ID: 1115279676

View in Genome Browser
Species Human (GRCh38)
Location 14:31647591-31647613
Sequence GCTGAACAGTCAGTCTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 2, 1: 7, 2: 35, 3: 81, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115279672_1115279676 9 Left 1115279672 14:31647559-31647581 CCTGTGTAACACACCTCCTACAA 0: 1
1: 0
2: 4
3: 51
4: 169
Right 1115279676 14:31647591-31647613 GCTGAACAGTCAGTCTGATTTGG 0: 2
1: 7
2: 35
3: 81
4: 145
1115279674_1115279676 -4 Left 1115279674 14:31647572-31647594 CCTCCTACAATGTGGTGCTGCTG 0: 2
1: 9
2: 28
3: 51
4: 192
Right 1115279676 14:31647591-31647613 GCTGAACAGTCAGTCTGATTTGG 0: 2
1: 7
2: 35
3: 81
4: 145
1115279675_1115279676 -7 Left 1115279675 14:31647575-31647597 CCTACAATGTGGTGCTGCTGAAC 0: 4
1: 11
2: 26
3: 43
4: 151
Right 1115279676 14:31647591-31647613 GCTGAACAGTCAGTCTGATTTGG 0: 2
1: 7
2: 35
3: 81
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115279676 Original CRISPR GCTGAACAGTCAGTCTGATT TGG Intronic