ID: 1115282121

View in Genome Browser
Species Human (GRCh38)
Location 14:31675910-31675932
Sequence ATGAAACAGAAGGGGACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115282121 Original CRISPR ATGAAACAGAAGGGGACCCA AGG (reversed) Intronic
900209176 1:1445154-1445176 AGGAAACAGAAGAGGAGCCTGGG + Intergenic
900219013 1:1497072-1497094 AGGAAACAGAAGAGGAGCCTGGG + Intronic
902631494 1:17707179-17707201 ACAGAACAGAAGCGGACCCAGGG + Intergenic
903173191 1:21566062-21566084 AAGAAGGAGAAGGGGACCCCAGG - Intronic
903604529 1:24566039-24566061 AGGAAGGAGAAGGGGAACCAAGG - Intronic
904806269 1:33134552-33134574 CAGAGACACAAGGGGACCCATGG + Intergenic
905323958 1:37137316-37137338 AGGCAAGAGAAGTGGACCCAGGG + Intergenic
906107614 1:43304328-43304350 GTGACAGAGAGGGGGACCCATGG + Intronic
907395799 1:54189216-54189238 ATGAAACAAATGGGGACCTAAGG + Intronic
908994908 1:70139900-70139922 ATGACAGAGAAGGGTACACAGGG + Intronic
909218999 1:72930233-72930255 TTGAAAATGAAGGAGACCCAGGG + Intergenic
909503273 1:76359086-76359108 ATGAAACAAGAGAGGACCTAGGG + Intronic
912184307 1:107256555-107256577 AGGTAACAGAAGGTGTCCCAAGG + Intronic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
916605222 1:166335678-166335700 AAGAAAAGGAAGGGGACCGAGGG - Intergenic
918766193 1:188486797-188486819 AAGAAACTGAAGGAGACCCAGGG + Intergenic
919557719 1:199081072-199081094 ATGAAAAGGAAGTGAACCCAAGG + Intergenic
920078054 1:203351345-203351367 ATTCAGCAGAAAGGGACCCAGGG - Exonic
920442993 1:205993980-205994002 CTGAATCAGAAAGGGACCTATGG + Intronic
921470246 1:215539460-215539482 ATGAAACGGAAGGGGAAAGAAGG - Intergenic
923424814 1:233858505-233858527 CTGAAACTGAAGGGGAGTCATGG - Intergenic
1063117076 10:3079212-3079234 ATGATACACAAGGTGACCCCAGG - Intronic
1063359036 10:5433596-5433618 ATGAAAGAAAAGGTGAGCCATGG - Intronic
1064355575 10:14614719-14614741 GTGAAAGTGAATGGGACCCAAGG + Intronic
1067016289 10:42758264-42758286 AGGACAAAGAAGGGGACTCAGGG + Intergenic
1067979046 10:51061928-51061950 ATGCAACAGAAGGAGACCCATGG - Intronic
1071218699 10:83437222-83437244 ATGTAAAAGAAGGGGACAGAGGG - Intergenic
1071964727 10:90841055-90841077 ATGAAACAGAAAAAGAGCCATGG + Intronic
1072525840 10:96270777-96270799 ATAAACCAGAAGCGGCCCCATGG - Intronic
1073572634 10:104593392-104593414 ATGAAAGAGGAAGAGACCCAGGG - Intergenic
1074719353 10:116251072-116251094 ATGATACAGAAGGGAACAGAGGG - Intronic
1078019546 11:7644562-7644584 AGGAAACAAAATGGGGCCCAGGG - Intronic
1078384624 11:10878471-10878493 AGAAAAAAAAAGGGGACCCAAGG - Intergenic
1079657784 11:23003618-23003640 ATGAAAGAGATGGGTTCCCATGG + Intergenic
1081207629 11:40293456-40293478 ATGGAGGAGAAGGGGACCCGGGG - Exonic
1082722674 11:56697421-56697443 ACCAAAAAGAGGGGGACCCATGG + Intergenic
1082821969 11:57550171-57550193 ATGGAGCAGAAGGGAACCCCCGG - Exonic
1084230656 11:67750311-67750333 AAGAAACAGAAGTGGAGCTAAGG + Intergenic
1084509232 11:69592957-69592979 ATGAAACAGAACGGAATTCAGGG - Intergenic
1084697306 11:70763328-70763350 ATGGGACAGCAGGGGACACAGGG + Intronic
1087144113 11:94795006-94795028 AACAAGCAGAAGGGGACCCTGGG - Exonic
1090079741 11:123603979-123604001 ATGGAACAGAAAGGAACCAAAGG + Intronic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1093992977 12:25610672-25610694 ATGGAAGTGGAGGGGACCCAAGG + Intronic
1094731728 12:33184391-33184413 AGTAAACAGAAGGGGACTCAAGG - Intergenic
1095915625 12:47475146-47475168 ATGGAACAGAAGAGGCCCCATGG - Intergenic
1096118476 12:49070167-49070189 AAGAAACAGAAAGGAACCCGGGG + Intergenic
1100501787 12:95181364-95181386 ATGACACAGGAGGAGCCCCATGG + Intronic
1100736608 12:97541783-97541805 AGGAAACAGAAAATGACCCAAGG + Intergenic
1101294056 12:103402816-103402838 GAGAAGTAGAAGGGGACCCAAGG + Intronic
1101752922 12:107597865-107597887 AAAAAACAGAAGGTGACCCAGGG - Intronic
1102400861 12:112628442-112628464 CTGATTAAGAAGGGGACCCATGG + Intronic
1102920055 12:116785069-116785091 AAGAAACAGAGGGGGAACCAAGG - Intronic
1104033942 12:125085413-125085435 ATGAAACAGACGTGGATGCAAGG - Intronic
1104177862 12:126350560-126350582 AGGAAAGAGAAGGGGACCTGTGG + Intergenic
1104611772 12:130234845-130234867 CTGACCCAGAAGGGGACTCAGGG + Intergenic
1106186214 13:27412276-27412298 AAGAAACTGAAGGGAATCCAGGG + Intergenic
1110191894 13:72739846-72739868 AAGAGAGAGAAAGGGACCCATGG + Intronic
1110690111 13:78422979-78423001 ATGAAAGAGATGGGGACTCCAGG + Intergenic
1111890458 13:94075390-94075412 ATAAAACACAAAGGGACACAAGG - Intronic
1112193997 13:97207057-97207079 AGGAAAGGGAAGGGGATCCAAGG - Intergenic
1112512302 13:100020555-100020577 ATGAAACAGGTGGGCTCCCAAGG - Intergenic
1114639467 14:24209660-24209682 ATCAAAGAGAAGGGAGCCCAAGG + Exonic
1115109134 14:29800374-29800396 ATGAAGTAGAAGTGGACACAGGG - Intronic
1115282121 14:31675910-31675932 ATGAAACAGAAGGGGACCCAAGG - Intronic
1117441542 14:55764286-55764308 ATGAAACAGAATGGAATCAAAGG + Intergenic
1118037090 14:61879529-61879551 ATGAAAGAGCAAGGGACCCATGG - Intergenic
1118987772 14:70771545-70771567 AAGCAACAGATGGAGACCCAGGG + Intronic
1125323357 15:38511862-38511884 ATAAAGCAGAAGGGGAGACATGG - Intronic
1125421812 15:39511657-39511679 ACAAAAATGAAGGGGACCCAAGG + Intergenic
1128313691 15:66647057-66647079 ATAACACAGAAGATGACCCATGG + Intronic
1128701280 15:69806319-69806341 ATGCATCAGAAATGGACCCATGG + Intergenic
1128753496 15:70165472-70165494 ATGTCACAGAAGAGGACGCAAGG + Intergenic
1128982733 15:72198579-72198601 AGCAAACAGGAGGGGTCCCAAGG + Intergenic
1130118340 15:81024994-81025016 AGGAAAAGGAAGGGGACACAGGG - Intronic
1130563110 15:84974063-84974085 TTGAATCAGGAGGGGAGCCAGGG + Intergenic
1132158486 15:99514307-99514329 ATGAAAGAGAAGGGGGTGCATGG - Intergenic
1132563527 16:609980-610002 AGGAAACAGAATGGGTCCCACGG + Intronic
1139149165 16:64359819-64359841 AAGAAACAGAAGGTGATCAATGG + Intergenic
1139357062 16:66372765-66372787 ATTAAACAGCAGGGGAGCCTTGG - Intronic
1140348196 16:74235261-74235283 AGGAAACAGAACGGAACTCAGGG - Intergenic
1140691899 16:77492709-77492731 ATGAAGCAGAAGCAGACCAAAGG + Intergenic
1140873002 16:79123914-79123936 TTGATACAGCAGGAGACCCAGGG - Intronic
1141140982 16:81496825-81496847 GTGAAACTGAATGGGAGCCAAGG + Intronic
1144175057 17:12697160-12697182 AAGGAGCAGGAGGGGACCCAAGG - Intronic
1145911956 17:28548168-28548190 ATCAGATAGATGGGGACCCAAGG - Intronic
1146624917 17:34427927-34427949 GAGAAACAGAAGGGCAGCCAAGG - Intergenic
1147140693 17:38459036-38459058 AGAAGACAGAAGGGGCCCCAGGG + Intronic
1147403608 17:40195323-40195345 AGGGAGCAGAAGGGGGCCCATGG - Exonic
1148069822 17:44902172-44902194 ATGAAACAGGGAGGGCCCCAAGG - Intronic
1148385021 17:47228110-47228132 ATGACACATGAGGGGACACAGGG + Intergenic
1148737233 17:49871621-49871643 ATCAAACAGAAGGGTCCCCCAGG - Intergenic
1148989004 17:51649075-51649097 ATGAAACTGAAAAGGGCCCATGG + Intronic
1150437715 17:65167062-65167084 ATGGTACAGAAGGGGGCCCACGG + Intronic
1151353449 17:73545013-73545035 ATGCAACAGGAGGGGGCCCAAGG - Intronic
1152960656 18:78600-78622 ATGAAACAGAAGTTGATACAAGG - Intergenic
1155144308 18:23070736-23070758 ATGCAACAGAAGTTGACACAAGG - Intergenic
1155274828 18:24176806-24176828 ATGACCCAGAAGGGTACACAAGG - Intronic
1156907426 18:42370567-42370589 ATGATAGAGAATGGGAGCCAAGG + Intergenic
1157691946 18:49690917-49690939 AGGAAGCTGAAGGGGAGCCATGG - Intergenic
1157713408 18:49865581-49865603 TTGAGCCAGGAGGGGACCCAGGG - Intronic
1159604102 18:70457291-70457313 CTGAGCCAGAAGAGGACCCAAGG - Intergenic
1160393576 18:78556036-78556058 TTCAAACAGAAGGGTACCTAAGG + Intergenic
1160985919 19:1838680-1838702 CTGAAACAGAAGGGTACAAATGG + Intronic
1161118153 19:2511041-2511063 AGGTAACAGGAGGGGACCCCTGG - Intergenic
1162458965 19:10803097-10803119 AGGGAACCGATGGGGACCCAGGG + Intronic
1163180261 19:15594338-15594360 ATGAGATAGAAAGGGACCAAGGG - Intergenic
1165139505 19:33690314-33690336 ATGAAAGAGAAGGGGGCCAGAGG + Intronic
925352199 2:3209208-3209230 ATGAGGCAGAAGGAGACCCCAGG - Intronic
926483903 2:13432076-13432098 ATGAAAGAGATGGGTTCCCATGG + Intergenic
926664546 2:15506499-15506521 GTGAAAGAGAAGGCGAACCAAGG + Intronic
927019721 2:19004005-19004027 AGGAAAAAGAAGGGAAGCCATGG - Intergenic
928731527 2:34237934-34237956 ATGCAACAGATGGGTTCCCATGG - Intergenic
929173663 2:38956473-38956495 ATGTAACAGAAGGGGCCACCAGG + Intronic
929291096 2:40192863-40192885 ATGGAACAGAAGAGAATCCATGG + Intronic
930388375 2:50727790-50727812 ATGAATCAGAAGAGGAGACAGGG + Intronic
931398292 2:61907645-61907667 ATAAAACAGCAGGATACCCAGGG + Intronic
936872664 2:117151155-117151177 ATGAAAAAAAAGGAGACTCAGGG - Intergenic
937439043 2:121901614-121901636 TTGAACCAGATGGGGTCCCAAGG + Intergenic
937454258 2:122027731-122027753 AAGAACCAGCAGGCGACCCAGGG + Intergenic
938919301 2:135979670-135979692 CTGAATTAGAAGGGGACACAGGG - Intronic
939108460 2:137977497-137977519 ATCAAGCTGAAGGAGACCCAAGG - Intronic
940213611 2:151281547-151281569 AAGACCCAGAAGGGAACCCAAGG - Intronic
940505401 2:154547004-154547026 ATGAAAGAGATGGGCTCCCATGG - Intergenic
941803534 2:169687579-169687601 ATGCAAAAGGTGGGGACCCATGG + Intronic
943788230 2:191901824-191901846 ATGCAACAGATGGGTTCCCATGG - Intergenic
947756393 2:232568888-232568910 AGGAAAGAGAGGGGGACGCAAGG - Intronic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1170572251 20:17638983-17639005 GTGAAACAGAAGGAGCCCCAAGG - Intronic
1172480114 20:35266488-35266510 ACGGAAGAGAAGAGGACCCAAGG + Intronic
1172969164 20:38861025-38861047 AAGAGACTGAAGAGGACCCAGGG - Intronic
1173203776 20:40974784-40974806 AAGAAACTGAAGAGGACACAAGG - Intergenic
1175366895 20:58461774-58461796 AAGAGACAGCAGGAGACCCAAGG - Intronic
1175795705 20:61769440-61769462 ATGGAACAGATGGGGAACCAAGG - Intronic
1176081242 20:63274149-63274171 ATGGAGCAGAAGGGAGCCCAGGG + Intronic
1176935653 21:14863760-14863782 ATGAAACAGAAGTGTTCTCATGG + Intergenic
1177339709 21:19783565-19783587 ATGCAAGAGGAGGGTACCCATGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179253369 21:39693408-39693430 AAGAAACAGATGGTGAGCCAAGG - Intergenic
1179556212 21:42178658-42178680 ATGACACAGAAAGGGAGGCAGGG - Intergenic
1181153844 22:20904566-20904588 ATCACACAGAAGCAGACCCACGG + Intergenic
1182017947 22:27056465-27056487 GTCAAACAGAAGGACACCCAGGG - Intergenic
1183302282 22:37064233-37064255 ATGAGGCAGAAGGGGAACCAGGG - Intergenic
1183958386 22:41396233-41396255 TTGAATCAGAAGGGGACCTCTGG + Exonic
1184842809 22:47062472-47062494 ATAAAACAGAAAGGAACACACGG - Intronic
951373691 3:21886883-21886905 ATGTAATGGGAGGGGACCCACGG - Intronic
953143526 3:40251338-40251360 ATGAAGCACATAGGGACCCAAGG - Intronic
955286638 3:57647830-57647852 ATGAGACAGGAGGGTATCCATGG + Intronic
955286829 3:57649817-57649839 ATGAGACAGGAGGGTATCCATGG - Intronic
956527320 3:70179264-70179286 CTCAAAAAGAAGGGGAACCAAGG - Intergenic
958874664 3:99602475-99602497 AAGAAAGAGAAGTGGTCCCACGG - Intergenic
963304874 3:143640350-143640372 ATGAGGCAGAAGTGGAACCAAGG - Intronic
963420982 3:145061065-145061087 ATGGAACAGATGGGTTCCCATGG + Intergenic
965245967 3:166268875-166268897 ATTAAACAGAAGGAGACTCAAGG + Intergenic
966826177 3:183966872-183966894 ATGAAACAGAGGGGGAGCAGGGG - Intronic
968157149 3:196390913-196390935 ATGCAAGAGAATGGGTCCCAAGG + Intronic
968934598 4:3603399-3603421 ATGATTCAGACAGGGACCCATGG + Intergenic
970144042 4:13014189-13014211 ATGAAACAGAAGGGGAACCTTGG - Intergenic
970498992 4:16657641-16657663 AAGAAACAGAAGGAAAGCCAGGG - Intronic
970788994 4:19834104-19834126 AGGAAATAAAAGGGGAACCAAGG + Intergenic
972316854 4:37934721-37934743 ATGACACTGAAGGGTCCCCAGGG - Intronic
974052293 4:56952388-56952410 CTGAGACAGAAGGGGAGGCAGGG - Intergenic
974929858 4:68349750-68349772 CGGAAACCGAAGGGGAGCCATGG - Exonic
975181936 4:71355940-71355962 ATGTACCAGAAAGGGAGCCATGG + Intronic
975754661 4:77560840-77560862 AGGAAACAGAAGAGAGCCCAAGG - Intronic
976312429 4:83625393-83625415 AAGAAACAGAAGGAGACCAAGGG - Intergenic
976525607 4:86083947-86083969 CTGGGACAGAAGGGAACCCATGG + Intronic
976868710 4:89764027-89764049 CAGAAACAGATGGGGATCCAAGG + Intronic
978213106 4:106162255-106162277 ATGCAAGAGATGGGCACCCATGG + Intronic
978619116 4:110621988-110622010 AGGAAACAGAAGGGAGGCCAGGG + Intronic
981412558 4:144449980-144450002 ATGATGCGGAAGGGGCCCCACGG + Intergenic
983669137 4:170215610-170215632 ATGCAACAGATGGGTTCCCATGG - Intergenic
984320532 4:178190201-178190223 AGGGAAAAGAAGGGGACGCAGGG + Intergenic
986317742 5:6601775-6601797 AGGAAACAGAATGGGGTCCACGG - Intronic
988529378 5:32014306-32014328 ATAAATCATAAGGGGACGCATGG - Intronic
989516782 5:42353368-42353390 AGGAAACACAAGGGAAGCCAAGG + Intergenic
992423647 5:76632974-76632996 ATGGAACAGAGAGGGACTCAAGG - Intronic
994894630 5:105686937-105686959 ATGAAAGAGTAGGGGACAGAAGG + Intergenic
998224841 5:140318990-140319012 ATGAAACAGATGGGCAGGCAGGG - Intergenic
999712623 5:154332033-154332055 AAGAGGCAGAAGAGGACCCAGGG - Intronic
1000260016 5:159578734-159578756 ATCAACCAGATGGGGAGCCATGG + Intergenic
1000869466 5:166557718-166557740 ATGAGACAAATGGGAACCCAGGG + Intergenic
1001449214 5:171811171-171811193 ATTAAACAGAAGCAGACACACGG - Intergenic
1001799119 5:174528112-174528134 ATGAAAAAGGAGGGGACGAATGG - Intergenic
1002563486 5:180097738-180097760 CTGAAACACCAGGGGACACAGGG + Intergenic
1003484674 6:6565146-6565168 ATGAGGCAGAAGAGGACCCCTGG - Intergenic
1004134952 6:12957416-12957438 ATGAAACAGAAAGTAACCCGGGG - Intronic
1007407824 6:41644973-41644995 GTGACACAGAGGGGGACACAAGG - Intronic
1007752532 6:44079216-44079238 ATGAGCCTGGAGGGGACCCAAGG - Intergenic
1009701325 6:67185723-67185745 CTGAAACAAAAGAGAACCCAGGG + Intergenic
1011773489 6:90701579-90701601 ATAAAACAGCAGGGGGCCCCTGG + Intergenic
1012137304 6:95574398-95574420 ATGTAACAGAAGGGGAATGAAGG - Intergenic
1012857984 6:104525957-104525979 AATAAACAGAAGGGGACCTCAGG + Intergenic
1012935391 6:105362739-105362761 ATGAAACAGTGGTGGACACAAGG + Intronic
1013045078 6:106477672-106477694 AAGAAAAAAAAGGAGACCCATGG + Intergenic
1013995298 6:116301420-116301442 ATAATACAGAAGGATACCCAAGG - Intronic
1014144208 6:117978638-117978660 GTGAGACAGAATGGGAACCAGGG - Intronic
1016480307 6:144473771-144473793 ATGAAACAGCAGGCTGCCCAAGG + Exonic
1018432730 6:163735710-163735732 AGGAAACAGAAAGGAACCGAAGG + Intergenic
1019450260 7:1094003-1094025 ATGACACAGAAGTGCCCCCACGG - Intronic
1021234529 7:18125797-18125819 ATGAAACTGAAGGAAACACAAGG - Intronic
1022858229 7:34338418-34338440 ATGAAACAGGAAAGGACACAGGG - Intergenic
1024554659 7:50593144-50593166 AGGGAACAGAACGGGGCCCACGG + Intronic
1026425590 7:70289362-70289384 ATGAAAGAGAAGGGAGCACATGG - Intronic
1028146985 7:87329663-87329685 AAGTAACAGAAGGAGACCCTGGG - Intergenic
1029626019 7:101720640-101720662 ATGAAATAGAAAGGGGCCCTGGG + Intergenic
1030465421 7:109895806-109895828 ATGAAACAGAAGGGGAGTTTGGG - Intergenic
1030699020 7:112618466-112618488 ATGAAATAGAAAGGGAATCATGG - Intergenic
1032651289 7:133881326-133881348 ATGAAACAGCATGGGATTCAGGG - Intronic
1033441678 7:141385794-141385816 CAGAAATAGAAGTGGACCCAAGG - Intronic
1034331273 7:150284634-150284656 ATGAAACAGAAGGTGAAACAGGG + Intronic
1034666768 7:152825219-152825241 ATGAAACAGAAGGTGAAACAGGG - Intronic
1034952888 7:155312974-155312996 ACAAATCAGAAGGGGACTCAAGG - Intergenic
1035606994 8:936257-936279 AAGAAAGAGAAGGGGACCCAAGG + Intergenic
1038715885 8:29990752-29990774 AAGAAAGAGAAGGGGAGCAAAGG - Intergenic
1041936274 8:63335356-63335378 GTCAAACAGAACGTGACCCATGG - Intergenic
1044797551 8:95919678-95919700 ATCAAGCTGAAAGGGACCCAAGG + Intergenic
1045413966 8:101948314-101948336 GTGAAGAAGAAGGAGACCCAAGG + Intronic
1045500707 8:102742477-102742499 ATGAAACAGGTGGAGACCAAGGG - Intergenic
1046556697 8:115782240-115782262 ATGAATGACAAAGGGACCCAAGG - Intronic
1047382476 8:124376020-124376042 ATTAAACAGATGGGCAACCACGG - Intergenic
1049154402 8:141058116-141058138 CTGAAACAGAAGGGGACTGTGGG - Intergenic
1050287614 9:4118789-4118811 ATGAAGCAGGAGTGGTCCCAGGG - Exonic
1051208232 9:14712891-14712913 AAGAAAGAGAAGGGAGCCCAAGG + Intergenic
1051338593 9:16090606-16090628 ATGAAAGAGAAGGAAACCAATGG + Intergenic
1052134841 9:24897357-24897379 ATGATACAGAAGTGGAGACATGG + Intergenic
1054455566 9:65428579-65428601 ATGATTCAGACAGGGACCCATGG - Intergenic
1054998273 9:71418418-71418440 ATGAAGCAGAACTGGACCTATGG + Intronic
1057016382 9:91656385-91656407 AGGAAACAGAAGGAGACATAAGG + Intronic
1057506899 9:95641960-95641982 ATGAAACTGACGGGTTCCCAAGG - Intergenic
1057673716 9:97119849-97119871 AAGAAACACAAGGGGACATAAGG + Intergenic
1058070383 9:100595579-100595601 CTGAATAAGAAGGGGACCCATGG + Intergenic
1058896313 9:109403795-109403817 ATAAAACAAAAGGGAACCAAAGG - Intronic
1059072699 9:111155593-111155615 ATGAGACAGAAACAGACCCAAGG + Intergenic
1061513054 9:131072543-131072565 AGGCCACAGAAGGGGACCCCTGG + Intronic
1062407361 9:136403279-136403301 GAGAAACAGAAGGGGTCCCAGGG + Intronic
1062439306 9:136562595-136562617 ATTCCACAGAAGGGCACCCAAGG - Intergenic
1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG + Intergenic
1186786125 X:12957136-12957158 AAGAAACAGAATGTGACCCTGGG - Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1188786336 X:34351425-34351447 ATGAAAGAGAAGGGGAGAGAAGG + Intergenic
1189061840 X:37762087-37762109 GAGAAACAGAAGGGGAAACAAGG - Intronic
1189849564 X:45165172-45165194 AGGGAACAGAAGGGGAGCAAGGG + Intronic
1190413402 X:50158939-50158961 ATAAAAAAGAAGAGGACACATGG + Intergenic
1191167498 X:57405624-57405646 ATAAAATAGGAGGGGGCCCAAGG + Intronic
1193144671 X:78064536-78064558 ATGAGAAAGGAGGTGACCCAGGG - Intergenic
1193332122 X:80246377-80246399 ATGAAAGAGAATGGGAAGCAAGG - Intergenic
1195688393 X:107604736-107604758 ATGAAACAGAGGCAGACACAGGG - Exonic
1196191966 X:112804319-112804341 CTGAGACAGGATGGGACCCAGGG - Intronic
1196276197 X:113768026-113768048 ATCAAAAGGAAGAGGACCCAAGG - Intergenic
1196816178 X:119667057-119667079 ATGGAACAGAAGGGAGCACATGG + Intronic
1196881697 X:120204726-120204748 ATGAAATAGCTGGGGGCCCATGG - Intergenic
1198862265 X:141084055-141084077 ATACAACCGGAGGGGACCCAAGG - Intergenic
1198900425 X:141503317-141503339 ATACAACCGGAGGGGACCCAAGG + Intergenic
1199989861 X:152980920-152980942 AGTAAAGAGAAGAGGACCCAGGG + Intergenic