ID: 1115279675 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:31647575-31647597 |
| Sequence | GTTCAGCAGCACCACATTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 235 | |||
| Summary | {0: 4, 1: 11, 2: 26, 3: 43, 4: 151} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115279675_1115279676 | -7 | Left | 1115279675 | 14:31647575-31647597 | CCTACAATGTGGTGCTGCTGAAC | 0: 4 1: 11 2: 26 3: 43 4: 151 |
||
| Right | 1115279676 | 14:31647591-31647613 | GCTGAACAGTCAGTCTGATTTGG | 0: 2 1: 7 2: 35 3: 81 4: 145 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115279675 | Original CRISPR | GTTCAGCAGCACCACATTGT AGG (reversed) | Intronic | ||