ID: 1115279676 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:31647591-31647613 |
Sequence | GCTGAACAGTCAGTCTGATT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 270 | |||
Summary | {0: 2, 1: 7, 2: 35, 3: 81, 4: 145} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1115279672_1115279676 | 9 | Left | 1115279672 | 14:31647559-31647581 | CCTGTGTAACACACCTCCTACAA | 0: 1 1: 0 2: 4 3: 51 4: 169 |
||
Right | 1115279676 | 14:31647591-31647613 | GCTGAACAGTCAGTCTGATTTGG | 0: 2 1: 7 2: 35 3: 81 4: 145 |
||||
1115279675_1115279676 | -7 | Left | 1115279675 | 14:31647575-31647597 | CCTACAATGTGGTGCTGCTGAAC | 0: 4 1: 11 2: 26 3: 43 4: 151 |
||
Right | 1115279676 | 14:31647591-31647613 | GCTGAACAGTCAGTCTGATTTGG | 0: 2 1: 7 2: 35 3: 81 4: 145 |
||||
1115279674_1115279676 | -4 | Left | 1115279674 | 14:31647572-31647594 | CCTCCTACAATGTGGTGCTGCTG | 0: 2 1: 9 2: 28 3: 51 4: 192 |
||
Right | 1115279676 | 14:31647591-31647613 | GCTGAACAGTCAGTCTGATTTGG | 0: 2 1: 7 2: 35 3: 81 4: 145 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1115279676 | Original CRISPR | GCTGAACAGTCAGTCTGATT TGG | Intronic | ||