ID: 1115286335

View in Genome Browser
Species Human (GRCh38)
Location 14:31717074-31717096
Sequence AAAAACAAGGTGCCACAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115286335_1115286340 12 Left 1115286335 14:31717074-31717096 CCCTTTTGTGGCACCTTGTTTTT 0: 1
1: 0
2: 3
3: 46
4: 452
Right 1115286340 14:31717109-31717131 CAAAATCTAACCTAGGAAAAAGG 0: 1
1: 0
2: 1
3: 19
4: 273
1115286335_1115286339 5 Left 1115286335 14:31717074-31717096 CCCTTTTGTGGCACCTTGTTTTT 0: 1
1: 0
2: 3
3: 46
4: 452
Right 1115286339 14:31717102-31717124 AAAAGTTCAAAATCTAACCTAGG 0: 1
1: 0
2: 1
3: 27
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115286335 Original CRISPR AAAAACAAGGTGCCACAAAA GGG (reversed) Intronic
901282628 1:8051065-8051087 AAAAAGAATGTACCACAAATTGG + Intergenic
901299978 1:8192539-8192561 AAAAAAAAGGAGAGACAAAAAGG + Intergenic
901389987 1:8938728-8938750 AAAAGCAAGTTGCCAGAAACAGG - Intergenic
901508540 1:9701967-9701989 AAAAACAAGATGCTACAGACAGG - Intronic
904874343 1:33642735-33642757 CAAAACAATCTGACACAAAAAGG - Intronic
906953615 1:50354206-50354228 AAGAACAAGATGCCACGACAAGG - Intergenic
907548061 1:55279436-55279458 AAAAAAAAGTTGCCAGTAAATGG - Intergenic
907820068 1:57958615-57958637 ATAAACAAAGTGCCACTAACTGG + Intronic
907830657 1:58061272-58061294 TGAAACAAAGTGCCACAAACCGG + Intronic
908236483 1:62152023-62152045 GAAACCAAGGTGAAACAAAATGG - Intronic
908891111 1:68849022-68849044 AACAACAAAGTACCACAAACTGG + Intergenic
909139453 1:71845411-71845433 AGAAACAAAGTCCCACATAATGG + Intronic
909174606 1:72340492-72340514 AAATACAAGGTGCCAAAAATGGG - Intergenic
909306421 1:74085343-74085365 AAACACAACCTGCCATAAAATGG + Intronic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
909491923 1:76235694-76235716 GGTAACAAGGTGCCACAAACTGG + Intronic
910000108 1:82331176-82331198 AAAACCAAGGTACCACCCAAGGG + Intergenic
910365254 1:86458464-86458486 AAAAAGAAGCAGCCACAAAGAGG + Intergenic
910552368 1:88490143-88490165 CATAACAAAGTGCCACAAACTGG - Intergenic
911226377 1:95309959-95309981 AAAATAAAGGTGCCAGAAATAGG + Intergenic
911460123 1:98178984-98179006 AAAAACTTGTTGCCACCAAATGG - Intergenic
911515259 1:98860368-98860390 AAAAAAAAGGTGCCTCCAACTGG + Intergenic
911657750 1:100464067-100464089 AGAAACAAGGGCCTACAAAACGG - Intronic
913357453 1:117938629-117938651 AAAAACAAAGAGCCATGAAAGGG - Intronic
914397799 1:147287553-147287575 AAAAACAAAGGCACACAAAAGGG - Intronic
915280027 1:154816132-154816154 AAATACAAGGGACCAAAAAAAGG - Intronic
916242227 1:162651497-162651519 AAGAACAAGGTGCTAAAAGAAGG - Intronic
916862519 1:168821392-168821414 AAAAACAGAGTGCCATAATAAGG + Intergenic
916937222 1:169641922-169641944 ATAAACACAGTCCCACAAAAGGG + Intergenic
917614047 1:176719591-176719613 AAAAATAAGTTGTGACAAAAAGG - Intronic
917782863 1:178417772-178417794 AAAAAAAAAGTGCCACAAAAAGG + Intronic
918353841 1:183686181-183686203 AAAAAGAAAGTGACACAAAAGGG - Intronic
918944604 1:191047068-191047090 TAAAGCAAAATGCCACAAAAAGG + Intergenic
920598512 1:207297957-207297979 AAAATCAAGGTGAGACCAAAAGG + Intergenic
921234518 1:213112062-213112084 AAAAACAAGCTGACAGAGAAGGG + Intronic
921920704 1:220666125-220666147 AAAAACAAGGTGTCATGAATAGG + Intergenic
922782872 1:228267523-228267545 AAAAACAAGAAGCAATAAAAGGG - Intronic
922891324 1:229063901-229063923 AAAGACAAAGGGCCCCAAAAAGG + Intergenic
923063004 1:230494249-230494271 AAAAACAAGTGTCCACAAAAAGG + Intergenic
923260024 1:232259523-232259545 AAGTCCCAGGTGCCACAAAAGGG - Intergenic
923415563 1:233756071-233756093 AAAAACATGTATCCACAAAAAGG + Intergenic
1062767842 10:79388-79410 CGTAACAAAGTGCCACAAAATGG - Intergenic
1062991004 10:1817838-1817860 TATAACAAAGTGCCACAAACTGG + Intergenic
1063469923 10:6276011-6276033 AAATACAAGGTGCCATGAATTGG - Intergenic
1064800196 10:19061773-19061795 TACAACAAGGTACCTCAAAATGG + Intronic
1065152013 10:22831603-22831625 AAAAAGAAAATGCCACGAAAAGG + Intergenic
1066330821 10:34420257-34420279 AAAAACAGGGTGCTAGAAACAGG - Intronic
1067514113 10:46922015-46922037 CATAACAAAGTGCCACAAATTGG - Intronic
1067648140 10:48129817-48129839 CATAACAAAGTGCCACAAATTGG + Intergenic
1067912815 10:50364000-50364022 AACAAGATGGTACCACAAAAAGG + Intronic
1068845492 10:61667926-61667948 GAAAACAAGGAACTACAAAAAGG - Intronic
1069063798 10:63921658-63921680 AATAGCAAGGTGGCAGAAAATGG + Intergenic
1069533291 10:69234540-69234562 GAAAACAAGGTGGGACACAATGG - Intronic
1070257912 10:74826628-74826650 AACAACAGGGGGACACAAAATGG + Exonic
1070265254 10:74895996-74896018 AAAAACAAGGTTAAACAAGAGGG - Intronic
1070492186 10:76987856-76987878 AAAAACAAGGAACCATCAAAAGG + Intronic
1070643292 10:78184310-78184332 CATAACAAGATGCCACAAACTGG - Intergenic
1071425681 10:85546895-85546917 AAACACAAGGTGCCAAAGATCGG + Intergenic
1072319303 10:94233236-94233258 TACAACAAGGTCCCCCAAAATGG + Intronic
1072513001 10:96148089-96148111 AAGAACAGGATGCCACAAAAAGG - Intronic
1072766047 10:98096026-98096048 AAAAAGACGTTTCCACAAAATGG + Intergenic
1073889136 10:108077671-108077693 TAAAAAGAGGTGCCACAAAATGG - Intergenic
1074834699 10:117278944-117278966 AAAAAGAACGTGCTACAAATTGG + Exonic
1075582841 10:123635038-123635060 AAAAGCAAGGTGGCAGAAAGGGG - Intergenic
1077662847 11:4084776-4084798 AAAAACAAAATGCCCCAAAGGGG - Intronic
1078255784 11:9657701-9657723 CATAACAAGGTACCACAAACAGG + Intergenic
1078308461 11:10214753-10214775 AAACACTAGATGCCACAAACTGG + Intronic
1079260573 11:18875378-18875400 CACAACAAGGTACCACAAACTGG - Intergenic
1080116702 11:28629615-28629637 AATAACAAGGTACCACATACTGG + Intergenic
1080234177 11:30050010-30050032 AAAAAAAAAGTCCCACAAATAGG - Intergenic
1081031790 11:38093684-38093706 AAAAACAAGGAACCAAGAAATGG + Intergenic
1081372362 11:42319905-42319927 AAGAACAAGGAGCCACTGAAGGG - Intergenic
1081486260 11:43531989-43532011 CATAACAAGGTGCCATAAACTGG - Intergenic
1082070538 11:47936201-47936223 AAAAGGAAGGTGCCCCCAAATGG + Intergenic
1087132888 11:94684123-94684145 CATAACAAAGTGCCACAAACTGG + Intergenic
1087287213 11:96277903-96277925 AAAAAAAAGTTCCCACAGAAGGG - Intronic
1088522553 11:110714590-110714612 AAACACAAGGAGCCAAAGAAGGG - Intergenic
1088838023 11:113595292-113595314 TATAACAATGTGCCACAAACTGG + Intergenic
1090975174 11:131673817-131673839 TAAAACAAAGTGCCAGAACAAGG + Intronic
1091681487 12:2530647-2530669 AAATTCAAGGGGGCACAAAAGGG + Intronic
1091734735 12:2911184-2911206 AAAAAAATTGTGCTACAAAAAGG - Intronic
1091769994 12:3145354-3145376 CAAAACAAGTTCACACAAAAAGG - Intronic
1092563501 12:9641197-9641219 CAAAACAAGGTCCAAGAAAAGGG + Intergenic
1093926044 12:24909471-24909493 AGTAACAAAGTGCCACAAACTGG + Intronic
1094820048 12:34217560-34217582 AAAAACAAGGCAGCACAACATGG + Intergenic
1095201813 12:39393506-39393528 AAATACAAGGTGACACATAATGG - Intronic
1095345698 12:41146776-41146798 TGTAACAAGGTGCCACAAACTGG - Intergenic
1097050130 12:56217890-56217912 AAAAACTATCTTCCACAAAAAGG + Intronic
1097711485 12:62922300-62922322 ATAAACAAAATGCCACATAAGGG - Intronic
1097997441 12:65904544-65904566 TAAAACAAGGTGCAAGAGAATGG + Intronic
1098080136 12:66775241-66775263 AAAAACAAGCTGAAACAAAGGGG + Intronic
1098866741 12:75772154-75772176 GAAAACAAGGTGTCACGACAGGG + Intergenic
1098878105 12:75888005-75888027 AATAACAAAGTACCACAAACTGG - Intergenic
1098968015 12:76814599-76814621 AAAAATAATGAGCCAAAAAATGG + Intronic
1098974326 12:76886762-76886784 AAAAAGGAGGTGGGACAAAATGG - Intergenic
1099948898 12:89277897-89277919 TATAACAAGGTGCCACAGACTGG - Intergenic
1100246381 12:92761810-92761832 GAAAACTAAGTGCAACAAAAAGG + Exonic
1101405685 12:104426605-104426627 CAAAACAAGTTACCACAAACTGG - Intergenic
1101408061 12:104446266-104446288 AGTAGCAAGGGGCCACAAAAGGG + Intergenic
1101530824 12:105571805-105571827 CAAAACCAAGTGCCAAAAAAAGG - Intergenic
1101833212 12:108275340-108275362 CAAATCAAAGTGCCACAAACCGG + Intergenic
1101854194 12:108428462-108428484 TATAACAAGTTGCCACAAACTGG - Intergenic
1102545979 12:113655927-113655949 AGAAACAAGCTACCACAAATGGG + Intergenic
1103262578 12:119601064-119601086 AAAAGGAAAGTTCCACAAAAAGG + Intronic
1103431274 12:120889164-120889186 AAAAACACAATGCCACAGAAAGG + Intronic
1104170166 12:126272982-126273004 TACAACAAAGTGCCACAAACTGG - Intergenic
1104510637 12:129374608-129374630 GGAAACAAGGTGCCACCCAAGGG + Intronic
1105532503 13:21232440-21232462 AAACACAAGGAGCAACAACACGG + Intergenic
1105680908 13:22726168-22726190 AAAAAAAAAGTGGCACAAAAAGG + Intergenic
1106630485 13:31467069-31467091 AATAACAAATTACCACAAAATGG - Intergenic
1107820986 13:44285487-44285509 AAAAAGAAGATGGCTCAAAAGGG - Intergenic
1109082593 13:57924381-57924403 AAAAACAAGTTGACATGAAAAGG + Intergenic
1109142927 13:58737973-58737995 TGCAACAAAGTGCCACAAAATGG - Intergenic
1109509219 13:63347131-63347153 CAAAACAATGTGTCACAAATGGG + Intergenic
1109781811 13:67120505-67120527 TAAAATTAGGTGGCACAAAAAGG - Intronic
1109829486 13:67768918-67768940 AATACCAAAGTGCCACTAAAAGG + Intergenic
1110343921 13:74424300-74424322 CATAACAAAGTACCACAAAATGG + Intergenic
1110550348 13:76805048-76805070 CACAACAAAGTGCCACAAACTGG + Intergenic
1111028951 13:82570577-82570599 AAAAAACAGGTGCCACTCAAAGG + Intergenic
1111184163 13:84709171-84709193 AAAATCAAGGTGCCAAATCAAGG - Intergenic
1111295512 13:86272811-86272833 ATAAACATGGTCCAACAAAAAGG + Intergenic
1111316828 13:86573681-86573703 AAAAACAAGTTGAGACTAAAAGG - Intergenic
1111781352 13:92729813-92729835 GAAAACAAGGTGCCACACACTGG - Intronic
1112715668 13:102182025-102182047 CATAACAAAGTACCACAAAATGG - Intronic
1112729024 13:102338687-102338709 AAAAACAAGATATCATAAAAAGG + Intronic
1112774571 13:102830169-102830191 AATAAGATAGTGCCACAAAAGGG - Intronic
1112896905 13:104310600-104310622 AAAAAAAAAGAGCTACAAAATGG - Intergenic
1115286335 14:31717074-31717096 AAAAACAAGGTGCCACAAAAGGG - Intronic
1115362997 14:32524813-32524835 AAAAACACGGAGCCAGAAATGGG - Intronic
1118156409 14:63246645-63246667 AAAAACAAGGTGCAAGAAATAGG - Intronic
1118305186 14:64649649-64649671 AATAACAAAGTACCACAAACTGG - Intergenic
1118328762 14:64800005-64800027 ACAATCAAGGTGCCACGAAATGG + Intronic
1118722638 14:68605178-68605200 AAAATCAAGGTGTCACAGCAGGG + Intronic
1118895287 14:69940702-69940724 ATTAACAAGGAGCCACAAAATGG - Intronic
1119766134 14:77189042-77189064 AAAAACAATGTTGCAAAAAAAGG + Intronic
1120329437 14:83071678-83071700 AAATACAAACTGCCAGAAAAAGG - Intergenic
1120486978 14:85126270-85126292 CATAACAATGTGCCACAAACTGG - Intergenic
1121057311 14:90868654-90868676 AAAAACAGGGTACCTCATAATGG - Exonic
1121255383 14:92526797-92526819 CATAACAAAGTGCCACAAACTGG + Intronic
1121918511 14:97858227-97858249 CAAATCAAGGAGCCAGAAAATGG + Intergenic
1124514366 15:30354149-30354171 TAAAACAAAGTGCCTCAAAAAGG + Intergenic
1124728554 15:32176616-32176638 TAAAACAAAGTGCCTCAAAAAGG - Intergenic
1125020151 15:34976511-34976533 AAAAACTAGATACCAGAAAAAGG + Intergenic
1127136559 15:55929877-55929899 AAAAACAAGATACTAAAAAAGGG + Intronic
1129485752 15:75870573-75870595 ATAAACAAGGGGCCGCAACATGG + Intronic
1129520495 15:76183092-76183114 AAAAAAAAAAAGCCACAAAATGG - Intronic
1130168880 15:81491398-81491420 AAGAAAATGGTGTCACAAAAGGG + Intergenic
1130848066 15:87766033-87766055 AAAATCAAGCTGTCACTAAAGGG + Intergenic
1131192744 15:90330267-90330289 AAAAAAAAAGTGGCACCAAATGG + Intergenic
1132213024 15:100039772-100039794 AAAAACAAGGTGTATCAACAAGG - Intronic
1132456776 16:28481-28503 CGTAACAAAGTGCCACAAAATGG - Intergenic
1132742101 16:1419719-1419741 AAAAACTAGATGCAAAAAAAGGG + Intergenic
1132753498 16:1470493-1470515 GGAAACAAGGTGACACACAAAGG + Intronic
1133135299 16:3707028-3707050 AAAAAACAGGTGATACAAAATGG - Intronic
1134285489 16:12858285-12858307 AACGACAAAGTGCTACAAAAAGG + Intergenic
1137470279 16:48748579-48748601 AATCACCAGGTGCCAGAAAAAGG + Intergenic
1138425712 16:56931055-56931077 CATAACAAAGTGCCACAAACTGG - Intergenic
1139008575 16:62604499-62604521 ACATAAAAGGTACCACAAAAAGG + Intergenic
1139183173 16:64771059-64771081 AAAATCCAGGACCCACAAAATGG + Intergenic
1141016821 16:80458679-80458701 AAAACCAAGATGTCAGAAAAGGG + Intergenic
1141251895 16:82366884-82366906 ATAAAACATGTGCCACAAAAGGG - Intergenic
1141314605 16:82950058-82950080 TATAACAAAGTGCCACAAACTGG + Intronic
1142723432 17:1793442-1793464 AAAGACCAGGTGCCACAGAAAGG - Intronic
1142776700 17:2145748-2145770 AAAAACAAGAAGCCACAGAGAGG + Intronic
1144100551 17:11938473-11938495 AAAAAGAATGGGCCACCAAAGGG + Intronic
1145113722 17:20188724-20188746 AAAACCAAAGTGCTACACAAAGG + Intronic
1145745761 17:27318480-27318502 AAAAACAAACTCACACAAAATGG + Intergenic
1148248261 17:46050343-46050365 AACCAGAAGGTGCCACTAAAAGG - Intronic
1149616435 17:58004718-58004740 CAAAATAAGTTGCTACAAAATGG + Intronic
1150486807 17:65549804-65549826 AGAAAGCAGGGGCCACAAAAGGG + Intronic
1150698639 17:67427938-67427960 AAGGACAATGTGCCACAAATGGG - Intronic
1151152421 17:72099384-72099406 AATAACAAGGGACCACAAACGGG + Intergenic
1151507008 17:74535164-74535186 CAATAAAAGATGCCACAAAATGG + Intergenic
1152501508 17:80713392-80713414 GAAAACAAGCAGCCACAAACTGG - Intronic
1152960667 18:78720-78742 CGTAACAAAGTGCCACAAAATGG - Intergenic
1153264606 18:3257821-3257843 AAAAACAAGGTACTACTAAAAGG + Intergenic
1154038181 18:10827292-10827314 AAAACAAAGGTGGCAGAAAATGG - Intronic
1154437670 18:14359625-14359647 AAAAAAAAAGTACAACAAAAAGG + Intergenic
1155087448 18:22472127-22472149 AAAAACCAGATGGCAGAAAATGG + Intergenic
1155722171 18:29029240-29029262 AGAAACAAGCTGCCACATACAGG + Intergenic
1155829447 18:30494141-30494163 AAAAAAAAGGTCCCACAAACTGG + Intergenic
1158784579 18:60694372-60694394 AATAACAAGGAGCCAGAAAAGGG + Intergenic
1159456805 18:68669541-68669563 CATAACAAAGTGCCACAAACTGG + Intergenic
1159803878 18:72930865-72930887 AAAACCAAGGAGCCAAAAATGGG - Intergenic
1160231332 18:77051854-77051876 AGAAACAAGGTGTTAAAAAAAGG - Intronic
1160328038 18:77968454-77968476 CATAACAAGGTGCCACAATCTGG - Intergenic
1163133869 19:15295042-15295064 AAATAAAAGGTTCCATAAAAGGG + Intronic
1164320842 19:24144505-24144527 AAATAAAAAGTGCAACAAAAAGG - Intergenic
1164645082 19:29853286-29853308 AAAAAAAAAGAGCCACAGAAGGG - Intergenic
1164678297 19:30117713-30117735 AAAGACAAGGAGGCACAGAAGGG + Intergenic
1165599399 19:37040583-37040605 TAAAACAAGATACCACATAAAGG + Intronic
1166197502 19:41216843-41216865 AAAAAAAAAATGCCACAATAAGG + Intergenic
1166768557 19:45266523-45266545 AGAAACAAAGTGTCCCAAAATGG + Intronic
1167100744 19:47403112-47403134 AAAAACACGGAGCCACCAACTGG - Exonic
1167155031 19:47733226-47733248 AAAAAAAAGGAGCCCCAGAAGGG - Intronic
1167467302 19:49657166-49657188 ACAAAAAAGGAGCCACAAAAAGG + Intronic
1167803456 19:51762071-51762093 AAAAAAAAGGTCCAATAAAATGG - Intronic
925205230 2:2000314-2000336 ATGAACTAGGAGCCACAAAAGGG - Intronic
925555163 2:5122698-5122720 CATAACAAGGAGGCACAAAATGG + Intergenic
926230988 2:11003672-11003694 AAAAACAAAGCACCACAAACTGG - Intergenic
926432402 2:12801642-12801664 AAAAGCAAGGTGCCAAAATAGGG + Intergenic
926857072 2:17268641-17268663 CATAACAAAGTACCACAAAATGG + Intergenic
927618927 2:24631114-24631136 AAAAAGAAGGTGCCTGAAAAAGG - Intronic
928047008 2:27944985-27945007 AAAAAAAAGGTAGCTCAAAATGG - Intronic
928058405 2:28083114-28083136 AAGTACAAGGTGCAGCAAAAAGG - Intronic
929002111 2:37357303-37357325 AAAAAAAAAATTCCACAAAATGG - Intronic
930681794 2:54264574-54264596 AAAAACAAGGTGGGAGGAAAGGG + Intronic
930850326 2:55952915-55952937 GAAAACAAGGAGAAACAAAAAGG - Intergenic
931083368 2:58801116-58801138 TAACACAAGGTGCAACACAATGG + Intergenic
931932600 2:67156995-67157017 AAAAAGATGGTGCCACACAGTGG - Intergenic
932518613 2:72382203-72382225 AAAAACAGGGTTCAACATAATGG + Intronic
932543491 2:72682152-72682174 ATAAAAAAGGTGCCAGAAAAAGG + Intronic
933481759 2:82867060-82867082 TATAACAAAGTGCCACAAACTGG + Intergenic
934487241 2:94726533-94726555 AAAAACACAGTGCCTCAAATGGG - Intergenic
934677022 2:96256830-96256852 TAAAACAAGGTTCCAAAAACTGG + Intronic
934991604 2:98925378-98925400 AAAAACAAGGTGACAAGGAAAGG + Intronic
935515076 2:104026619-104026641 GAGACCAAAGTGCCACAAAAGGG - Intergenic
935912491 2:107912084-107912106 AAAAACAAAGTAACAAAAAAAGG + Intergenic
936029461 2:109059581-109059603 AAAAAAAAGGTCACACAACATGG + Intergenic
936259409 2:110946082-110946104 CAAAACGTGATGCCACAAAAAGG - Intronic
937925195 2:127162568-127162590 AGCAACCAGGTACCACAAAATGG - Intergenic
938012903 2:127842934-127842956 AAATACACAGTGCCACACAACGG + Intergenic
938895650 2:135747599-135747621 AACAGAAAGGTGCCACATAAAGG + Intronic
940574373 2:155481037-155481059 AATAAAAATGTGCCAAAAAATGG - Intergenic
941254487 2:163211481-163211503 AATAACAAAGTACCACAGAATGG + Intergenic
941522169 2:166559646-166559668 CAGAACAAGGTGTCATAAAAGGG + Intergenic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942188277 2:173445482-173445504 CATAACAAAGTGCCACAAACTGG + Intergenic
942270456 2:174269056-174269078 AATAACAAAGTGCCACAGACTGG - Intergenic
942957594 2:181791676-181791698 AAAAACAACCCGCCACCAAAGGG - Intergenic
944945832 2:204683797-204683819 AAAAACATGGTGTCAGAATATGG - Intronic
945780338 2:214163330-214163352 AAAAACAAATTGCCATAAAAAGG - Intronic
946065492 2:216983734-216983756 AAAAACCAGGACACACAAAAAGG + Intergenic
947140222 2:227013612-227013634 AAGATCAAGGAGCCACAACAGGG - Intronic
947142343 2:227031159-227031181 GAAAACAAGTTCCCACAAATAGG + Intronic
947608274 2:231504694-231504716 AAAAGCAAGGCTCCACAAACTGG + Intergenic
948398045 2:237661976-237661998 CATAACAAAGTGCCACAAACTGG + Intronic
948843843 2:240673377-240673399 AAAAGCAAGTTGCCAAAAACAGG - Intergenic
1169148379 20:3269600-3269622 CAAAACAAAATGCCTCAAAATGG + Intronic
1169474340 20:5917484-5917506 GAATAGAAGGTGCCACCAAATGG + Intronic
1169648229 20:7838142-7838164 AAATCCAAGATCCCACAAAAAGG + Intergenic
1169743771 20:8922316-8922338 AACTACAAGGTGCCACATGATGG - Intronic
1169921683 20:10740912-10740934 ACAAACAAGCTGCAACAAATGGG + Intergenic
1170044655 20:12072451-12072473 TAAAACAAAGTACCACAAACTGG - Intergenic
1170304124 20:14918591-14918613 AAAAACACAGTGTCACAAAAAGG - Intronic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1173519422 20:43688171-43688193 AAAAAAAGAGTGCCAGAAAAGGG - Intronic
1173572238 20:44084966-44084988 CATAACAAGGTACCACAAACTGG - Intergenic
1174890035 20:54382012-54382034 AAAAAAAAGGTGAAAAAAAAAGG - Intergenic
1174925266 20:54752042-54752064 CATAACAAGATACCACAAAAAGG - Intergenic
1175553789 20:59833530-59833552 AAAGACAAGGTTCCAACAAAGGG + Intronic
1175641156 20:60631531-60631553 AAAAGCATGGGGCCACAAATAGG - Intergenic
1177930461 21:27276621-27276643 AAAAACAAGGTGTTACTATAAGG - Intergenic
1178005049 21:28209408-28209430 ACACACAAGATGCCACAGAAGGG + Intergenic
1179379318 21:40883704-40883726 AAATAAAAGAGGCCACAAAATGG + Intergenic
1182407602 22:30150357-30150379 AAGAACAGGATGCCATAAAAAGG - Intronic
1182559837 22:31151029-31151051 AAAAACTTGGTACCAAAAAAGGG - Intergenic
1182670589 22:31992325-31992347 AAAAACAAATTGGCACAAGAGGG - Intergenic
1182765936 22:32758634-32758656 AATCACAAGGTCCCACAATAGGG - Intronic
1183892077 22:40937834-40937856 TAAAAACAGGTGCCCCAAAATGG - Intergenic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
951057723 3:18167192-18167214 AAAAACAAATTGCCTGAAAAAGG + Intronic
951335337 3:21414811-21414833 AAAAACCAGATGCCATAAAATGG + Intergenic
951656433 3:25014135-25014157 AAAAAACATATGCCACAAAATGG - Intergenic
951781694 3:26370523-26370545 CAAAACAAAGTGCAATAAAATGG - Intergenic
952589522 3:34933484-34933506 AAAAATAAGGTTTCAAAAAAAGG - Intergenic
954056261 3:48028472-48028494 AAAACAAAAGTACCACAAAATGG + Intronic
955201255 3:56854209-56854231 AAAAACAATTAGGCACAAAAAGG + Intronic
955795760 3:62635250-62635272 AAAAACAAGGTGACATCACATGG + Intronic
956102596 3:65784125-65784147 AAAAAAAAGGTGCAATAACAAGG + Intronic
956312759 3:67899948-67899970 AAGAACAAGGTGCAAAAAGACGG - Intergenic
956544070 3:70379777-70379799 AAAAGCAAAGTGCAAAAAAAAGG + Intergenic
957223928 3:77418181-77418203 AAAAACAAGAAGCACCAAAAAGG - Intronic
958263850 3:91414248-91414270 AAAAAAAAAGTGCCAGTAAAGGG - Intergenic
958710691 3:97713532-97713554 AAAAATACTGTGCCAAAAAAAGG + Intronic
959472713 3:106772440-106772462 AAAAAAAACGTGCAACAACATGG - Intergenic
959810225 3:110609897-110609919 ACAAACAAGGTGATTCAAAATGG + Intergenic
959828124 3:110825622-110825644 AAAAACAAAATGAAACAAAATGG + Intergenic
962017393 3:131455906-131455928 AAACACAAGGGGACACAAGAAGG - Intergenic
963388588 3:144628582-144628604 CAAAGTAAGGTGCCAGAAAAAGG - Intergenic
963656313 3:148055777-148055799 AAAGACAAAGTGCCACATATAGG + Intergenic
963713745 3:148779188-148779210 CAAAACAAGGAGACACAAAAGGG + Intergenic
963966823 3:151381184-151381206 AGAAACACAGTGCCACAAGAAGG - Intronic
964293552 3:155208720-155208742 AATAACAAAGTGCCACAGACTGG - Intergenic
966055311 3:175679935-175679957 AAAAAGAAGGTGAGAAAAAAAGG + Intronic
967187427 3:186957006-186957028 AAAAGCAATGTGCAACAAAGAGG + Intronic
968280116 3:197470805-197470827 CAAAACAAAGTGCCACAAATTGG + Intergenic
969038883 4:4278118-4278140 AAAAAATAGATGCCACATAAAGG + Intronic
969740923 4:9025907-9025929 AAAAACACGGTGCCCCGAACAGG - Intergenic
970015942 4:11512661-11512683 AAAAACTATGAGCTACAAAATGG + Intergenic
970034198 4:11713423-11713445 AAAAATAAGGTCCCAAGAAAAGG + Intergenic
970088150 4:12371019-12371041 AAAAACTAAGGGCCACAAAAAGG + Intergenic
970335195 4:15031257-15031279 AAAAACAAACTCCTACAAAATGG - Intronic
971088772 4:23314589-23314611 AAAAACATGTTATCACAAAAAGG - Intergenic
971201510 4:24513407-24513429 AAGCACTAAGTGCCACAAAATGG - Intergenic
971628766 4:28961357-28961379 AAAAACAAGATTCCAAAAAATGG + Intergenic
972127656 4:35789725-35789747 AAAAATAAGGAGAGACAAAAGGG - Intergenic
973873977 4:55195749-55195771 AAAGAAAATGTGGCACAAAATGG + Intergenic
973957394 4:56076309-56076331 CATAACAAAGTGCCACAGAATGG - Intergenic
974836964 4:67262735-67262757 CACAACAAAGTACCACAAAAAGG + Intergenic
975097412 4:70473450-70473472 AAAAAAAAGGTACAAGAAAAAGG + Intronic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
976777569 4:88722748-88722770 AAAATCATAGTGCCTCAAAATGG + Intergenic
977162959 4:93659166-93659188 AAAAAAAAAGTGCCAAAAACTGG + Intronic
977422763 4:96824033-96824055 TACAACAAGATGCCACCAAAAGG - Intergenic
978218377 4:106237241-106237263 AAAAGAAAGGTGCTAGAAAAAGG + Intronic
979657335 4:123210549-123210571 AAAGAAAATGTGCAACAAAATGG - Intronic
979932437 4:126647784-126647806 AGTAACAAAGTGCCACAAACTGG - Intergenic
980377090 4:131963922-131963944 AAAAACAAAGTGAAAAAAAAAGG + Intergenic
980952108 4:139391266-139391288 AAAAACAAAGTCCCACGAAATGG + Exonic
981758200 4:148164215-148164237 AGAATCAAGGTGTCACAACAGGG - Intronic
982524284 4:156457629-156457651 AACAACAAAGTACCACAAACTGG - Intergenic
982571154 4:157052110-157052132 AAGAACACGGTGTAACAAAAAGG - Intergenic
983992214 4:174133874-174133896 AAAACCAGTGTGACACAAAAAGG - Intergenic
984581050 4:181510572-181510594 AAAAAGAAAGTGTAACAAAAAGG + Intergenic
985766827 5:1784487-1784509 AAAAAGATGGTGCCACAGCAGGG - Intergenic
985882320 5:2647734-2647756 AAAAACATGGTGCAACAGACAGG - Intergenic
986166649 5:5278354-5278376 TGATAAAAGGTGCCACAAAAAGG - Intronic
986550544 5:8949517-8949539 CATAACAAAGTGCCACAAATGGG - Intergenic
986576450 5:9218260-9218282 TAAAACAAAGTACCACAAACAGG - Intronic
987617273 5:20292540-20292562 TAAAACAAGGAACCACAAACTGG + Intronic
988181339 5:27797693-27797715 AAAAATAAGGTGCCAGAGACTGG + Intergenic
988320634 5:29690679-29690701 AATAACAAGGTACCATAAACTGG - Intergenic
988594984 5:32583020-32583042 AAGAAGAGGGTGGCACAAAAAGG - Intronic
989585275 5:43069654-43069676 TAAAGGAAGGTGGCACAAAATGG + Intronic
990057707 5:51604804-51604826 TAAAACAAAGTGCCACAAAGAGG - Intergenic
990062335 5:51667373-51667395 AAAAAGAGAGTGGCACAAAAAGG - Intergenic
990433506 5:55762713-55762735 TAAAACAAGGGGCTACATAAGGG - Intronic
990695788 5:58415665-58415687 AAAAACAAGCTGCAAAAAATTGG - Intergenic
991219578 5:64197752-64197774 AAAAATAATGTGCCACGAAAAGG - Intronic
991292907 5:65050133-65050155 CAAAATAAAGTGCCACAAACTGG + Intergenic
991716642 5:69457039-69457061 AAAAACTAGGTCACACACAAAGG + Intergenic
991731056 5:69588641-69588663 AAAAACTAGGTCACACACAAAGG + Intronic
991807488 5:70443800-70443822 AAAAACTAGGTCACACACAAAGG + Intergenic
991863894 5:71039211-71039233 AAAAACTAGGTCACACACAAAGG - Intronic
994003714 5:94812780-94812802 AAAAAAAAGGTGATACAAAATGG + Intronic
994104454 5:95930897-95930919 AAAAAAAAAATGGCACAAAATGG - Intronic
995027906 5:107445802-107445824 AAAAGCCAGGTGCCACAAGAAGG - Intronic
995762601 5:115579262-115579284 AAAAACTAGGGACCACAAAAGGG - Exonic
997605218 5:135170337-135170359 GAAAACACTTTGCCACAAAATGG - Intronic
997783314 5:136682262-136682284 AAAAAGTGTGTGCCACAAAATGG - Intergenic
998024297 5:138800805-138800827 AAAAAAAAAGTGCAACAGAAGGG + Intronic
998373663 5:141677722-141677744 AAAAACAAGGGGCCAGATAAGGG - Intronic
998795468 5:145813439-145813461 AGCAACAAGCAGCCACAAAAAGG - Intronic
1000317903 5:160110729-160110751 AAAAATAAAGTTCAACAAAAAGG + Intronic
1000430047 5:161140879-161140901 AAAAACAAGGGCCTTCAAAATGG + Intergenic
1000945163 5:167413451-167413473 AATAGCAAGGTGTCACAAATTGG - Intronic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1001720367 5:173852068-173852090 ATAAACAAAGTACCACAAACTGG - Intergenic
1003127762 6:3369242-3369264 AAAAAAATGGTGGCACAAAAAGG + Intronic
1003453888 6:6262717-6262739 AAAAAAAAGGAGTCACAAAATGG + Intronic
1004124662 6:12861239-12861261 AAAAGGAAGGTTCCATAAAAAGG + Intronic
1004317297 6:14600924-14600946 AAAAACAAGGAGCCACCAAAGGG + Intergenic
1005011906 6:21343723-21343745 AAAAACAAAGTGCCATAACTTGG + Intergenic
1005064675 6:21806755-21806777 AAATACAAGCTGGCACAAGATGG - Intergenic
1005869249 6:29961616-29961638 AAAATCAAAGTGCCAGAAACAGG - Intergenic
1007897118 6:45374175-45374197 CAAAAGAATGTGCCAGAAAAGGG + Intronic
1008461713 6:51782547-51782569 AATAAAAAGGTGACATAAAAGGG - Intronic
1008991580 6:57608724-57608746 AAAAAAAAAGTGCCAGTAAAGGG + Intronic
1009180101 6:60506971-60506993 AAAAAAAAAGTGCCAGTAAAGGG + Intergenic
1009275674 6:61676164-61676186 AAATAAAAGTTGCCACTAAAAGG + Intergenic
1009777334 6:68221091-68221113 AAAAAGGAGGTGCCACAAAGTGG + Intergenic
1010056432 6:71570830-71570852 AAAAAAAAAATTCCACAAAATGG - Intergenic
1010300941 6:74258364-74258386 AAAAACAAGTTGTCAGAAAGAGG - Intergenic
1010823705 6:80447185-80447207 AAGAAAATGGTGGCACAAAAGGG - Intergenic
1010885299 6:81230484-81230506 AAAAACAAGATCCCAGAGAAAGG + Intergenic
1011119669 6:83937898-83937920 AAAAAGGAGGTGACACCAAAAGG - Intronic
1011790422 6:90893001-90893023 CATAACAAGGTGCCACAGATGGG + Intergenic
1011877568 6:91980074-91980096 AAAAACAAAGTGAAACAAATGGG - Intergenic
1012073054 6:94647634-94647656 GAAAACAAAGTACCACAAATTGG + Intergenic
1012731811 6:102892803-102892825 CATAACAAAGTGCCACAGAATGG + Intergenic
1012961997 6:105631731-105631753 ACAGACCATGTGCCACAAAATGG - Intergenic
1013363478 6:109416501-109416523 AAAAAAAAAAAGCCACAAAAAGG - Intronic
1013387064 6:109642238-109642260 CATAACAAAGTGCCACAAACTGG - Intronic
1013610667 6:111791782-111791804 TATAACAATGTGCCACAAAATGG - Intronic
1013707423 6:112854438-112854460 AAAAACAAATTGCTACCAAAGGG + Intergenic
1014727241 6:124986264-124986286 AAAAACAAGGTCACAAAAGAAGG - Intronic
1015804186 6:137092057-137092079 ATAAACAGGGTGCTCCAAAAAGG - Intergenic
1015961695 6:138656806-138656828 CAAAAGAAGCTGCCAAAAAAGGG + Intronic
1016200585 6:141402753-141402775 ATAAACTAGGTGGCACATAATGG - Intergenic
1016390032 6:143565617-143565639 AAAAAAAGAGTGCCAAAAAATGG + Intronic
1017263409 6:152414415-152414437 AAAAAAAAGTGGCCACAAAGAGG + Intronic
1017433219 6:154391638-154391660 AGACACAAAGTGACACAAAATGG - Exonic
1017575066 6:155793179-155793201 AAACACAAAGTAACACAAAAAGG + Intergenic
1017609474 6:156169804-156169826 AAAACCAAGGTGCCATATTATGG - Intergenic
1017969697 6:159301305-159301327 AAGAACAATGTTCCAGAAAAAGG - Intergenic
1018519412 6:164630069-164630091 GAAAACACTGTGCCACAAGAGGG - Intergenic
1018682670 6:166276908-166276930 AGAAAAAATGTGCCACAAACTGG + Intergenic
1019568784 7:1698314-1698336 AAAAGAAAATTGCCACAAAAGGG - Intronic
1019890197 7:3940465-3940487 AAGAAGAAGATGCCATAAAACGG - Intronic
1021742584 7:23702852-23702874 CAAGACAAGGTGCCATCAAATGG - Intronic
1021972629 7:25980746-25980768 CAAAACAAAGTGCCACAGACTGG - Intergenic
1022244245 7:28542643-28542665 AAAAGCACAGTGGCACAAAAGGG - Intronic
1022854087 7:34298424-34298446 CAAAAGAAGGAGCCACAAAGTGG + Intergenic
1023378794 7:39585565-39585587 AATAACGAGGTACCACAGAACGG - Intronic
1024559448 7:50631031-50631053 AAAAACCAGGTGCCCCAGAGTGG - Intronic
1024912742 7:54464743-54464765 AAAATGAAGATGCCACTAAAAGG + Intergenic
1026207848 7:68273704-68273726 AAGCATAAAGTGCCACAAAATGG - Intergenic
1026532929 7:71215280-71215302 AACAACAAGGTGCAAAAAAAAGG - Intronic
1026735459 7:72946022-72946044 AAACACAGGGTGCCTCAATAGGG - Intronic
1026785798 7:73300952-73300974 AAACACAGGGTGCCTCAATAGGG - Intergenic
1027108267 7:75418986-75419008 AAACACAGGGTGCCTCAATAGGG + Intronic
1027778573 7:82496407-82496429 AATAACAAAGTGCCACAGACTGG + Intergenic
1028323938 7:89498288-89498310 TGAAACAATGTGCCACAAACTGG - Intergenic
1028518831 7:91706866-91706888 AAAATCAAGAGGCCACAAGATGG + Intronic
1028560103 7:92165876-92165898 AAAAAAAAGGTAACATAAAAGGG + Intronic
1029235299 7:99111078-99111100 AAAATCAAAGTGCTATAAAAAGG - Intronic
1029436112 7:100564981-100565003 AAAAACACAGTGCTACAAGAAGG - Exonic
1029907566 7:104106918-104106940 CATAACAATGTGCCACAAACTGG + Intergenic
1030201478 7:106909842-106909864 CATAACAAAGTGCCACAAACTGG - Intergenic
1030871541 7:114762375-114762397 AAAAAAATGGTACCACGAAAAGG + Intergenic
1031432959 7:121695546-121695568 CAAAACAAAGTACCACAAATTGG + Intergenic
1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG + Intronic
1031511279 7:122653246-122653268 AAAAACAAGGGGCCACACAAGGG + Intronic
1032379341 7:131460097-131460119 AAGAATAAGCTGCCATAAAAAGG - Intronic
1032638489 7:133737660-133737682 AAAAACAATCTGCTACACAAAGG - Intronic
1034100744 7:148448391-148448413 AAAAAAAAAGTGACACAAAAAGG + Intergenic
1034391598 7:150791758-150791780 AAAAACAAGGTGGCAGAGGAAGG + Intronic
1034684715 7:152959806-152959828 AAACACAAGGTGGCACTAAAGGG + Intergenic
1034877481 7:154738338-154738360 AGAAACAAGGAGCCACGAAGAGG - Intronic
1035761208 8:2070170-2070192 ATAAACAAGCTGCCTCGAAAGGG - Intronic
1035849297 8:2899274-2899296 AATAACAAAGTACCACAAACTGG - Intergenic
1035968263 8:4219139-4219161 CAACACCAGGTGCTACAAAAAGG - Intronic
1036608651 8:10330831-10330853 CATAACAAGGGGCAACAAAACGG - Intronic
1037502263 8:19497359-19497381 AAACACAAGGTATCTCAAAAGGG + Intronic
1038588739 8:28815744-28815766 ATAAGCAAGATGCCACATAAGGG + Intronic
1039443509 8:37612083-37612105 AAAAACACAGTGCCCCACAAAGG + Intergenic
1039996340 8:42537080-42537102 AAAAAAAAGATTCTACAAAAAGG + Intronic
1040904160 8:52448300-52448322 AAGAATAAGGCTCCACAAAAAGG - Intronic
1042189660 8:66172790-66172812 AAGAAAAAGAGGCCACAAAATGG + Intronic
1042749030 8:72138117-72138139 ATAAACAAAGTGCCACAACCTGG + Intergenic
1042878766 8:73464695-73464717 AAAAACAAAGTGTAAAAAAAAGG + Intronic
1043293268 8:78630982-78631004 ATAAACATGGTGTCACAAATTGG - Intergenic
1043503610 8:80880536-80880558 AAAAATAATGTGAGACAAAAAGG - Intergenic
1044049315 8:87480396-87480418 AAAAATAGGGTGCTAGAAAATGG - Intronic
1045931674 8:107634061-107634083 AAAAAAAAAGTGCCAAAAATTGG + Intergenic
1046119758 8:109831203-109831225 AAAAACAGGGTGTTACTAAAAGG + Intergenic
1046524158 8:115362533-115362555 AAAATCAAGGATCTACAAAAAGG + Intergenic
1046804033 8:118460622-118460644 AAAAACAAGAAATCACAAAATGG + Intronic
1046816039 8:118584742-118584764 AAAAACATGGTGCCTTCAAAAGG - Intronic
1047610151 8:126512932-126512954 AATAACAAAGTACCACAAATAGG + Intergenic
1048041069 8:130729240-130729262 AAAGAAAAGATGCCAGAAAAAGG + Intergenic
1048146405 8:131848783-131848805 AAAATTATTGTGCCACAAAAAGG + Intergenic
1048159359 8:131999705-131999727 AAAAAAAAAGATCCACAAAAGGG + Intronic
1048230387 8:132634741-132634763 TATAACAAAGTGCCACAAACTGG - Intronic
1048480635 8:134788938-134788960 AAATACAAGGCCACACAAAAAGG - Intergenic
1048998818 8:139811148-139811170 AAGAACAAGGTTCTATAAAAAGG + Intronic
1052296002 9:26896419-26896441 CATAACAAAGTGCCACAAACTGG - Intergenic
1052565588 9:30145764-30145786 AAAAGCAAGGTAAAACAAAATGG + Intergenic
1052659049 9:31404571-31404593 AAAAAAAATGAGCCACAAAAAGG + Intergenic
1052822837 9:33152532-33152554 AAAAAAAATGGGCCAAAAAAAGG + Intronic
1053529726 9:38868313-38868335 ACTAACAAAGTACCACAAAATGG - Intergenic
1053670562 9:40357818-40357840 AAAAACACAGTGCCTCAAATGGG + Intergenic
1053920352 9:42984162-42984184 AAAAACACAGTGCCTCAAATGGG + Intergenic
1054201951 9:62092740-62092762 ACTAACAAAGTACCACAAAATGG - Intergenic
1054323032 9:63691963-63691985 AAAAACAAAGTGAAAAAAAAAGG + Intergenic
1054381685 9:64497881-64497903 AAAAACACAGTGCCTCAAATGGG + Intergenic
1054514051 9:66018482-66018504 AAAAACACAGTGCCTCAAATGGG - Intergenic
1054636406 9:67495619-67495641 ACTAACAAAGTACCACAAAATGG + Intergenic
1054949109 9:70829861-70829883 AAAAACAAGTAGCAACAAAATGG - Intronic
1057388408 9:94623927-94623949 AAAAACAAGGTGACAGGAGAGGG + Intronic
1057832519 9:98418066-98418088 CCAAATAAGGGGCCACAAAAGGG + Intronic
1057984689 9:99700975-99700997 AAAAACAAGGTACAAAACAAAGG - Intergenic
1058219322 9:102277419-102277441 GAAAACATGGTGCCACACGATGG - Intergenic
1058329884 9:103747012-103747034 AGAAACAAGCTGCCACCAACTGG - Intergenic
1058590845 9:106563699-106563721 AAAAACATGGTGCTATGAAATGG + Intergenic
1058595538 9:106611459-106611481 AAGAACAAGTTGCTAAAAAAGGG + Intergenic
1058747908 9:108009603-108009625 AAAAAAAAAGTGTCACAAACTGG + Intergenic
1059022711 9:110593866-110593888 GAATACATGCTGCCACAAAAAGG - Intergenic
1059094951 9:111402654-111402676 GAAAACAAAGAGCCAAAAAATGG + Intronic
1059101655 9:111477886-111477908 AAAAAAAAGTTGCCAAAAATAGG - Intronic
1060914324 9:127376822-127376844 AAAAACTAGCCTCCACAAAAGGG + Intronic
1061174036 9:128981408-128981430 AAAAAAAAGCTGTCATAAAAGGG - Intronic
1062488977 9:136795270-136795292 AAAAACAAGGCGCCACCGACTGG - Intronic
1062515552 9:136933278-136933300 AAGAACAAGGTGTCAGAAACTGG + Intronic
1062737430 9:138145027-138145049 CGTAACAAAGTGCCACAAAATGG + Intergenic
1185497088 X:563678-563700 TTAAACAAGATGCCACATAACGG + Intergenic
1186602702 X:11055557-11055579 AATGACAAGGTACCATAAAAGGG + Intergenic
1187021975 X:15393145-15393167 AAAGACATGGTGCCAAAAGATGG - Intronic
1187703039 X:21982348-21982370 AAAAAAAAAGTACCACAAGACGG + Intronic
1188118867 X:26280203-26280225 CAAAACAAGATGCTATAAAAAGG - Intergenic
1189456930 X:41199847-41199869 ATAAATAAGGTGCACCAAAATGG - Intronic
1190226761 X:48552092-48552114 TAAAACTAGGTGACACAAAAAGG - Intronic
1191650127 X:63528544-63528566 GAAAAGAAGGCGGCACAAAATGG + Intergenic
1192150740 X:68710820-68710842 AAAAGGGAGGTGCCAGAAAATGG - Intronic
1192375554 X:70557594-70557616 ATAAACAAGATGTAACAAAATGG + Intronic
1192981707 X:76351107-76351129 AAAGAAAAGGTGCCACATCAAGG + Intergenic
1193611216 X:83633474-83633496 GAAAACAAAGTGTAACAAAATGG - Intergenic
1193684713 X:84563134-84563156 CAAGAGAAGGTGCCCCAAAAAGG - Intergenic
1193758136 X:85433936-85433958 TGTAACAAAGTGCCACAAAATGG - Intergenic
1194875434 X:99181563-99181585 AAAAGCAAGCTGCTACAAACAGG + Intergenic
1195056173 X:101147139-101147161 AAAAAAAAGGTGCAGCAGAAAGG - Intronic
1195089638 X:101446403-101446425 TAAAACAAGGGGGCATAAAATGG + Intronic
1195105059 X:101595701-101595723 AAAAACAAATTCCAACAAAATGG + Intergenic
1195329831 X:103787823-103787845 AAACACCAGGAGCCACACAACGG - Exonic
1196038034 X:111168367-111168389 AAAAACACTGTGACACAATAGGG - Intronic
1196091644 X:111750451-111750473 TAAAGCAAAGTGCAACAAAATGG - Intronic
1196261075 X:113582148-113582170 AAAAACAAAAAGCCACAAAATGG + Intergenic
1197840979 X:130746400-130746422 AAAAGCAAGGTCCCAAAATAAGG - Intronic
1198698533 X:139370335-139370357 GAAAATCAAGTGCCACAAAAGGG + Intergenic
1200131728 X:153852419-153852441 AAAAACAAGGTGAGAAAGAATGG - Intergenic
1200399586 X:156011242-156011264 CGTAACAAAGTGCCACAAAATGG + Intergenic