ID: 1115269202

View in Genome Browser
Species Human (GRCh38)
Location 14:31533006-31533028
Sequence GCAAATCATGCACCCAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115269202_1115269205 0 Left 1115269202 14:31533006-31533028 CCCTCATTGGGTGCATGATTTGC 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1115269205 14:31533029-31533051 AGAATTTCTCCCCATCCTGTGGG 0: 1
1: 0
2: 1
3: 50
4: 861
1115269202_1115269204 -1 Left 1115269202 14:31533006-31533028 CCCTCATTGGGTGCATGATTTGC 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1115269204 14:31533028-31533050 CAGAATTTCTCCCCATCCTGTGG 0: 1
1: 0
2: 2
3: 24
4: 219
1115269202_1115269210 21 Left 1115269202 14:31533006-31533028 CCCTCATTGGGTGCATGATTTGC 0: 1
1: 0
2: 2
3: 32
4: 326
Right 1115269210 14:31533050-31533072 GGTTGTCTTTATTTTCTTGTTGG 0: 1
1: 0
2: 5
3: 56
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115269202 Original CRISPR GCAAATCATGCACCCAATGA GGG (reversed) Intronic
904685047 1:32253627-32253649 GCAAATGATGCACCAAAGGGAGG + Intronic
904860022 1:33529866-33529888 GCAAATCATGTACCTTATAAAGG + Intronic
905195881 1:36276917-36276939 GCAAGTCATACATCCAATAAGGG + Intronic
905511461 1:38524553-38524575 GCAAATCATGTACCTGATAAGGG - Intergenic
906507049 1:46388068-46388090 GCAAATCATCCACATACTGAAGG + Intergenic
907501069 1:54881216-54881238 GCAAATCATGAATCTAATAAAGG + Intronic
909414683 1:75392261-75392283 GCAAACTATGCACCCAACAAAGG + Intronic
909456234 1:75852768-75852790 GCAAATCATATATCCAATAAGGG - Intronic
910313358 1:85853867-85853889 GCAAATTATGCATCCAACAAAGG - Intronic
911136158 1:94443363-94443385 GCAAACTATGCATCCAATAAAGG - Intronic
911245218 1:95509385-95509407 GAAAGTCATGGACCCATTGAAGG + Intergenic
911630921 1:100182625-100182647 GCAAATCATACATCCGATAAGGG - Intergenic
913433273 1:118819436-118819458 GCAAATTATGCATCCAACAAAGG + Intergenic
914501127 1:148247318-148247340 GTAAATCATGTACCAACTGAGGG - Intergenic
917149092 1:171925608-171925630 GCAAACTATGCATCCAATAAAGG - Intronic
918365271 1:183801398-183801420 GCAAATCATGTATCTAATAAGGG - Intronic
919492200 1:198218656-198218678 GCAAATTATGAACCCAACAAAGG + Intronic
919584955 1:199425794-199425816 GCAAGCCATGCATCCAATAAAGG + Intergenic
921044556 1:211465575-211465597 GCAAATGATACATCCAATAAGGG + Intergenic
921150939 1:212402563-212402585 GCAAATCATACACCTGATAAGGG - Intronic
921462161 1:215442254-215442276 GCAAACTATGCATCCAACGAAGG - Intergenic
922640742 1:227228922-227228944 GCAAATCATGTATCTGATGAGGG - Intronic
922783332 1:228270027-228270049 GCAAACAATGCAACAAATGAGGG - Intronic
923828503 1:237526726-237526748 TCAAATTATGCCCCCAATGAAGG - Intronic
924070155 1:240268957-240268979 GCAAATCATGCACTGAATAGGGG - Intronic
924353207 1:243139456-243139478 GCAAAACATACAGCCTATGAAGG - Intronic
924436071 1:244044209-244044231 GAAAAAAATGCACACAATGATGG - Intergenic
1062946149 10:1463771-1463793 GCAAATCACACAGCCAATGCTGG + Intronic
1063319560 10:5040118-5040140 GCAAATCCTACACACAATGGTGG + Intronic
1064272245 10:13875965-13875987 GCAAAAAATAGACCCAATGAGGG + Intronic
1064949469 10:20831991-20832013 GCAAATTAGGGAGCCAATGAAGG - Intronic
1065146472 10:22773364-22773386 GCAAATTATGCATCCAACAAAGG - Intergenic
1065182612 10:23141992-23142014 ACAAACAATGCACCCAATAAAGG + Intergenic
1065975425 10:30837542-30837564 GCAAACCATGCATCTAATAAAGG + Intronic
1066356794 10:34692494-34692516 GCAAATTATGCATCCAACAAAGG + Intronic
1067008017 10:42682970-42682992 GCAAATGATTCAACCAAAGAAGG + Intergenic
1067331112 10:45319995-45320017 GCAAATTATGCACCCAACAAAGG - Intergenic
1070460518 10:76664451-76664473 TCAAATCATGCATCTAATAAGGG + Intergenic
1070921943 10:80193096-80193118 GAAAATCAGGCCCCCAAGGAGGG + Intronic
1071363206 10:84871723-84871745 GCAAATTATGCATCCAACAAGGG + Intergenic
1071454168 10:85830556-85830578 GCAAACTATGCATCCAATAAAGG + Intronic
1071808311 10:89148790-89148812 ACAAAACATGCATCCAATAAAGG - Intergenic
1072368398 10:94738693-94738715 GCAAACTATGCACCCAACAAAGG - Intronic
1072489834 10:95893991-95894013 GCAATCTATGCATCCAATGAAGG + Intronic
1073244909 10:102082974-102082996 TCCAAGCATGCAGCCAATGATGG + Intergenic
1074029561 10:109672525-109672547 GCAAATTATGCATCCAACAAGGG + Intergenic
1074128800 10:110554482-110554504 GCAAATCATGTACCTGATAAGGG + Intergenic
1075187999 10:120280554-120280576 GCAAACTATGCAACCAATGAAGG + Intergenic
1075957998 10:126541437-126541459 GCAAATCATATACCAAATAAAGG + Intronic
1078036348 11:7809451-7809473 GCAAACTATGCATCCAATGAAGG + Intergenic
1080089528 11:28328864-28328886 GCAAATCATACATCTAATAAGGG - Intronic
1080675734 11:34424799-34424821 GCAAACCATGCATCCAACAAAGG + Intergenic
1081022621 11:37966879-37966901 GCAAACTATGCATCCAATAAAGG + Intergenic
1081131911 11:39391012-39391034 GCAAATTATGCATCCAACAAAGG - Intergenic
1081750052 11:45503753-45503775 GCAAATCATGTACCTGATAAAGG - Intergenic
1082209142 11:49476313-49476335 GCAAATGATGCTACCACTGAAGG + Intergenic
1082619579 11:55403338-55403360 CCAAATGCTGCACACAATGAAGG + Intergenic
1083510105 11:63201747-63201769 GCAAACTATGCATCCAATAAAGG + Intronic
1086057881 11:82668896-82668918 GCAAATTATGCATCCAACAATGG - Intergenic
1086227541 11:84530382-84530404 GCAAACTATGCATCCAATAAGGG + Intronic
1086313675 11:85566247-85566269 GCAAATCATGCATCTGATAAGGG - Intronic
1087436481 11:98125320-98125342 GCAAATTATGCATCCAACAAAGG - Intergenic
1089015034 11:115158581-115158603 TAAAATCATTCACCAAATGAAGG + Intergenic
1090630427 11:128642517-128642539 GCAAACTATGCATCCAATAAAGG + Intergenic
1090637202 11:128696898-128696920 GCAAATTATGCACAAAATAAAGG - Intronic
1090842195 11:130500119-130500141 TTAAATCATTCACCCACTGAAGG + Intergenic
1091012504 11:132017039-132017061 GCAAATCATACAGCTAATAAAGG - Intronic
1091709514 12:2728419-2728441 GCAAACTATGCACCCAACAAAGG - Intergenic
1092734359 12:11566376-11566398 GCAAATCATATAACCAATAAGGG - Intergenic
1092779785 12:11974986-11975008 GCAAATCATATACCCGATAAGGG + Intergenic
1092982093 12:13806620-13806642 GCAAATCATACATCTAATAAAGG - Intronic
1093150287 12:15612499-15612521 GCAAATTATGCATCCGACGAAGG - Intergenic
1093481702 12:19610830-19610852 GCAAATTATGCATCCAACAAAGG - Intronic
1093498734 12:19785449-19785471 GCAAACTATGCATCCAATAAAGG - Intergenic
1093655811 12:21693261-21693283 GCAAACTATGCACCCAACAAAGG + Intronic
1093719453 12:22422235-22422257 GCAAACTATGCACCCAACAAAGG + Intronic
1093719952 12:22428875-22428897 GCAAACTATGCACCCAACAAAGG + Intronic
1095109774 12:38280363-38280385 TAAAATCATTCACCAAATGAGGG - Intergenic
1095571651 12:43689765-43689787 GCAAACTATGCATCCAATAAAGG + Intergenic
1097594015 12:61605239-61605261 GCAAACCATACATCCAATAAGGG - Intergenic
1098457963 12:70697461-70697483 GCAAATCATGTATCTAATAAGGG - Intronic
1098734660 12:74084145-74084167 GCAAATCATACATCCAATAAGGG - Intergenic
1099252921 12:80280198-80280220 GCAAATTATGCACCCTACAAAGG - Intronic
1101075251 12:101122291-101122313 GCAAACTATGCACCCAATAAAGG - Intronic
1101779777 12:107824823-107824845 GCAAATCATCCACATACTGAAGG - Intergenic
1102782580 12:115578122-115578144 GCAAATCATGCATCTGATGAGGG + Intergenic
1102859900 12:116326719-116326741 GCACAGCATGCACTCAATAATGG + Intergenic
1103169378 12:118801117-118801139 GCAAATCATATATCCAATAAAGG - Intergenic
1103809373 12:123601710-123601732 GCAAAACAGGCACCCGCTGATGG - Intergenic
1105282204 13:18972779-18972801 GCAAATCAAATACACAATGAGGG + Intergenic
1105464256 13:20622729-20622751 GCAAATCATGCATCTGATAATGG - Intronic
1106126718 13:26906171-26906193 GCAAATCACCCACCCGATAAGGG - Intergenic
1109103553 13:58219140-58219162 GCAAATCATGTACCTAATAAAGG + Intergenic
1109504538 13:63283136-63283158 GCAAACTATGCATCCAACGAAGG - Intergenic
1109663193 13:65492714-65492736 GCAAATTATGCATCCAACAAAGG + Intergenic
1110803708 13:79730604-79730626 GCAAACCATGCATCCAACAAAGG - Intergenic
1111480452 13:88817460-88817482 GCAAATCATACACCTAATAAAGG + Intergenic
1114387987 14:22275117-22275139 GCAAACCATGCATCCAACAAAGG - Intergenic
1114541539 14:23463846-23463868 GCAAATCATGTATCTAATAAGGG + Intergenic
1115269202 14:31533006-31533028 GCAAATCATGCACCCAATGAGGG - Intronic
1116131377 14:40859082-40859104 GCAAATCATGCTTCAGATGATGG + Intergenic
1116563718 14:46417911-46417933 GCAAAGCATGCATCTAATAAAGG + Intergenic
1119408980 14:74417024-74417046 ACAAAACAAGCACCCAATAATGG - Intronic
1120214402 14:81666623-81666645 GTAATTCATGCACAAAATGATGG - Intergenic
1120920889 14:89754670-89754692 GCAAATCATGCATCCAACCAAGG + Intergenic
1122419945 14:101569444-101569466 GCAAACCATGCATCTGATGAGGG + Intergenic
1122728074 14:103773044-103773066 GCAAATCATGTACCTGATAAAGG - Intronic
1123575715 15:21665973-21665995 GCAAACTATGCACCCAACAAAGG + Intergenic
1123612335 15:22108446-22108468 GCAAACTATGCACCCAACAAAGG + Intergenic
1124154188 15:27210636-27210658 GCAGAACATGCACTCAGTGATGG + Intronic
1126019458 15:44385940-44385962 GCAAATCATACACCTGATTAGGG - Intronic
1126464866 15:48952522-48952544 GCAAACTATGCACCCAACAAAGG + Intronic
1126898680 15:53287886-53287908 ACAAATCATTCACTCCATGATGG - Intergenic
1127771651 15:62236166-62236188 GCAAAACATGCACAAAATGTAGG - Intergenic
1127955933 15:63853545-63853567 GCAAATTATGCATCCAACAAAGG + Intergenic
1128864973 15:71108024-71108046 CCAAAGCATGCAGCCAATGCAGG + Intronic
1131565006 15:93477968-93477990 GCAATTCCTGCTCCCAAGGAGGG + Intergenic
1131961832 15:97797284-97797306 GCAAATCAGGCACATAATAATGG - Intergenic
1202984583 15_KI270727v1_random:400218-400240 GCAAACTATGCACCCAACAAAGG + Intergenic
1134263009 16:12668578-12668600 GCAAATCATGTATCTAATAAGGG + Intronic
1134899177 16:17919622-17919644 GCCAATCATACACCTTATGAGGG + Intergenic
1136098255 16:27974318-27974340 CAAAATCTTGCACCCAGTGAGGG + Intronic
1136651166 16:31672830-31672852 GCAAACCATGCATCCAGCGAAGG - Intergenic
1137235142 16:46610384-46610406 TCCAATCAGGCACCAAATGAGGG + Intronic
1139138034 16:64228562-64228584 GTAAATGATGCACTCAATAAGGG + Intergenic
1139731097 16:68946062-68946084 GCAAATCATGCATCTGATAAAGG - Intronic
1140788787 16:78369498-78369520 GCACAACATGCAACCAAGGAGGG + Intronic
1140914552 16:79482742-79482764 TCTAACCATGCACCCAATGAGGG + Intergenic
1142922687 17:3204511-3204533 GCAAACTATGCATCCAATGAAGG - Intergenic
1144642814 17:16947438-16947460 GCAAACTATGCACCCAACAAAGG + Intronic
1144885841 17:18460430-18460452 GCAAATCCTGCAGCTATTGAAGG + Intergenic
1145146371 17:20483942-20483964 GCAAATCCTGCAGCTATTGAAGG - Intergenic
1145946673 17:28780949-28780971 GCAAACCATACATCCAATAAGGG + Intronic
1149129644 17:53283036-53283058 GCAAATCAAACACTCACTGAGGG - Intergenic
1150318903 17:64193354-64193376 CCAAATCATTTAACCAATGATGG - Intronic
1150894097 17:69189423-69189445 GCAAACTATGCACCCAACAAAGG - Intronic
1153503919 18:5775779-5775801 GCAAATCATATACCCAGTAAGGG - Intergenic
1153657383 18:7295098-7295120 GCAAATCATGTATCTAATAAGGG - Intergenic
1154112044 18:11578676-11578698 CAAAATCATGCAGCCAGTGAGGG + Intergenic
1155463293 18:26107845-26107867 GCAAACTATGCATCCAATGAAGG - Intergenic
1155812188 18:30250878-30250900 GCAAAGAATGGATCCAATGAGGG + Intergenic
1155996449 18:32335775-32335797 GGAAATCATGCATCTAAAGAAGG - Intronic
1156887041 18:42147296-42147318 ACAAATGATGCACCCAACAAAGG + Intergenic
1157604268 18:48915849-48915871 GCAAATCACTCACCCATTGGAGG + Intergenic
1158214191 18:55082278-55082300 GCAAATCATACATCCAACAAAGG + Intergenic
1158656767 18:59343882-59343904 GCAAACTATGCATCCAACGAAGG + Intronic
1163199402 19:15753637-15753659 GCAAACCATGCATCTGATGAAGG - Intergenic
1163813040 19:19446435-19446457 GCAAATCATACACCTGATAAGGG - Intronic
1166251516 19:41574430-41574452 GCAAATCATGTACCCCATAAGGG + Intronic
1166601501 19:44099254-44099276 GCACTTCAGGCACCCAAGGACGG + Intronic
925564998 2:5241838-5241860 GGAAATTATGAACGCAATGAAGG - Intergenic
927383394 2:22505042-22505064 CCAAATCATGAAGTCAATGATGG + Intergenic
927629302 2:24758075-24758097 TCAGAACATGAACCCAATGATGG + Exonic
929092630 2:38234581-38234603 GCAAACTATGCATCCAGTGAAGG + Intergenic
929154370 2:38776194-38776216 GCCAATCATGCAACGAATAAAGG + Intronic
929398685 2:41554041-41554063 GCAAACTATGCACCCAACAAAGG - Intergenic
929815366 2:45226610-45226632 GCAAATCATCTACCTAATAAGGG - Intergenic
930556492 2:52902347-52902369 GCAAACTATGCACCCAACAAAGG + Intergenic
930900257 2:56497855-56497877 GCATACTATGCACCCAACGATGG - Intergenic
932643124 2:73471427-73471449 GCAAACCATGTATCTAATGAGGG + Intronic
933343728 2:81055528-81055550 GCAAATATTCCTCCCAATGAGGG + Intergenic
933609423 2:84418234-84418256 CCAAATCATGCAGGCAGTGAAGG + Intergenic
933988509 2:87614989-87615011 GCAAATCATAAACCCAATACAGG + Intergenic
935157867 2:100499499-100499521 ACAAACTATGCATCCAATGAAGG - Intergenic
935350105 2:102145228-102145250 GCAAACCAAGCACCCATTCACGG - Intronic
936305331 2:111335822-111335844 GCAAATCATAAACCCAATACAGG - Intergenic
936408311 2:112228820-112228842 GCAAATCATGTATCTAATAAAGG + Intronic
937754614 2:125521504-125521526 GCAAATCATGCATCTAACAAAGG + Intergenic
938502698 2:131839348-131839370 GCAAACTATGCACCCAACAAAGG + Intergenic
941074672 2:160993182-160993204 GCACATAATGCATTCAATGAAGG - Intergenic
941096699 2:161245212-161245234 GCAAACAATGCAACAAATGAGGG - Intergenic
944788668 2:203100958-203100980 GCAAACCATGCATCCAACAAAGG - Intronic
945215243 2:207426760-207426782 GCAAATCATGTACCTGATAAGGG + Intergenic
947363797 2:229373184-229373206 GCAAATGATGCATCCAAGAAAGG + Intronic
947897262 2:233687188-233687210 GCATATCACCCACCCAATTACGG - Intronic
948296452 2:236864224-236864246 GGAAATCATGCATCCATTGAGGG + Intergenic
948500931 2:238393433-238393455 GCAAATCACACATCCAATAAAGG - Intronic
1168741693 20:197544-197566 GCAAATTATGCATCCAACAAAGG + Intergenic
1169657919 20:7945866-7945888 GCAAATTATGCGTCCAATAAAGG - Intergenic
1169891290 20:10455135-10455157 GCAAATCATACATCTGATGAAGG - Intronic
1175787506 20:61721212-61721234 GCAAAGCATGCTCTCAGTGAAGG - Intronic
1179121797 21:38553919-38553941 GCAAATTATGCATCCAACAAAGG + Intronic
1179443715 21:41416212-41416234 GCAAACTATGCAGCCAACGAAGG + Intergenic
1180191607 21:46168032-46168054 GCAAAACATACACCCAAAAAAGG + Intronic
1182885420 22:33769770-33769792 GCAAAGCATGTACCCAACTAAGG + Intronic
949463219 3:4316760-4316782 GCCAATCTTGCACCCAAAAAAGG + Exonic
951821649 3:26820596-26820618 GCAAATCATGCATCCAAAAAAGG - Intergenic
954379703 3:50213054-50213076 GCAATTCCTGGACCCAGTGATGG + Intronic
956024307 3:64965988-64966010 GCAAATCATACACCTGATAAGGG - Intergenic
957197964 3:77094938-77094960 GCAAATCATATACCCAATAATGG - Intronic
957592416 3:82216712-82216734 GCAAATGATGCATCCAACAAAGG - Intergenic
958003612 3:87783817-87783839 GCAAATCATATATCAAATGAAGG + Intergenic
958610229 3:96415700-96415722 GCAAACCATGCATCCAACAAAGG - Intergenic
958758696 3:98280912-98280934 GCAAACTATGCATCCAATAAAGG + Intergenic
960152621 3:114265711-114265733 GCAAATTATGCATCCAACAAAGG - Intergenic
960253383 3:115483452-115483474 GCAACTCAAGTACCCATTGATGG + Intergenic
960778386 3:121288741-121288763 GCAAATTATGCATCCAACAAAGG - Intronic
962333336 3:134500736-134500758 GCAAACCATGCATCCAACAAAGG - Intronic
962346370 3:134621804-134621826 GCAAATCATATATCCAATAAGGG + Intronic
962521140 3:136198545-136198567 GCAAATTATGCATCCAACAAAGG + Intergenic
964134096 3:153324949-153324971 GCAAATTATGCATCCAACAAAGG - Intergenic
964955209 3:162346448-162346470 GCAAAAGATACACCCCATGAAGG - Intergenic
964987405 3:162761198-162761220 GCAAACTATGCACCCAATAGAGG - Intergenic
965156170 3:165059200-165059222 GCAAATCTTGCACAAATTGAGGG + Exonic
965375606 3:167919738-167919760 GAAAATCATGCAGCCAATGGGGG + Intergenic
966245156 3:177800161-177800183 GCAAATTATGCACCCAACAAAGG + Intergenic
967239444 3:187422862-187422884 GCAAACTATGCATCCAAAGAAGG + Intergenic
967600747 3:191385552-191385574 GCAAATTATGCATCCAACAAAGG - Intronic
968247094 3:197162940-197162962 GCAAATCATACACCTGATAAGGG + Intronic
968417066 4:447585-447607 GAAATACATGCACCAAATGAAGG + Intronic
968496033 4:916199-916221 GCAAATCATATACCTAATAAAGG + Intronic
968604542 4:1526971-1526993 GCAAATCATGTACCTGATAAGGG - Intergenic
969549015 4:7851968-7851990 GCAAATCAAGTACACAATAATGG + Intronic
970488245 4:16545624-16545646 GCAAATCATTGTCCCCATGAGGG - Intronic
972144714 4:36008785-36008807 GCAAACTATGCACCCAACAAAGG + Intronic
975249466 4:72161571-72161593 GCAAACTATGCATCTAATGAAGG - Intergenic
976677483 4:87719337-87719359 GCAAATTATGAACCTAAGGATGG - Intergenic
979128516 4:117008696-117008718 GCAAACCATGCAGCCAACAAAGG + Intergenic
979143277 4:117205724-117205746 GCAAATCATGCACGCAACAAAGG + Intergenic
979248742 4:118541073-118541095 GCAAAACATACAGCCTATGAAGG + Intergenic
980455657 4:133038939-133038961 GCAAACTATTCATCCAATGAGGG - Intergenic
981690918 4:147508041-147508063 GCAAATCATACATCTGATGAAGG - Intronic
982323248 4:154102530-154102552 GCAAACCTTGCAAACAATGAAGG - Intergenic
983018794 4:162648489-162648511 GCAAATTATGCATCCAACAAAGG - Intergenic
983466621 4:168101204-168101226 GCACATCATACAGCCAGTGAAGG - Intronic
983667676 4:170200091-170200113 GCAAACCATGCATCCAACAAAGG + Intergenic
983834697 4:172373073-172373095 GCAAATCATCCACATACTGAAGG + Intronic
984061914 4:174999797-174999819 GCAAACTATGCACCTGATGAAGG - Intergenic
984071872 4:175124785-175124807 ACAAATGATGCATCCAATAAAGG + Intergenic
984209489 4:176828323-176828345 GCAAATCATGCATCTTATAATGG + Intergenic
984831382 4:183978000-183978022 GCAAACTATGCATCCAATGGAGG - Intronic
986137652 5:4997736-4997758 GAAATTCATACACCCAATAAAGG - Intergenic
987544998 5:19303227-19303249 GCAAATCATCCACATATTGAAGG + Intergenic
987796241 5:22630876-22630898 GCAAATTATGCATCCAACAAAGG + Intronic
988124419 5:27010590-27010612 GCAGATCCTGCACTCAATGTAGG - Intronic
989435578 5:41409423-41409445 GCTAGCCATGCACACAATGAGGG - Intronic
991132165 5:63135173-63135195 GCAAATCATGTATCTGATGATGG + Intergenic
992049612 5:72930428-72930450 GCAAATCATCCACATACTGAAGG - Intergenic
992084739 5:73268107-73268129 GCAAATGAAGCAACCAATTAGGG - Intergenic
993179269 5:84529541-84529563 GCAAATGATGCACCAGGTGAGGG - Intergenic
995970001 5:117956708-117956730 TCAAATAAAGCCCCCAATGATGG - Intergenic
996046420 5:118878752-118878774 GCAAATTATGCATCCAAAAAAGG + Intronic
996224796 5:120978660-120978682 GCAAATCATGCATCTGATAAGGG - Intergenic
997210744 5:132075298-132075320 GCAATTCAAGCACCCCATGTGGG - Intronic
999356464 5:150938263-150938285 GCAAATCATCAAACCAATGGTGG + Intergenic
999408552 5:151328833-151328855 GCAAATCATGCAGCCACATAGGG - Intronic
999647462 5:153732628-153732650 GCAAACCATATACCCAATAAGGG - Intronic
1000016638 5:157283618-157283640 GCAAATGCTGCATCCAGTGAGGG - Intronic
1001944234 5:175765351-175765373 GCAAACCATGTACCCAACAAAGG + Intergenic
1004600204 6:17142481-17142503 GCAAACTATGTATCCAATGAAGG - Intergenic
1004813417 6:19285831-19285853 GCAAATCATGTATCTGATGAGGG + Intergenic
1005800953 6:29424031-29424053 GCAAATTATGCACCTAATACGGG + Intronic
1006266334 6:32927873-32927895 GCAAATCATGTATCCAACAAAGG + Intergenic
1006328529 6:33372586-33372608 GCAAATTATGAAGCCAAGGAGGG + Intergenic
1007121180 6:39383066-39383088 GCAAACTATGCATCCAATGAAGG - Intronic
1007310571 6:40942734-40942756 ACAAATTATGCACCCAACAAAGG + Intergenic
1008544022 6:52570010-52570032 GCAAATCTCCCAGCCAATGAGGG + Intronic
1008547783 6:52598562-52598584 GTAAATCATTCACCCAGTGGGGG - Intergenic
1009295691 6:61943739-61943761 GCAAACTATGCATCCAATAAGGG + Intronic
1010063110 6:71647059-71647081 GCAAACTATGCACCCAACGGGGG + Intergenic
1010942549 6:81935649-81935671 GCAAAACATGAACACTATGAGGG + Intergenic
1011106993 6:83793169-83793191 GCAAACTATGCATCCAACGAAGG + Intergenic
1011570743 6:88731693-88731715 GCAAATCATATATCCAATAAAGG + Intronic
1012056566 6:94419833-94419855 GCAAATCATACACTGAATAAGGG - Intergenic
1012424308 6:99097312-99097334 GCAAACCATGCATCCAACAAAGG + Intergenic
1012715110 6:102658819-102658841 GCAAGTCATGCAATCAATAAAGG + Intergenic
1013104175 6:107012499-107012521 GCCAAGCTTGCACCCAATAAAGG + Intergenic
1013156686 6:107498264-107498286 CCCAATCACTCACCCAATGAGGG - Intronic
1013962347 6:115915482-115915504 GCAGATCATCCACCTAATGTGGG - Intergenic
1014330698 6:120060127-120060149 GCAAACCATGCATCCAATAAAGG + Intergenic
1014806509 6:125835963-125835985 TCAAATCATCCATTCAATGATGG - Intronic
1015176103 6:130311118-130311140 GTAAATCATGCACCTACGGAGGG + Intronic
1015636158 6:135276683-135276705 GCAAATTATGCACCTAACGAAGG + Intergenic
1015691398 6:135927878-135927900 CCAAATTATGCACCCAACAAAGG + Intronic
1017052258 6:150404186-150404208 GAAAATCATTTACCCAATAAGGG - Exonic
1017598363 6:156054169-156054191 GCAAATCATGGGCCCAAGGCAGG + Intergenic
1018925498 6:168203546-168203568 GCAAACTATGCATCCAATAATGG + Intergenic
1019208204 6:170380749-170380771 GCAAACCATGCATCTAATAAGGG - Intronic
1021966070 7:25920344-25920366 GCAAATCATGCATCTGATAAAGG + Intergenic
1022534823 7:31091317-31091339 GCAAATTATGCATCCAACAAAGG - Intronic
1022783300 7:33608760-33608782 GCAAACTATGCACCCAACAAAGG - Intergenic
1022932099 7:35128822-35128844 TCAAATCATGCTACCAATGTAGG + Intergenic
1023084799 7:36559651-36559673 ACAAATGATGCATCCAATCAAGG - Intronic
1023782802 7:43673246-43673268 GCAAATTATGCATCCAACAACGG + Intronic
1024127001 7:46309355-46309377 GCAAACTACGCATCCAATGAAGG - Intergenic
1024216165 7:47250337-47250359 GCACATCATGTATCCAATAAGGG - Intergenic
1024789381 7:52946799-52946821 GCAAATTATGCATCTAATAAGGG + Intergenic
1026337535 7:69407604-69407626 GCAAATAATATACCTAATGAGGG + Intergenic
1026514250 7:71053925-71053947 GAAAATCATACATCCAATAAGGG + Intergenic
1027447176 7:78287451-78287473 GCATATCATGTAGACAATGAAGG + Intronic
1027544628 7:79511771-79511793 GCAAACTATGCATCCAATAAAGG - Intergenic
1028184122 7:87761065-87761087 GCAAATCATACACAAAATCAGGG + Intronic
1028496887 7:91471562-91471584 GCAAATTATGCATCCAACAAAGG - Intergenic
1029021243 7:97366693-97366715 GCAAACCATTCATCCAATAAGGG + Intergenic
1029828031 7:103221619-103221641 CCAAATCATGCTACCAATGTAGG + Intergenic
1029905148 7:104084851-104084873 GCAAATCATGTATCCGATAAGGG - Intergenic
1033222057 7:139534142-139534164 TAAAATTATGCAACCAATGATGG + Intronic
1033317734 7:140312054-140312076 GCAAATCATATACCCAATAAGGG - Intronic
1034051942 7:147993122-147993144 GCAAATCAAGCACCCAGTAACGG - Intronic
1035735739 8:1886331-1886353 GCAAATCATGGACACCAGGATGG + Intronic
1036106905 8:5850815-5850837 GCAAATTATGCACCTAATAAAGG + Intergenic
1036576694 8:10034118-10034140 GCAAACTATGCAACCAACGAAGG + Intergenic
1038829236 8:31038469-31038491 GCAAATCATACACCCAATAAGGG - Intronic
1039141365 8:34392213-34392235 CCAAATTTTGAACCCAATGAGGG + Intergenic
1039773940 8:40717160-40717182 TCAAACCTTGCACACAATGAAGG + Intronic
1040796611 8:51295154-51295176 GTAAATCATCCACATAATGAAGG + Intergenic
1041266055 8:56066187-56066209 GCAAATCATCTACCTAATAAGGG + Intergenic
1041399732 8:57429170-57429192 ACAACTCATGTACCCAAAGAAGG - Intergenic
1042702783 8:71635034-71635056 GCAAATTATGCAGCCAATAGAGG - Intergenic
1042919835 8:73910122-73910144 GTAAATCATCCACACACTGAAGG - Intergenic
1046708583 8:117483823-117483845 GCAAACCATGCATCCAATGAAGG - Intergenic
1047238193 8:123060976-123060998 GCCAATCATACGACCAATGAGGG + Intronic
1047602644 8:126441736-126441758 GCAAATCATGAATCTAATAAAGG + Intergenic
1049336232 8:142087663-142087685 TAAAATCATGCACCGCATGATGG - Intergenic
1050133224 9:2434567-2434589 ACAAATTATGCACCCAACAAAGG - Intergenic
1051668093 9:19484202-19484224 ACTAATCATGCACCCACTGCAGG - Intergenic
1051706584 9:19887307-19887329 GCAAATTATGCATCCAACAAAGG - Intergenic
1052711411 9:32060982-32061004 GCAAATTCTGCACCCAATCTTGG + Intergenic
1053606310 9:39663652-39663674 GCAAACCATGCATCTGATGAGGG + Intergenic
1054247230 9:62678764-62678786 GCAAACCATGCATCTGATGAGGG - Intergenic
1054561349 9:66713299-66713321 GCAAACCATGCATCTGATGAGGG - Intergenic
1055521870 9:77089605-77089627 GCAAGCCATGTACCCAATAAGGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1055990167 9:82097072-82097094 GCAAACTATGCATTCAATGAGGG - Intergenic
1056087703 9:83168551-83168573 GCAAATCATCCATCTGATGAGGG + Intergenic
1056113370 9:83418364-83418386 GCAAACTATGTATCCAATGAAGG + Intronic
1056392554 9:86153160-86153182 GCAAATCATCCACATACTGAAGG + Intergenic
1057296755 9:93849853-93849875 GCAAATCAAAAACACAATGAAGG - Intergenic
1058016209 9:100035313-100035335 GCAAATGATGCACTCAACAAAGG + Intronic
1058916657 9:109573415-109573437 GCAAATTATGCATCCAACAAAGG + Intergenic
1059589360 9:115641276-115641298 GCAAACTATACACCCAGTGAAGG - Intergenic
1059868904 9:118548849-118548871 GCAAATTATGCACCCAACAAAGG + Intergenic
1060346397 9:122820379-122820401 GCAGATCATGCAACCATTCATGG + Exonic
1061979688 9:134094572-134094594 GCAAACCATGCACCTGATAAGGG + Intergenic
1186110562 X:6250988-6251010 GCAAACTATGCATCCAGTGAAGG + Intergenic
1186650033 X:11549372-11549394 GCAAACTATTCATCCAATGAAGG + Intronic
1186767538 X:12786465-12786487 GCAAATCATGTATCTGATGAGGG - Intergenic
1187654632 X:21457121-21457143 GCAAACCATGTATCCAATAAGGG - Intronic
1187793441 X:22976151-22976173 GCAAACTATGCACCCAACAAAGG + Intergenic
1187923519 X:24229197-24229219 GCAAATCATATACCCAACAAAGG - Intergenic
1188075250 X:25768015-25768037 ACAAACCATGCAACCAATGAAGG + Intergenic
1188286489 X:28331858-28331880 GCAAATCATACACCTAATAAAGG - Intergenic
1188775618 X:34215016-34215038 CCAAACTATGCATCCAATGAAGG + Intergenic
1189657325 X:43258886-43258908 GCAAACTATGCATGCAATGAAGG - Intergenic
1192272425 X:69594525-69594547 GCAAATCATACATCGAATAAGGG + Intergenic
1192986369 X:76403651-76403673 GCAAACCATACATCCAATAAGGG + Intergenic
1193185936 X:78512738-78512760 GCAAACTATGCACCCAACGAAGG + Intergenic
1193255797 X:79347702-79347724 GCAAATTATGCATCCAACAAAGG + Intergenic
1193364384 X:80613753-80613775 GCAAATTATGCATCCAGTAAAGG + Intergenic
1193427558 X:81357771-81357793 GCAAATTATGCACCCAACAAAGG - Intergenic
1193554939 X:82941783-82941805 GCAAATGATGCATCCAACAAAGG - Intergenic
1193703848 X:84795927-84795949 GCAAATTATGCATTCAATGAAGG + Intergenic
1194151491 X:90330135-90330157 GCAAACTATGCATCCAACGAAGG + Intergenic
1194895988 X:99440561-99440583 GCAAATGATTCATTCAATGAGGG + Intergenic
1195145073 X:102005691-102005713 GCAAACTATGCATCCAATAAAGG + Intergenic
1195415203 X:104612089-104612111 GTAAACTATACACCCAATGAAGG - Intronic
1196018900 X:110968728-110968750 GCAAATCATGCATCTAACAAAGG - Intronic
1199556593 X:149115690-149115712 GCAAATTAAGCACCCAAAAATGG + Intergenic
1200340063 X:155386953-155386975 GCAAATTATGCAGCCAACAAAGG - Intergenic
1201314531 Y:12630811-12630833 GCAAATTATGCATCCAACAAAGG + Intergenic
1201407321 Y:13662246-13662268 GTAAATCATCCACACACTGAAGG + Intergenic