034901-238034923 ATACCACAGCTGGTGCTCTCCGG + Intergenic
924321382 1:242854652-242854674 TTACCACAGCTGATGCTCTCTGG - Intergenic
1062760841 10:17424-17446 CTACTACAGCTGATGCTTTCTGG + Intergenic
1064587065 10:16849802-16849824 TTCCCACAGCTGCTGATTTCAGG + Intronic
1064908106 10:20370016-20370038 TTACCACAGCTGATGCTCTCCGG - Intergenic
1065470924 10:26081054-26081076 CTACCACAGCTGATACTTTCTGG - Intronic
1065853760 10:29813395-29813417 TCACCCCACCTGATGCTCTGGGG - Intergenic
1066145472 10:32553822-32553844 CTACCACAGCTGATGCTCTCTGG - Intronic
1066657849 10:37712062-37712084 CTGCTCCAGCTGATGCTCTCTGG + Intergenic
1066747132 10:38611913-38611935 CTACTACAGCTGATGCTTTCTGG + Intergenic
1068096584 10:52499284-52499306 ATATCACAGCTGATACTCTCTGG - Intergenic
1069150483 10:64953737-64953759 CTACCACACTTGATGCTCTCTGG - Intergenic
1069242682 10:66162711-66162733 CTACTATACCTGATGCTCTCTGG - Intronic
1070457388 10:76630816-76630838 TTTGCACAGCTGCTGCTCTTGGG - Intergenic
1072928010 10:99633791-99633813 CTACCACAGCTGATGCTCTCTGG + Intergenic
1073355528 10:102850864-102850886 TAACCACAGCTCAAGCTCCCAGG - Intergenic
1074761373 10:116669773-116669795 ATACCCCAGCTGATGCTTTTGGG - Intronic
1074985783 10:118658526-118658548 CTACTACAGCTGATGCTTTCTGG - Intergenic
1075660583 10:124193083-124193105 CTACTACAGCTGATGCTTTCTGG - Intergenic
1076666270 10:132094733-132094755 CTCCCACAGCAGATGCTCTCTGG - Intergenic
1076670886 10:132120609-132120631 TCACCACAGCTGATGCCCTCAGG - Intronic
1076670892 10:132120639-132120661 TCACCACAGCTGACACCCTCAGG - Intronic
1078288629 11:9983570-9983592 CTACTACACCTGATGCTTTCTGG + Intronic
1079273679 11:19013392-19013414 CTACCACAGCTGATGTTCTCTGG - Intergenic
1079791686 11:24747548-24747570 CTACCACAGCTGATGCTCTCTGG - Intronic
1080153002 11:29076075-29076097 CTACCAAAGGTGATGCTCTCTGG - Intergenic
1080324162 11:31050494-31050516 TTACTACAGCTGATGCTTCCTGG + Intronic
1080402327 11:31947532-31947554 CTACTACAGCTGATGCTTTCTGG + Intronic
1080672510 11:34394575-34394597 CTACCACAGCTGATGATCTCTGG - Intergenic
1081195298 11:40152931-40152953 CTACCACAGCTGCTGCTTTCTGG + Intronic
1081326710 11:41754290-41754312 GTACCACAGCTGATGCACTCTGG - Intergenic
1082140456 11:48603061-48603083 CTACTACAGCTGATGCTTTCTGG - Intergenic
1082567645 11:54700160-54700182 ATACTACAGCTGATGCTTTCTGG - Intergenic
1082916890 11:58446783-58446805 CTACCACAACTGATGCTCTCTGG + Intergenic
1083528510 11:63395717-63395739 TCTCCACAGCTGATGTTCTCTGG - Intronic
1083849600 11:65357094-65357116 CCACCAAAGCTGATGCCCTCCGG + Exonic
1084840746 11:71844173-71844195 CTACTACAGCGGATGCTTTCTGG + Intergenic
1085747856 11:79129876-79129898 CTACCACAGCTGAGGCTCTCTGG + Intronic
1085917188 11:80903630-80903652 CTACCATAGCTGATGCTCTCTGG + Intergenic
1086300639 11:85423429-85423451 TTACCACAGCTGATACTCTCTGG - Intronic
1086825396 11:91489703-91489725 CTACCACAGCTGATGCTCTCTGG - Intergenic
1086919473 11:92569879-92569901 TTCCAACAGCTCATGCTCTCTGG + Intronic
1087242841 11:95799370-95799392 TTACCTCTGCTGTTGCTTTCTGG - Exonic
1087842243 11:102932453-102932475 TTCCCATAGCTGGAGCTCTCAGG - Intergenic
1087984756 11:104664000-104664022 TTACAATTTCTGATGCTCTCAGG + Intergenic
1088179508 11:107092875-107092897 CCACCACAGCTGATGCTCTCAGG + Intergenic
1088206451 11:107397659-107397681 CTACTACAGCTGATGCTCTCTGG + Intronic
1088239562 11:107759179-107759201 CCACCACAGCTGATGCTCTCTGG + Intergenic
1088388015 11:109281427-109281449 CTACCAGAGCTGATGCTCTCTGG - Intergenic
1089826251 11:121280926-121280948 CTACTACAGCTGATGCTTTCTGG - Intergenic
1089952869 11:122546478-122546500 CTACCACAGCTGATGCTCTCTGG - Intergenic
1090753065 11:129764136-129764158 CTACCACAGCTGATGCTCTCTGG + Intergenic
1090757347 11:129803988-129804010 CTACTACAGCTGATGCTTTCTGG + Intergenic
1090894985 11:130964211-130964233 CTACCACAGCTGATGCTCTCTGG - Intergenic
1091210494 11:133854309-133854331 CTACTACAGCTGATGCATTCTGG - Intergenic
1092693572 12:11144089-11144111 CTACTACAGCTGATGCTTTCTGG - Intronic
1093002019 12:14007614-14007636 CTACCACAGCTGATGCTCCCTGG - Intergenic
1093010556 12:14102153-14102175 CTATCACAGATGATGCTCTCTGG + Intergenic
1093389635 12:18602521-18602543 TTACTACAGCTGATGCTTTCTGG + Intronic
1093409235 12:18845092-18845114 ATACCACAGCTGATGCTCTCTGG - Intergenic
1093488696 12:19681178-19681200 CTACCACAGCTGATGCTCTCTGG - Intronic
1093720609 12:22437590-22437612 CTACTACAGTTGATGCTTTCTGG + Intergenic
1093994987 12:25631285-25631307 CTACCACAGCTGATGCTCTCTGG + Intronic
1094342632 12:29430314-29430336 CGACCACAGCTGGTGCTCTCTGG - Intronic
1094362148 12:29641232-29641254 CTAGCACAGATGAAGCTCTCTGG + Intronic
1094447320 12:30546025-30546047 CTACCACAGCTGATGCTCTCTGG - Intergenic
1094501343 12:31023501-31023523 CTAGTACAGCTGATGCTTTCTGG + Intergenic
1094718340 12:33034911-33034933 CTATCACAGCTGATCCTTTCTGG - Intergenic
1094802188 12:34049141-34049163 CTATCACAGCTAATGCTTTCTGG + Intergenic
1094808574 12:34115127-34115149 CTACTACAGCTGATGCTTTCTGG + Intergenic
1095115319 12:38345051-38345073 CTACCACAGCTAATGCTTTCTGG + Intergenic
1095248151 12:39946361-39946383 CTACTACAGCTGATGCTTTCTGG - Intronic
1095665216 12:44789132-44789154 CTACCACAGCTGATGCTCTCTGG + Intronic
1095732727 12:45522602-45522624 CTACTACAGCTGATGCTTTCTGG + Intergenic
1095892808 12:47250275-47250297 TTACTACAGCTGATGTTTTCTGG + Intergenic
1095932110 12:47637331-47637353 CTACCACAGCTGATGCTCTCTGG + Intergenic
1096347915 12:50866621-50866643 ATACCACAGCTGATGCTCTCTGG + Intronic
1096699468 12:53372572-53372594 TAAGCCCAGCTGATGGTCTCTGG - Intergenic
1096888564 12:54743493-54743515 CTACCACAGCTGATGCTCTCTGG - Intergenic
1096956885 12:55534994-55535016 CTATTACAGCTGATGCTTTCTGG + Intergenic
1097295520 12:57958374-57958396 CTACCACAACTGATGCTCTCTGG + Intergenic
1097385936 12:58950258-58950280 CTACTACAGCTGATGCCTTCTGG - Intergenic
1097760586 12:63459669-63459691 CTACTACAGCTGATGCTTTCTGG + Intergenic
1099393080 12:82103425-82103447 CTACAACAGCTAATGCTATCTGG + Intergenic
1099477129 12:83121654-83121676 CTACCACAGCTTATGCTCTCTGG - Intronic
1099687411 12:85907917-85907939 CTACCATAGCTGATGCTGTCTGG - Intergenic
1099777381 12:87151170-87151192 CTACTACAGCTGATGCTTTCTGG - Intergenic
1100088103 12:90936439-90936461 TTACTACAGCTGATGCTTTCTGG - Intronic
1100203565 12:92325251-92325273 CTACCACAGCTGATGCTCTTTGG - Intergenic
1100290957 12:93214742-93214764 CTGCTACAGCTGATGCTTTCTGG - Intergenic
1102916713 12:116759861-116759883 CTACCACAGCTGATGCTCTCTGG - Intronic
1103761073 12:123250837-123250859 TTACCACAGCTGATGCTTTCTGG - Intronic
1104284848 12:127415717-127415739 TTCCCACAGGAGATGTTCTCTGG + Intergenic
1104372362 12:128235147-128235169 TTACCACAGATTGTGCGCTCAGG + Intergenic
1105908292 13:24835315-24835337 CTACCACAGCTGATGCTCTCTGG + Intronic
1105930790 13:25049640-25049662 CTACCACCACTGATGCTCTCTGG + Intergenic
1106571821 13:30934405-30934427 TTACTACAGATGGGGCTCTCAGG + Intronic
1107666206 13:42693663-42693685 CTACTATAGCTGATGCTTTCTGG - Intergenic
1107755969 13:43622757-43622779 CTACCACAGCTGACGCTCTCTGG - Intronic
1108469756 13:50756216-50756238 CTACCACAGCTGATGCTCTCTGG - Intronic
1108817133 13:54305544-54305566 CTACCACAGCTGATGCTCTCTGG + Intergenic
1109079197 13:57876356-57876378 TAACTACAGCAGATGCTATCAGG - Intergenic
1109213547 13:59562877-59562899 CTATCATAACTGATGCTCTCTGG - Intergenic
1109508378 13:63336752-63336774 ATACCACAGCTGATACTCTCTGG - Intergenic
1110561900 13:76918244-76918266 ATACCACAGCTGATGCTGTCTGG + Intergenic
1110627593 13:77668704-77668726 CTACCACAGCTGATGTTCTCTGG + Intergenic
1110661171 13:78060794-78060816 ATACCACAGCTGATGTTCTCTGG - Intergenic
1110852590 13:80262502-80262524 CAACCACAGCTGATGCTCTCTGG - Intergenic
1111165729 13:84455361-84455383 TTACTACATCTTATGCTTTCTGG - Intergenic
1111748195 13:92296266-92296288 CTACCACAGCTGATGCTCTCTGG - Intronic
1112035325 13:95492165-95492187 TGACTACAGCTGATGCTTTCTGG - Intronic
1112945353 13:104920476-104920498 CTACCACAGCTGATGCTTTCTGG + Intergenic
1113269903 13:108662284-108662306 CTACTACAGCTGATGCTTTCTGG - Intronic
1113330011 13:109318141-109318163 CAACCACAGCTGATGCATTCTGG + Intergenic
1113755682 13:112809063-112809085 TCCCCAGAGCTGCTGCTCTCAGG - Intronic
1114030755 14:18577886-18577908 CTACTACAGCTGATGCTTTCTGG - Intergenic
1114692285 14:24595271-24595293 CTACCACAGCTGATGCTCTCTGG - Intergenic
1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG + Intronic
1115299284 14:31865786-31865808 CTACCACAGCTGATGCTCTCTGG + Intergenic
1115680353 14:35730875-35730897 CTACCACAGCTGATGCTCTCTGG + Intronic
1115835462 14:37397490-37397512 TTACCACAGCTGATGCTCTCTGG - Intronic
1115996956 14:39204346-39204368 CTACCATAGTTGATGCTCTCTGG + Intergenic
1116013683 14:39380978-39381000 TTACCACAGGGGCTGCTCTTGGG - Intronic
1116049003 14:39781023-39781045 CTACCACAGCTGATGCTCTCTGG - Intergenic
1116335577 14:43651921-43651943 CTACCACAGCTGATACTCTCTGG + Intergenic
1116346747 14:43803433-43803455 CTACCACAGCTGATGCTCTCTGG + Intergenic
1117386956 14:55224981-55225003 TCACCACAGTTGAGGCACTCTGG + Intergenic
1117510756 14:56448639-56448661 CTACTACAGCTGATGCTTTCTGG - Intergenic
1117639869 14:57786408-57786430 CTACTACAGCTGATGCTCTCTGG + Intronic
1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG + Intergenic
1118162364 14:63302566-63302588 ATACTATAGCTGATGCTCTCTGG + Intergenic
1118532081 14:66718006-66718028 CTACCACAGCTGATACTCTCTGG - Intronic
1119023299 14:71133256-71133278 CCTCCACAGCAGATGCTCTCTGG + Intergenic
1119098500 14:71856569-71856591 CTACCACAGCTGATGCTTTCTGG + Intergenic
1120489636 14:85161167-85161189 CTACCACAGCTGATGCTCCCTGG + Intergenic
1121459898 14:94066477-94066499 ATACTATAGCTGATGCTTTCTGG + Intronic
1121516572 14:94556233-94556255 CTACCACAGCTGATGCTCTCTGG - Intergenic
1123104194 14:105830391-105830413 CTACCACCACTGATGCTCTCTGG - Intergenic
1124380756 15:29162799-29162821 CTACTACAGCTGATGCTTTCTGG + Intronic
1124557170 15:30736596-30736618 CTACCACAGCTGATGCTCCCTGG + Intronic
1124674095 15:31669151-31669173 CTACCACAGCTGATGCTCCCTGG - Intronic
1125055900 15:35358883-35358905 ATACCACAGCTGATGCTCTCTGG - Intronic
1125269370 15:37921467-37921489 CTACTACAGCTGATGCTCTCTGG - Intergenic
1125444703 15:39741465-39741487 TAACCACAGCATATGCTCTTGGG + Intronic
1125993138 15:44129947-44129969 TTCCCCAAGCTGATGTTCTCTGG - Intronic
1126460758 15:48913095-48913117 CTACTATAGCTGATGCTCTCTGG - Intronic
1126572754 15:50169171-50169193 CTACTACAGCTGATGCTTCCTGG + Intronic
1126577534 15:50211126-50211148 CTATTACAGCTGATGCTTTCTGG + Intronic
1126678242 15:51180440-51180462 TGATCACACCTGATGCTCTGGGG - Intergenic
1127008180 15:54594325-54594347 CTACTACAGCTGATGCTTTCTGG - Intronic
1127194504 15:56569033-56569055 CTACCACAGCTGATACTCTCTGG + Intergenic
1128238763 15:66085317-66085339 TTACTATAGCTGATGCTTTCTGG + Intronic
1128415058 15:67437042-67437064 CTACTATAGCTGATGCTTTCTGG + Intronic
1129002933 15:72348979-72349001 TTAGCTCAGCTGCTGCTCTCAGG - Intronic
1129097568 15:73225304-73225326 CTACCACAGCTGATGCTCTCTGG - Intronic
1129944775 15:79529565-79529587 TTCCCAGAGCTGCTTCTCTCTGG + Intergenic
1132210251 15:100016865-100016887 CTACCATAGCTGGTGCTCTCTGG - Intronic
1132392385 15:101448527-101448549 TTACAACAGCTGACGCTTGCTGG + Intronic
1134621271 16:15691305-15691327 TTACCACGTCTGAAGCTCCCAGG - Exonic
1135901621 16:26465046-26465068 CTACTGCAGGTGATGCTCTCTGG + Intergenic
1136406466 16:30050791-30050813 TCACCACAGCTGCTGCTCCTGGG - Intronic
1136735935 16:32467731-32467753 CTACTACAGCTGATGCTTTCTGG - Intergenic
1138797932 16:59993022-59993044 CTACTATAGCTGATGCTTTCTGG - Intergenic
1138881055 16:61015044-61015066 CCACCACAGCTGATGCTCTCTGG + Intergenic
1139987877 16:70915639-70915661 TTACCACAGCTGATGGTCTCTGG - Intronic
1203017140 16_KI270728v1_random:361843-361865 CTACTACAGCTGATGCTTTCTGG + Intergenic
1203035475 16_KI270728v1_random:635001-635023 CTACTACAGCTGATGCTTTCTGG + Intergenic
1143990868 17:10960079-10960101 CTACCATAGCTGATGCTCTCTGG + Intergenic
1144100788 17:11940499-11940521 CTACCCCAGCAGCTGCTCTCAGG + Intronic
1144139643 17:12336389-12336411 CTACTACAGCTGACGCTTTCTGG - Intergenic
1146583431 17:34059985-34060007 CTACTACAGCTGATACTTTCTGG + Intronic
1146751415 17:35384739-35384761 CTACTATAGCTGATGCTTTCTGG - Intergenic
1146950381 17:36901269-36901291 TTGCCACAGTTAATGCTCTGTGG - Intergenic
1147463157 17:40588937-40588959 CTACTACAGTTGATGCTTTCTGG - Intergenic
1148860250 17:50600883-50600905 TTACCGCTGGTGATGCTGTCAGG + Intronic
1149026274 17:52030842-52030864 TTTCCCCACCTGAGGCTCTCAGG + Intronic
1150538992 17:66076697-66076719 GTACCACAGCTGATGCTCTCTGG + Intronic
1150945641 17:69743027-69743049 CTGCCACAGCTGATGCTCTCTGG - Intergenic
1151048429 17:70948388-70948410 CTACCACAGCTGATGCCCTCTGG + Intergenic
1152286801 17:79417305-79417327 GTGCCTCAGCTGAAGCTCTCAGG + Intronic
1152827262 17:82475046-82475068 TTTCCACACCTGATGGTTTCTGG + Intronic
1152953748 18:17778-17800 CTACTACAGCTGATGCTTTCTGG + Intergenic
1153065489 18:1039996-1040018 CTACCATAGCTGATGCTCTCTGG + Intergenic
1153069453 18:1089049-1089071 CTACCACAGCTGATGCTTTCTGG - Intergenic
1153400517 18:4679246-4679268 CTAACACAGCTGATGCTCTCTGG + Intergenic
1156011339 18:32501180-32501202 CTATCACAGCTGATGCTCTCTGG - Intergenic
1156604230 18:38646781-38646803 TTACTACAGGTGATGCTTTAAGG + Intergenic
1156944699 18:42814708-42814730 CTACCACAGCTGATGCTTTCTGG + Intronic
1157218634 18:45807369-45807391 CTACTGCAGCTGATGCTCTCTGG + Intergenic
1157540892 18:48505701-48505723 ATACTACAGCTGATGTTTTCTGG + Intergenic
1157686101 18:49644152-49644174 TAACCACAGCTAATGTTCACTGG + Intergenic
1158331477 18:56367867-56367889 CTACCACGGCTGGTGCTCTCCGG - Intergenic
1158829797 18:61264305-61264327 CTACCACAGCTGATGCTGTCTGG + Intergenic
1158888156 18:61848641-61848663 TTTCCACAGGTGCTGGTCTCTGG - Intronic
1159787121 18:72727349-72727371 CTACTACAGCTGATGCTCTCTGG + Intergenic
1160219725 18:76965885-76965907 CTACCACAGCTGATGCTCTCTGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1164251761 19:23483297-23483319 GTACTACAGCTGATGCTTTCTGG + Intergenic
1166604220 19:44126540-44126562 CTACCACAGCTGATGCTCTCTGG - Intronic
1168224690 19:54986162-54986184 TTTCCCCAGCTGATGCTCATCGG + Exonic
1168458371 19:56533615-56533637 CTGCCACAGCTGGTGCTCTTTGG - Intergenic
925343349 2:3151648-3151670 CTACCACAGCTGATGCTCTCTGG + Intergenic
925756431 2:7136654-7136676 TTACCACTGCTGCTGATCTGTGG + Intergenic
927296762 2:21463844-21463866 TTGCTACCGCTGTTGCTCTCTGG - Intergenic
928356681 2:30622443-30622465 CCACCACAGCTGATGCTTTCTGG + Intronic
928385040 2:30859931-30859953 TTCCCACAGCTGCTGCTTCCCGG - Intergenic
928733771 2:34261876-34261898 CTACCACTGCTGATGCTCTCTGG + Intergenic
928772499 2:34719475-34719497 CTACCATGGCTGATGCTCTCTGG - Intergenic
929722878 2:44389007-44389029 TTACTACAGTTGATGCTCTCTGG - Intronic
931136948 2:59414040-59414062 CGACCACAACTGATGCTCTCTGG - Intergenic
931525182 2:63145256-63145278 TTACTACAGCTGATGCTTTCTGG - Intronic
931547909 2:63409039-63409061 ATACCACAGCTGATGCTCTCTGG + Intronic
932100620 2:68896442-68896464 CTAATACAGGTGATGCTCTCTGG - Intergenic
932270408 2:70403938-70403960 CTACCACAGCTGATACTCTCTGG + Intergenic
933121391 2:78542176-78542198 CTACCATAGCTGATGCTCTCTGG + Intergenic
934177707 2:89591345-89591367 CTACTACAGCTGATGCTTTCTGG - Intergenic
934187102 2:89756840-89756862 CTATTACAGCTGATGCTTTCTGG - Intergenic
934288006 2:91665646-91665668 CTACTACAGCTGATGCTTTCTGG - Intergenic
934309532 2:91851084-91851106 CTACTACAGCTGATGCTTTCCGG + Intergenic
935748029 2:106206254-106206276 CTTGCAGAGCTGATGCTCTCTGG - Intergenic
936122100 2:109755834-109755856 CTTGCAGAGCTGATGCTCTCTGG + Intergenic
936222594 2:110615640-110615662 CTTGCAGAGCTGATGCTCTCTGG - Intergenic
936554948 2:113488005-113488027 CTACCACAACTGACACTCTCTGG + Intronic
937057893 2:118954561-118954583 CTACTACAGCTGATGCTTTCTGG + Intronic
937521826 2:122721133-122721155 CTACCACAGCTGATGCTCCCTGG + Intergenic
937529316 2:122809011-122809033 CTACTACAGCTGATACTCCCTGG + Intergenic
937767591 2:125679992-125680014 CTACCAGAGCTGATGCTGTCTGG - Intergenic
937781951 2:125848678-125848700 CTACCATAGCTGATGCTTTATGG - Intergenic
938497450 2:131807881-131807903 CTACTACAGCTGATGCCTTCTGG + Intergenic
938598222 2:132811268-132811290 CTAATACAGCTGATGCTTTCTGG - Intronic
939769595 2:146299021-146299043 CTACCACAGCTGATGCTTTCTGG + Intergenic
940034679 2:149301562-149301584 CTACTACAGCTAATGCTTTCTGG - Intergenic
940172333 2:150842868-150842890 CTACTACAGCTGATGCTTTCTGG - Intergenic
940290767 2:152075621-152075643 TGACCAGACCTGAGGCTCTCAGG - Intronic
940618651 2:156083631-156083653 CTACTACAGCTGATACTTTCTGG - Intergenic
940802191 2:158145121-158145143 CTATCACAGCTGATGCTCTCTGG + Intergenic
941627472 2:167845234-167845256 CTACCACAGCTGGTGCTCTCTGG + Intergenic
941631585 2:167890956-167890978 CTACCACAGCTGATACTCTCTGG - Intergenic
942579229 2:177398556-177398578 TTACCACATCTGATGTTCCCGGG + Intronic
943129712 2:183840175-183840197 CTACCACAACTGATGCTCTCTGG + Intergenic
944431343 2:199636917-199636939 TTACCACAACTTAATCTCTCAGG - Intergenic
944432043 2:199644541-199644563 CTACCACAGCTGATGCTCTCTGG - Intergenic
944528842 2:200648588-200648610 TTACTACAGCTGATGCTTTCTGG - Intronic
944550379 2:200839711-200839733 TTACCACTGCTGATGATTTAGGG - Intergenic
944874015 2:203943655-203943677 CTATTACAGCTGATGCTTTCTGG - Intronic
945132082 2:206584358-206584380 CTACTACAGCTGATGCTTTCTGG - Intronic
945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG + Intergenic
945864568 2:215161851-215161873 CTACTATAGCTGATGCTTTCGGG + Intergenic
946036494 2:216746438-216746460 CTACTACAGCTGATGCTTTCTGG + Intergenic
946724316 2:222647223-222647245 TGCCCACAGCTGATGGTCACTGG + Intronic
947457043 2:230264967-230264989 ATACCACAGCTGATGCTCTCTGG - Intronic
948447050 2:238040912-238040934 GAGCCACAGCTGCTGCTCTCAGG - Intronic
1169336159 20:4759324-4759346 CTACTACAGCTGATGCTTTCTGG - Intergenic
1169401353 20:5283129-5283151 CTACCACAGCTGATGCTCTCTGG + Intergenic
1170245728 20:14220030-14220052 ATACCACAGCTGATGCTCTCTGG - Intronic
1170506907 20:17035887-17035909 TTACCACACTTGAGGGTCTCAGG + Intergenic
1170720981 20:18879133-18879155 CTACCACAGCTGATGCTCTCAGG - Intergenic
1170836161 20:19886369-19886391 TTACCACAGCAGTCGCTCTTGGG + Intergenic
1171160275 20:22916248-22916270 CTACTGCAGCTGATACTCTCGGG - Intergenic
1171165630 20:22967686-22967708 CTACTACAGCTGATGCTTTCTGG + Intergenic
1171242319 20:23581870-23581892 CTACTATAGCTGATGCTTTCTGG - Intergenic
1173094369 20:40010863-40010885 TTACCCCTCCTGAAGCTCTCAGG + Intergenic
1177140552 21:17353257-17353279 CTACCACAGCTGATGCTCTCTGG + Intergenic
1177174400 21:17689032-17689054 CTACTGCAGCTGATGCTTTCTGG - Intergenic
1177195546 21:17900690-17900712 CTACCACAGCTGATGCTCTCTGG - Intergenic
1177995321 21:28089797-28089819 CCACTACAGCTGATGCTCTCTGG - Intergenic
1178059415 21:28835135-28835157 CTACTACAGCTAATGCTGTCTGG + Intergenic
1178220211 21:30648100-30648122 TTAAGTCAGCTGATGATCTCTGG - Intergenic
1178894821 21:36549627-36549649 TGACAGCAGCTGCTGCTCTCTGG - Intronic
1178959070 21:37047501-37047523 GTACCATAGCTGATGCTCTCTGG + Intergenic
1179233168 21:39523652-39523674 CTACCACAGCTAGTGCTCTTTGG - Intergenic
1180250735 21:46585706-46585728 CTACCACAGCTGATGCTGTCTGG + Intergenic
1180454869 22:15504942-15504964 CTACTACAGCTGATGCTTTCTGG - Intergenic
1180536627 22:16398221-16398243 CTACTACAGCTGATGCTTTCTGG + Intergenic
1180638485 22:17279376-17279398 TTCCCAGAGCTGATGTCCTCAGG - Intergenic
1180638495 22:17279424-17279446 TTCCCAGAGCTGATGTCCTCAGG - Intergenic
1183048331 22:35240253-35240275 CTACTATAGCTGATGCTTTCTGG - Intergenic
1183288700 22:36984403-36984425 TTCCCACAGCACATCCTCTCTGG - Intergenic
1184857219 22:47152886-47152908 CTCCCACAGCTAACGCTCTCAGG - Intronic
949397776 3:3633617-3633639 TTCCCAGAGCTGATGCCCACTGG + Intergenic
949604002 3:5634191-5634213 CTACTACAGCTGATGCTTTCTGG - Intergenic
950603517 3:14057622-14057644 CTACCACAGCTGATGGTCTCTGG - Intronic
951183831 3:19688946-19688968 GTACCACAGCTGATGCACCCTGG + Intergenic
951302632 3:21017391-21017413 GGACCACAGCTGATGTGCTCTGG - Intergenic
951851927 3:27151146-27151168 CTACCATAGCTGATGGTCTTTGG + Intronic
951967161 3:28399424-28399446 CTGCCACAGCTGATGCTCTCTGG + Intronic
952685865 3:36147850-36147872 TTACCACTCCTAATGCACTCCGG - Intergenic
953723919 3:45381392-45381414 CTACCACAGCTGATGCTCTCTGG - Intergenic
954660826 3:52225982-52226004 GCACCACAGCTGGTGCCCTCAGG + Exonic
955175595 3:56611067-56611089 CTACTACAGCTGATGCTTTCTGG - Intronic
955179896 3:56657593-56657615 CTACCCCACTTGATGCTCTCAGG - Intronic
956950301 3:74274294-74274316 CTACCACAGCTGATGCTCTCTGG + Intronic
956995649 3:74824344-74824366 ATACCATAGCTGATGCTCTCTGG - Intergenic
957016363 3:75069303-75069325 CTACCACAGATGATTCTCTCTGG - Intergenic
957971741 3:87390908-87390930 ATACTACAGTTGATGCTCTCTGG + Intergenic
958013843 3:87914834-87914856 CTACCACAGCTGATGCTCTCTGG + Intergenic
958262942 3:91403972-91403994 CTGCTACTGCTGATGCTCTCTGG - Intergenic
958480751 3:94643254-94643276 CTACCACAGCTGAAGCTCTCCGG - Intergenic
958490457 3:94766144-94766166 CTACCACAGCTGATGCTGTCTGG - Intergenic
958505644 3:94973781-94973803 CTACCACAGCTGATGCTTTCTGG + Intergenic
958647064 3:96887593-96887615 CCACCACAGCTGGTGCTCTCTGG - Intronic
958770713 3:98422114-98422136 CTACTACAGCTGATGGTCTCTGG + Intergenic
958969906 3:100600469-100600491 CTACCATAGCTTATGCTCTCTGG - Intergenic
959047000 3:101485249-101485271 CTACCATAGCTGATGCTTTCTGG + Intronic
959275194 3:104269482-104269504 CTACTACAGCTGATGATCCCTGG - Intergenic
959279810 3:104323619-104323641 CTAACACAGCTGATGCTCTCTGG + Intergenic
959899085 3:111639621-111639643 CTACTATAGCTGATGCTTTCTGG + Intronic
959997311 3:112693616-112693638 CTACCACAGTTGATACTCTCTGG + Intergenic
960512816 3:118571469-118571491 TTACTACAGCTGATTCTCTCTGG - Intergenic
962065982 3:131981192-131981214 CTACCACAGCTGATGCTCTCTGG - Intronic
964160681 3:153641226-153641248 CTACTACAGCTGATGCTTTCTGG + Intergenic
964189027 3:153980567-153980589 ATACCACAGCTAATGCTCTTTGG + Intergenic
964601220 3:158503387-158503409 CTACCACAGCTGATGCTCTCTGG - Intronic
965052681 3:163671175-163671197 CTACTACAGCTGATGCTTTCTGG - Intergenic
965216849 3:165874721-165874743 TTACTACAGCTCATGCTTTCTGG - Intergenic
965321858 3:167261329-167261351 CTACCACACCTGATGATCTCTGG - Intronic
965874348 3:173299287-173299309 GTACCACAGCTGATGTTCTCTGG - Intergenic
965952743 3:174330533-174330555 TTACCCCAGCTGCTGCACTCTGG - Intergenic
966020385 3:175202619-175202641 CTACCACAGCTGATGCTCTCTGG - Intronic
967133354 3:186492908-186492930 TGCCCACAGCTGCTGCCCTCGGG + Intergenic
967138307 3:186531132-186531154 TTATCAAAGCAGATTCTCTCAGG - Intergenic
967257489 3:187608833-187608855 ATACCACAGCTAATGCTCTCTGG - Intergenic
967340922 3:188397181-188397203 TTCCCACTGCAGATGCTCTTTGG + Intronic
967399977 3:189049638-189049660 CTACTACAGCTGATGCTTTCTGG + Intronic
970312097 4:14793291-14793313 GTATGACAGCTGATGCTATCTGG + Intergenic
970346546 4:15158602-15158624 CTACTATAGCTGATGCTTTCTGG - Intergenic
970549282 4:17163422-17163444 CTACCACAGCTGATGCTCTCTGG - Intergenic
970658590 4:18260038-18260060 CTACTACAGCTGATGCTTTCTGG - Intergenic
970996128 4:22269110-22269132 CTACCACAGCTGATGCTCTCTGG + Intergenic
971183089 4:24349298-24349320 CTACTGCAGCTGATGCTTTCTGG - Intergenic
971718320 4:30210178-30210200 TTACCACAGTTGATTCTATGAGG + Intergenic
972189042 4:36568442-36568464 CTACCACAGCTGATGCTGTCTGG - Intergenic
972817999 4:42666112-42666134 TGACCCCAGCTTCTGCTCTCTGG - Intergenic
973069122 4:45835488-45835510 CTACTACAGCTGATGATCTCTGG - Intergenic
973179545 4:47251446-47251468 ATACCCCAGCTGATGCTTTTGGG - Intronic
973181148 4:47269893-47269915 TTAACAAACCTGATGCTCTAAGG + Intronic
973703243 4:53556759-53556781 CTAACACAGCAGATGCTCTTTGG - Intronic
973831527 4:54764659-54764681 CTACCACAGCTGATATTCTCTGG - Intergenic
974026889 4:56740893-56740915 TTAGCACATCTGATGCTCTTGGG + Intergenic
974085392 4:57255178-57255200 TTTCTACAACTGATGCTCACTGG + Intergenic
974474408 4:62361398-62361420 CTACCACATCTGATGCTCCCTGG - Intergenic
974951003 4:68582755-68582777 ATACTACAGCTGATGCTTTCTGG + Intronic
975034006 4:69658688-69658710 CTACTACAGCTGATGCTTTCTGG + Intergenic
975517291 4:75260479-75260501 CTACTACAGCTGATGCTTTCTGG + Intergenic
975680242 4:76868520-76868542 GTACCACAGCTGATGCTCTCTGG + Intergenic
975951050 4:79771829-79771851 CTACCACAGCTGAGGCTCTCTGG + Intergenic
976856516 4:89610414-89610436 ATACCACAGCTGATGCTCTGTGG + Intergenic
977019960 4:91746709-91746731 CTACTACAGCCGATGCTTTCTGG - Intergenic
977746811 4:100558878-100558900 CTACTACAGCTGATGCTTTCTGG + Intronic
978670740 4:111244606-111244628 ATACCACAGCTGATGCGTTCTGG + Intergenic
978683842 4:111415414-111415436 CTACCCCTGCTGATGTTCTCTGG - Intergenic
978726653 4:111977434-111977456 ATACCACAGCTGATGCTCTCTGG - Intergenic
978999393 4:115199240-115199262 ATACCACAGCTGATGCTTTCTGG - Intergenic
979498396 4:121411170-121411192 CTACCACAACTGATGCTCTCTGG - Intergenic
979499097 4:121418626-121418648 CTACCACAGCTGATGCTCTCTGG - Intergenic
979561689 4:122108459-122108481 CTATTACAGCTGATGCTTTCTGG + Intergenic
979562961 4:122120687-122120709 CTTCCATAGCGGATGCTCTCTGG - Intergenic
979704887 4:123709495-123709517 CTACTATAGCTGATGCTTTCTGG + Intergenic
979995509 4:127426360-127426382 CTACTACAGCTGATGCTTTCTGG + Intergenic
980237861 4:130131812-130131834 CTACAACAGCTGATGCTTTCTGG + Intergenic
980519259 4:133909908-133909930 GTACTATAGCTGATGCTCTAGGG - Intergenic
980523559 4:133961052-133961074 CTACCACAGCTGATGCTCTCTGG + Intergenic
980878420 4:138685596-138685618 TTAGTGCAGCAGATGCTCTCTGG + Intergenic
981346677 4:143684147-143684169 CTACCACAGCTGATGCTCTCTGG + Intronic
981400944 4:144313404-144313426 CTACCACAGCTGATGCTCTCTGG - Intergenic
981461145 4:145014580-145014602 CTACCACAGCTGATGCTCTCTGG + Intronic
981760754 4:148192480-148192502 CTACTACAACTGATGCTTTCTGG - Intronic
981865151 4:149408805-149408827 TCTCCCCAGCTGATGCTCTCAGG + Intergenic
982075035 4:151730413-151730435 ATACTACAGCTAATGCTCTCTGG + Intronic
982189903 4:152843418-152843440 TTACTACAGCTGATGCTTTCTGG - Intronic
982312119 4:153997177-153997199 CTACCACAGCTGATGCTGTCTGG - Intergenic
982491781 4:156038885-156038907 CTACCACAGCTGCTGCTCTCTGG + Intergenic
982630594 4:157824592-157824614 TTTCCACAACTGATGCTCTCTGG + Intergenic
982680112 4:158418890-158418912 CTACCACAGCTGATGGTCTCTGG - Intronic
983206475 4:164915641-164915663 TGCCCACAGCTGATGGTCACTGG - Intergenic
983212149 4:164969905-164969927 TGCCCACAGCTGATGGTCACTGG + Exonic
983544900 4:168952916-168952938 CTACCACAGCTGATGCCCTCTGG - Intronic
984266670 4:177505245-177505267 CTACTACAGCTGATGTTTTCCGG - Intergenic
984527517 4:180875282-180875304 CTACCACAGCTGATGCTTTCTGG - Intergenic
984686011 4:182668826-182668848 TTACCACAGCTAATCCTCTTGGG + Intronic
984721728 4:182978599-182978621 CTACCACAGCTGATGCTCTCTGG + Intergenic
985008590 4:185559760-185559782 CTACCACAGCTGATGCTTTCTGG - Intergenic
985092941 4:186382109-186382131 CCACCACAGCTGATGCTCTCTGG + Intergenic
985217716 4:187671738-187671760 CTACCACAGCTGATGCTCTCTGG - Intergenic
985355792 4:189117196-189117218 CTACTTCAGCTGATGCTGTCTGG + Intergenic
986870267 5:12036956-12036978 CTACCACAGCTGATGCTCTCTGG + Intergenic
987006008 5:13709953-13709975 CTACCACAGCTGATGCTCTCTGG + Intronic
987577763 5:19752669-19752691 CTAACACAGCTGATGCTCTCTGG + Intronic
987640165 5:20602013-20602035 GAACCACAGCTGATGTGCTCTGG + Intergenic
988902263 5:35745812-35745834 CTACTACAGCTGATGCTCTCTGG + Intronic
989686195 5:44090052-44090074 TCACTACAGCTTGTGCTCTCTGG - Intergenic
990036025 5:51320845-51320867 TTTCAACAGCAGATGCTTTCAGG + Intergenic
990233372 5:53739479-53739501 CTACTATAGCTGATGCTTTCTGG + Intergenic
990572817 5:57095576-57095598 CTACCACAGCTGATGCTCTCTGG + Intergenic
990776187 5:59308761-59308783 CTACCACAGCTGATGCTCTCTGG - Intronic
991117414 5:62970201-62970223 CTACCACAGCTGATGCTCTCTGG + Intergenic
993250301 5:85513104-85513126 CTACTTCAGCTGATGCTCTCTGG - Intergenic
993917083 5:93756366-93756388 CTACTACAGCTGATGTTCTCTGG + Intronic
993964803 5:94347293-94347315 ATACCACAGCTGATGCTCTCTGG + Intronic
994222147 5:97208514-97208536 CTACCACAGCTGAGGCTCTCTGG - Intergenic
994568339 5:101482766-101482788 CTACCACAGCTGATACTCTCTGG - Intergenic
994875344 5:105414138-105414160 CTACCACAGCTGATGTTCTCTGG + Intergenic
994883540 5:105529092-105529114 CTACCATAGCTGATGCTCTCTGG - Intergenic
995472971 5:112523123-112523145 ATACCACAGCTGATGCTCTCTGG - Intergenic
995722543 5:115151521-115151543 CCACCACAGTTGATGCTCTTTGG + Intronic
995817842 5:116191782-116191804 CTACTACAGCTGATGCTCTCTGG + Intronic
995955353 5:117770077-117770099 TAACCACAGCTGATGCTCTCTGG + Intergenic
996124110 5:119705940-119705962 CTACTACAGCTGATACTCTCTGG - Intergenic
996288913 5:121828856-121828878 CTACCACAGCTGATGCTGTCTGG - Intergenic
996325443 5:122267672-122267694 ATACCACAGCTGATGCTTTCTGG + Intergenic
996504752 5:124257018-124257040 CTACTACAGTTGATGCTCTCCGG - Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
997760959 5:136446716-136446738 ATACCACAGCTGATGCCCTCTGG + Intergenic
997857300 5:137383759-137383781 TTTCCACAGCTGCAGCTCTCAGG + Intronic
998940903 5:147280780-147280802 ATACCAAAGCTGATGCTCTCTGG + Intronic
999484778 5:151984826-151984848 CTACCACAGCTGATGCTCTCTGG - Intergenic
1000396351 5:160778587-160778609 TGCCCAGAGCTGATGCTCTCTGG - Intronic
1000757877 5:165183964-165183986 CTACCACAGTTGATGCTCTCGGG - Intergenic
1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG + Intergenic
1001449080 5:171810202-171810224 TTAAAACAGCTGACACTCTCTGG - Intergenic
1002813885 6:660284-660306 CTACTACAGCTGATGCTTTCTGG + Intronic
1003029393 6:2589072-2589094 CTACTACAGCTGATGCTTTCTGG - Intergenic
1003450918 6:6230583-6230605 CTACCACAGCTACTGCTCTCTGG + Intronic
1003581986 6:7348065-7348087 ACTACACAGCTGATGCTCTCTGG + Intronic
1003930446 6:10919575-10919597 CTACCATAGCTGATGCTCTCTGG - Intronic
1004806037 6:19205042-19205064 CTACCGCAGCTGATGCTGTGAGG - Intergenic
1005191394 6:23228323-23228345 CTACTACAGCTGAGGGTCTCTGG - Intergenic
1005672422 6:28120514-28120536 TTACCACAGCAGGTGCTCCAAGG + Intergenic
1005760305 6:28961414-28961436 CTACCACAGTTGATGTTCTCTGG + Intergenic
1008256168 6:49302987-49303009 CTACCACAGCTGATGCTCTCTGG + Intergenic
1008305355 6:49892568-49892590 CTAACACAGCTGATGCTCTCTGG + Intergenic
1008992465 6:57618914-57618936 CTGCTACTGCTGATGCTCTCTGG + Intronic
1009181086 6:60518027-60518049 CTGCTACTGCTGATGCTCTCTGG + Intergenic
1009384100 6:63068473-63068495 CTACTACAGCTGAAGCTTTCTGG - Intergenic
1009798551 6:68503085-68503107 CTACCACAGCTGATGCTCTCTGG + Intergenic
1009968815 6:70604849-70604871 CTACCACAGCTGATGCTTTCTGG + Intergenic
1010165073 6:72905897-72905919 CTGCCACAGATGATGCTCTCTGG - Intronic
1010637872 6:78283099-78283121 CCACCACAGCTGATGCTTTTTGG - Intergenic
1010679364 6:78781432-78781454 CTACTACAGCTGATGCTTTCTGG + Intergenic
1011133108 6:84072575-84072597 CTACCACAGCTGATGCTCTCTGG - Intronic
1011168662 6:84479640-84479662 CTACCATAGCTGATCCTCTCTGG + Intergenic
1011233358 6:85188116-85188138 TTGCTACAGCTGATGCCTTCTGG + Intergenic
1011893268 6:92193911-92193933 CTACCACAGCTGATGCTGTGTGG - Intergenic
1011957982 6:93047294-93047316 TGAGCACAGCTTATGCTCCCAGG - Intergenic
1012155991 6:95820114-95820136 ATACCACAGCTGATGCTCTTTGG + Intergenic
1012225113 6:96694550-96694572 CTACCACAGCTGATGCTCTCTGG + Intergenic
1012737865 6:102973881-102973903 CTACCCCAGTTGATGTTCTCTGG + Intergenic
1012793777 6:103734542-103734564 CTACTACAGTTGATGCTGTCTGG + Intergenic
1013721003 6:113028215-113028237 CTACTATAGCTGATGCTTTCTGG - Intergenic
1013900975 6:115156026-115156048 CTATTACAGCTGATGCTTTCTGG - Intergenic
1014285002 6:119487220-119487242 CTACTACAGCTGATGCTTTCTGG + Intergenic
1014304788 6:119727320-119727342 TTAGCAAAGCTGATGCTCTCTGG - Intergenic
1014336865 6:120147648-120147670 ATACCACAGCTGATGCTTTCTGG + Intergenic
1014531352 6:122563463-122563485 CTCCTACAGCTGATGCTTTCTGG - Intronic
1014603934 6:123448702-123448724 CTACTGCAGCTGATGCTCTCTGG + Intronic
1014738805 6:125124597-125124619 CTTCTACAGCTGATGCTTTCTGG + Intronic
1015362327 6:132354654-132354676 CCACCACAGCTGATGCTCTCTGG - Intronic
1015663275 6:135600242-135600264 CTACTACAGCTGATGCTCTCTGG - Intergenic
1015849754 6:137559963-137559985 CTAGCACAGCTGATGCTCTCTGG - Intergenic
1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG + Exonic
1016289979 6:142518429-142518451 CTACCAGAGCTGATGCTGTCTGG - Intergenic
1016841315 6:148528439-148528461 TTTGCTCAGCTGCTGCTCTCTGG + Intronic
1020634940 7:10685186-10685208 CTACCACAGCTGATGCTCTCAGG + Intergenic
1020860819 7:13489721-13489743 CTACTATAGCTGATGCTCTCTGG + Intergenic
1022777667 7:33544693-33544715 CTACTACAGCTGATGCTTTCTGG - Intronic
1023213352 7:37832366-37832388 TTATCACAGCTGAGGCTTCCTGG + Intronic
1024545523 7:50513964-50513986 CTACTACAGCTGATGCTCTCTGG + Intronic
1024669254 7:51577321-51577343 CTACTACAGCTGATGCTCTCTGG - Intergenic
1024745325 7:52399789-52399811 CTGTCAAAGCTGATGCTCTCTGG - Intergenic
1024917192 7:54515064-54515086 CTACCACAGGTGATGCTTTCTGG - Intergenic
1025772828 7:64528813-64528835 CTACCACAGCTGATGCTCTCTGG + Intronic
1027295413 7:76764376-76764398 CTACTACAGCTGATGCTTTCTGG + Intergenic
1027417612 7:77990061-77990083 CTACCACAGCTGATGCTCTCTGG - Intergenic
1027699255 7:81449531-81449553 CTACCATAGCTGAGGCTCTCTGG + Intergenic
1028182923 7:87747483-87747505 CTACCACAGCTGATGCTCTCTGG - Intronic
1028962199 7:96761655-96761677 CTACCACAGTTGATGCTCTCTGG - Intergenic
1030007775 7:105135432-105135454 TTCCCTCTGCTGCTGCTCTCTGG - Intronic
1030325243 7:108211894-108211916 CTACCAGAACTGATACTCTCTGG + Intronic
1030936030 7:115585539-115585561 CTACTAGAGCTGATGCTTTCTGG + Intergenic
1031761216 7:125715812-125715834 TTACTACAGCTGATGCTTTCTGG - Intergenic
1031879258 7:127177489-127177511 CTACTACAGCTGATGCTTTCTGG + Intronic
1032361445 7:131259213-131259235 TTCCCAGAGGTGATGCACTCTGG - Intronic
1032815058 7:135465112-135465134 TTTCCTAAGCTGCTGCTCTCTGG + Intronic
1033816687 7:145082584-145082606 CTACCACAGCTGATGCTCTCTGG - Intergenic
1034008671 7:147504236-147504258 CTCCCACAGCAGCTGCTCTCAGG - Intronic
1034339253 7:150341436-150341458 TTTCCACATCTGTCGCTCTCCGG - Exonic
1034581812 7:152050279-152050301 TTACCACTGCTGATGATTTGGGG + Intronic
1034683160 7:152946825-152946847 ATACCATAGCTGATGTTCTCTGG - Intergenic
1036047607 8:5161105-5161127 TTACCTTAGCTGCTGCTTTCTGG + Intergenic
1036837579 8:12088564-12088586 CTACTACAGCGGATGCTTTCTGG - Intergenic
1036859373 8:12334812-12334834 CTACTACAGCGGATGCTTTCTGG - Intergenic
1037581419 8:20247914-20247936 TAGCCACAGCTGCTGTTCTCAGG - Exonic
1037713562 8:21376344-21376366 ATCCCATGGCTGATGCTCTCTGG - Intergenic
1037896180 8:22657886-22657908 GTACCAAGGCTGCTGCTCTCAGG - Intronic
1038237118 8:25769691-25769713 CTACTACAGCTGATGCTTTCTGG + Intergenic
1038367170 8:26948247-26948269 CCACCACAGCTGATGCTCTCTGG - Intergenic
1039083253 8:33755173-33755195 CTATCACAGCTGATGCTCTCTGG - Intergenic
1039095513 8:33880725-33880747 TTACCACAGCTGATGCTCTCTGG - Intergenic
1039123614 8:34175826-34175848 GTACCACAGCTCATGCTCTCTGG + Intergenic
1039571865 8:38593196-38593218 TTGCCACCTCTGATGCTCTCTGG + Intergenic
1039641500 8:39227820-39227842 CTACCACAGCTGATGCTCTCTGG + Intronic
1041227803 8:55717334-55717356 CTACTGCAGCTGATGTTCTCTGG + Intronic
1041364209 8:57083767-57083789 CTACCACAGCTGATGCTCTCTGG + Intergenic
1041570512 8:59332922-59332944 CTACCACAGCTGATGCTCTCTGG - Intergenic
1041637140 8:60156660-60156682 CTAACACAACTGATGCTTTCTGG + Intergenic
1041819067 8:62009066-62009088 TCACCACAGTTGAAGCTCACCGG - Intergenic
1041877948 8:62712237-62712259 CTACCATAGCTGATATTCTCTGG - Intronic
1042304105 8:67313761-67313783 CTACTACAGCTGATGCTTTCTGG - Intronic
1042467092 8:69140658-69140680 TTACTACAGTTGATGCTTTCTGG - Intergenic
1043040825 8:75259821-75259843 CTACCACAGCTGATGCTCTCTGG + Intergenic
1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG + Intergenic
1043816845 8:84812430-84812452 CTACCACAGCTGATGCTCCCTGG - Intronic
1044227644 8:89737161-89737183 CTACCACAGCTGATGCCCTCTGG + Intergenic
1045779863 8:105849969-105849991 ACACTACAGCTGATGCTTTCTGG + Intergenic
1046074451 8:109299743-109299765 CTACCACAGCTGATGCTCTCTGG + Intronic
1046929895 8:119831673-119831695 TTACCACAACAGATTTTCTCTGG + Exonic
1047032395 8:120896564-120896586 CTACTACAGCTGATGCTTTCTGG + Intergenic
1047130721 8:122017269-122017291 TTACTATAGCTGATGCTTTCTGG - Intergenic
1048248628 8:132837869-132837891 TGAACACAGCTGATACACTCTGG - Intronic
1048342772 8:133553726-133553748 TAATCACAGCTGATGTTTTCTGG - Intronic
1049566341 8:143341092-143341114 TCCCCACAGCTGAGGGTCTCAGG + Intronic
1049898058 9:129179-129201 CTACCACAACTGACACTCTCTGG - Intronic
1050147423 9:2583812-2583834 TTACTACATCTGATGCTTTCAGG + Intergenic
1050502724 9:6315446-6315468 CTACTATAGCTGATGCTTTCTGG + Intergenic
1051362716 9:16295056-16295078 CTACTACAGCTGATGCTCTCTGG + Intergenic
1051500809 9:17775838-17775860 TGAACACAGCTGATGCACTTGGG - Intronic
1052246915 9:26347212-26347234 CTACCATAGCTGATGCTCTCTGG + Intergenic
1052731420 9:32291060-32291082 CTACTATAGCTGATGCTTTCTGG - Intergenic
1052894628 9:33735428-33735450 CTACCATAGCTGATGCTCTCTGG + Intergenic
1053020933 9:34693516-34693538 TTACCACATCTGAGACTCTGAGG + Intergenic
1053741136 9:41139477-41139499 CTACCACAACTGACACTCTCTGG - Intronic
1054346346 9:63968966-63968988 CTACCACAACTGACACTCTCTGG - Intergenic
1054444122 9:65295616-65295638 CTACCACAACTGACACTCTCTGG - Intergenic
1054486150 9:65725889-65725911 CTACCACAACTGACACTCTCTGG + Intronic
1054687213 9:68291820-68291842 CTACCACAACTGACACTCTCTGG + Intronic
1055346948 9:75349869-75349891 CTACTACAGTTGAGGCTCTCTGG - Intergenic
1056322693 9:85451896-85451918 CTACTGCAGCTGATGCTTTCTGG - Intergenic
1056699008 9:88886911-88886933 CTACTACAGCTGATGCTTTCTGG - Intergenic
1057003862 9:91538203-91538225 CTACCACAGCTGATGCTTTCTGG + Intergenic
1058085003 9:100739569-100739591 CTACCACAGCTGATGCTTTCTGG - Intergenic
1058308370 9:103471174-103471196 TTACTACAGCTGATGCTTTCTGG - Intergenic
1058410436 9:104725199-104725221 CTACTACAGCTGATGCTTTCTGG + Intergenic
1059609569 9:115878154-115878176 CTACTACAGCTGATGCTCTCTGG - Intergenic
1059919964 9:119149125-119149147 TTTCCACAGCTGGTGCACTACGG - Intergenic
1060480989 9:124016804-124016826 CTACCACAGATGTAGCTCTCTGG + Intronic
1061603961 9:131694334-131694356 GTGACACAGCTGATGCTTTCTGG - Intronic
1062592279 9:137279735-137279757 CTGCCACAGCGGATGCTCCCGGG - Exonic
1186849588 X:13567636-13567658 GTACCACAGTTGAAGCTTTCAGG + Intergenic
1187681453 X:21771200-21771222 ATACCACAGCTGATGCTCTCTGG + Intergenic
1187748421 X:22433834-22433856 CTACTACAGCTGATGCTTTCTGG + Intergenic
1188030515 X:25258456-25258478 TGATCTCAGCTTATGCTCTCTGG - Intergenic
1188045863 X:25425944-25425966 CTACCACAGCTTATGCTCTCTGG - Intergenic
1189218201 X:39345194-39345216 CTACTATAGCTGATGCTTTCTGG + Intergenic
1189603217 X:42648971-42648993 CTACCACAGCTGATGCTCTCTGG + Intergenic
1189879147 X:45471213-45471235 CTACCACAGCTGATGCTCTCTGG - Intergenic
1190895443 X:54613924-54613946 TTACTATAGCAGATGCTTTCTGG - Intergenic
1191067587 X:56366989-56367011 CTACTACAGCTGATGCTTCCTGG - Intergenic
1191080395 X:56504474-56504496 CTAGCATAGCTGATGCTCTCTGG + Intergenic
1191080680 X:56506259-56506281 CTACCACAGCTGATGCTGTCTGG + Intergenic
1191151785 X:57227648-57227670 CTACTACAGCTGATGTTTTCTGG - Intergenic
1191779841 X:64853806-64853828 TTGCTACAGCTGCTGCTTTCTGG - Intergenic
1191988722 X:67009652-67009674 TTACCCCAACTGGTGTTCTCTGG + Intergenic
1192069031 X:67917915-67917937 CTACCACAGCTGATGCTCTCTGG - Intergenic
1192820249 X:74637291-74637313 CTGCCATAGCTGATGCTCTCTGG + Intergenic
1192881069 X:75284799-75284821 CTACTACAGGTGATGCTCTCTGG - Intronic
1192914486 X:75638081-75638103 GTACTACAGCTGATGCTATCTGG - Intergenic
1192929614 X:75792060-75792082 GTACCACAGCTGATGCTCTCAGG + Intergenic
1192968149 X:76202179-76202201 CTACCACAGCTGATGCTCTCTGG - Intergenic
1193154636 X:78159053-78159075 CTACTACAGCTAATGCTTTCTGG + Intergenic
1193253365 X:79319308-79319330 CTACTACAACTGATGCTTTCTGG - Intergenic
1193389890 X:80913943-80913965 CTACCACAGCTGATGCTTTCTGG - Intergenic
1193420846 X:81280318-81280340 ATACTACAGCTGATGGTTTCTGG + Intronic
1193578551 X:83232984-83233006 CTACCACAGCTGATGCTCTCTGG + Intergenic
1193643854 X:84043849-84043871 CTACTACAGTTGATGCTTTCTGG - Intergenic
1193779616 X:85686061-85686083 CTACTACAGCTGGTGCTTTCTGG - Intergenic
1193785975 X:85760333-85760355 CTGCCACAGCTGATGCTCTCTGG - Intergenic
1193826273 X:86231275-86231297 CTACTACAGCTGATGCTTTTTGG - Intronic
1193937660 X:87642032-87642054 CTACCATAGCTGATGCTTTCTGG + Intronic
1194543432 X:95203323-95203345 CTACTATAGCTGATGCTCTCTGG - Intergenic
1194701458 X:97119553-97119575 CTACCACAGCTGATGCTCTATGG - Intronic
1194926883 X:99836352-99836374 CTACTACAGCTGATTCTTTCTGG - Intergenic
1195019440 X:100812260-100812282 CTACTACAGCTGATGCTTTCTGG - Intergenic
1195075914 X:101326866-101326888 CTATCACAGCTGATGCTCTCTGG + Intergenic
1195795492 X:108642378-108642400 CTACCACAGCTGATGCTTTCTGG + Intronic
1196119984 X:112039530-112039552 CTAACTCAGCAGATGCTCTCTGG + Intronic
1196218937 X:113088550-113088572 ACACTACAGCTGATGCTTTCTGG + Intergenic
1196530673 X:116782711-116782733 CTACTGTAGCTGATGCTCTCTGG + Intergenic
1196590455 X:117481342-117481364 CTACTACAGCTGATGCTCTCTGG - Intergenic
1196737526 X:118992661-118992683 CTACCACAGCTGTTGTTTTCTGG + Intronic
1196948236 X:120850090-120850112 CTACCACAGCTGATGCTCTCTGG - Intergenic
1197066201 X:122237098-122237120 ATTCCACAGCTGATGTTCTCTGG - Intergenic
1197132440 X:123020306-123020328 TTTCTACAGCTAATGCTCTCTGG + Intergenic
1197518947 X:127473316-127473338 CTACCACAGGTGATGCTCTCTGG + Intergenic
1197664575 X:129210243-129210265 CTACCACACCTGATGCTCTCTGG - Intergenic
1197669048 X:129255729-129255751 CTACCACAGCTGATGCTTTCTGG - Intergenic
1197671618 X:129284227-129284249 CTACCATAGCTGATGCTCTCTGG - Intergenic
1197953734 X:131924025-131924047 CTACTACAGCTGATGCTTTCTGG + Intergenic
1199057822 X:143318908-143318930 CTACCACAGCTGATGCTCTCTGG - Intergenic
1199077077 X:143536341-143536363 CTGCCACAGCTGGTGCTCTTTGG + Intergenic
1199474765 X:148232832-148232854 TTTCCCCAGCTGAGGCTTTCTGG - Intergenic
1199668564 X:150121427-150121449 CTAGCACAGCTGATGCTCTCTGG + Intergenic
1201315835 Y:12644349-12644371 CTATCACAGCTGATGCTCTCTGG + Intergenic
1201408484 Y:13673335-13673357 CTACCACAGCTGATGCTCTCTGG + Intergenic
1201418127 Y:13768807-13768829 TTAACATACCTGAAGCTCTCTGG - Intergenic
1201634683 Y:16109466-16109488 CTAACACTGCTGATGCTATCAGG - Intergenic