ID: 1115287852

View in Genome Browser
Species Human (GRCh38)
Location 14:31736726-31736748
Sequence GACTGCTGGATTTTAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115287852 Original CRISPR GACTGCTGGATTTTAGCTTA GGG Intronic
904870405 1:33614247-33614269 CATTCCTGGATTTTAGTTTATGG + Intronic
905556958 1:38893905-38893927 CATTGTTGGATTTTAGCTTTGGG + Intronic
910045328 1:82906845-82906867 TATTTTTGGATTTTAGCTTAGGG - Intergenic
914772494 1:150701737-150701759 CACTGCTTTATTTTAGCTTTTGG - Intronic
915253722 1:154609284-154609306 AACTGCTGGATTTTTGTTCAAGG + Intronic
915547496 1:156609590-156609612 GCCTTCTGGATTTTAGTTTAAGG + Intergenic
919093986 1:193008103-193008125 GACTACTGGATTTGGACTTAGGG - Intergenic
919180083 1:194069502-194069524 GACTGCTGGGTGTTAGATTTAGG + Intergenic
1064140110 10:12783301-12783323 GACTGTTGGCTTTTATCTTCTGG + Intronic
1064273755 10:13888185-13888207 GCGTGCTGGATTTTATCTTGAGG - Intronic
1069179241 10:65335544-65335566 TAGTGCTGGATTTTAGCTTGAGG + Intergenic
1070554983 10:77520639-77520661 GGCTGCTGGATATTGGCTGATGG - Intronic
1071356469 10:84801385-84801407 GACTGCTTTACTTTAGCTAATGG - Intergenic
1078622776 11:12924136-12924158 GAGTGCTGCATTCTAGCTTCTGG - Intronic
1079253425 11:18805367-18805389 GACTTCTGGAATTTTGGTTAAGG + Intergenic
1082905142 11:58299797-58299819 GAAGGCTGGATTTTAACTTTAGG + Intergenic
1084467519 11:69334791-69334813 GACTCCTTGATTTTAGCCCAGGG - Intronic
1091786054 12:3244045-3244067 GACTGCTGGGTGTAAGCTTTAGG + Intronic
1091949051 12:4576539-4576561 GATTGCTGGATTGTATGTTAAGG + Intronic
1092806920 12:12232562-12232584 ACCTGCTGGATTCTTGCTTAAGG - Intronic
1095989914 12:48027488-48027510 GACTGCTGGACTGTAGCCTGGGG - Intergenic
1097600597 12:61687767-61687789 GACTCGTGGAATTAAGCTTAGGG - Intergenic
1100140470 12:91612622-91612644 GTCTGATGGATTATAGCCTAGGG - Intergenic
1105627222 13:22124515-22124537 GGCTGCTGAATTTTAGGTTTCGG - Intergenic
1106166660 13:27252876-27252898 GACTGCTGTATTTTACCTTATGG + Intronic
1107410215 13:40151367-40151389 GACACCTGGATTTTAGTCTAGGG - Intergenic
1109465212 13:62722866-62722888 GAATGCTAGATTTTAGATTGTGG - Intergenic
1109993604 13:70091728-70091750 GACTGCTGGATTTGAAATAATGG + Intronic
1114287557 14:21259587-21259609 GATTGCTGGTTTCTAGCTTCTGG - Intronic
1115287852 14:31736726-31736748 GACTGCTGGATTTTAGCTTAGGG + Intronic
1116284051 14:42949475-42949497 GAATGTTGGATTTTAGCAAAAGG - Intergenic
1116940798 14:50789024-50789046 GACTTCTGGATCCCAGCTTAGGG - Intronic
1118843959 14:69532544-69532566 GACTGCTGGACTTTATCTGAGGG - Intergenic
1124795734 15:32776328-32776350 GACTGCTGGTTTCCAGCATAGGG + Intronic
1126135772 15:45389658-45389680 GACTTCTTGTTTTTAACTTAAGG + Intronic
1127112757 15:55692096-55692118 GACTACTAAATTTTAGCTTGAGG - Intronic
1134439013 16:14286334-14286356 AGCTGCTGGAGTTTGGCTTAAGG + Intergenic
1137563465 16:49517996-49518018 TAATGATGGATTTTAGCTTACGG - Intronic
1137594191 16:49713165-49713187 GACTGTGGGCTTTTAGCTTTTGG - Intronic
1137744582 16:50811296-50811318 AATTGGTGGATTTTAGCTTTAGG + Intergenic
1138430604 16:56966160-56966182 GACAGCTTGATCTTAGCTCAGGG - Intronic
1138618649 16:58194158-58194180 GCCTGCTGTATTTTAGCTGCAGG - Intronic
1140782790 16:78311905-78311927 GACACCTGGATTTTAGCCCAGGG - Intronic
1153021227 18:630884-630906 GACATCTTGATTTTAGCCTAGGG + Intronic
1155563995 18:27112547-27112569 GATTTCAGGATTTTAGATTAGGG + Intronic
1155655774 18:28191134-28191156 GACTGTTGAATTTTATCTGATGG + Intergenic
1156154898 18:34289655-34289677 GACTTTTGTATTTTAGCCTATGG - Intergenic
1159055656 18:63460962-63460984 AACTGCTGGATTTTATGCTAAGG + Intergenic
1160053730 18:75460307-75460329 TACAGCTGGATCTTAGCTCAGGG + Intergenic
1161822355 19:6537684-6537706 GTCAACTTGATTTTAGCTTAGGG - Intergenic
1167148936 19:47698106-47698128 GGCTGCTGGTTTTTAGCCGAGGG + Intronic
926835882 2:17019398-17019420 GATTGCTGGATTTTATGGTAAGG + Intergenic
927632134 2:24783764-24783786 TAAGGCTGGATTTTAGCTGAAGG - Intergenic
928416414 2:31095938-31095960 GACACCTTGATTTTAGCTCAGGG - Intronic
929258163 2:39836895-39836917 GACTGGTGTTTTTGAGCTTAAGG + Intergenic
935922125 2:108027468-108027490 GACAGCTGTATTTAATCTTAAGG - Intergenic
936580642 2:113697431-113697453 AACAGCAGGATTTTAGTTTATGG - Intergenic
937470633 2:122171147-122171169 GACACCTTGATTTTAGCTCAGGG + Intergenic
938767974 2:134474936-134474958 GCCTGCTGGGATTTGGCTTAGGG - Intronic
940533725 2:154911484-154911506 AACTGCTGGATTTTTGCACAGGG - Intergenic
940706843 2:157116285-157116307 GAATGTTGGATTTTGTCTTAAGG - Intergenic
943263218 2:185693059-185693081 GACAACTTGATTTTAGCTTTGGG + Intergenic
943654095 2:190488916-190488938 GAATACTGGAATTTAGCTTTGGG - Intronic
947895647 2:233669355-233669377 GCCTGCTGGAATTTAGATTGGGG + Intronic
947991648 2:234492840-234492862 GACTCCTGCATTTTAGCATCCGG + Intergenic
1171824402 20:29881048-29881070 CACTGATGTATTTTAACTTAAGG + Intergenic
1173594322 20:44248722-44248744 GACTGCTGGATTCTACCCCAAGG + Intronic
1174372504 20:50101964-50101986 TACTACTGGACTTTACCTTAAGG + Intronic
1177429525 21:20973798-20973820 TACAGCTGTATTTTAGCTCAAGG - Intergenic
1179333700 21:40430098-40430120 GAGTGCTGGATTTTAGCAAGAGG - Intronic
951447205 3:22796606-22796628 GTCTGCTGGATTTTACCATGAGG + Intergenic
953426585 3:42799879-42799901 GAGTGATGTATTTTAGCTAAAGG + Intronic
954526972 3:51280356-51280378 CACTGCTGGCTTTCAGCTTCTGG - Intronic
960674936 3:120184624-120184646 GACAGCTGGTTTTCAGCTTAGGG - Intronic
964460552 3:156921149-156921171 GAACGCTGGATTTTATCTTTAGG - Intronic
964899310 3:161638666-161638688 GAGATCTGGATTTTATCTTAAGG + Intergenic
966988841 3:185207685-185207707 GACACCTGGATTTTAGCCCAGGG + Intronic
970268867 4:14321329-14321351 GACTCCTTGATTTTAGCCCAGGG - Intergenic
970774084 4:19652117-19652139 GACATCTTGATTTAAGCTTAGGG - Intergenic
974981286 4:68960465-68960487 GAGTGCTGGGTTTTGCCTTAAGG + Intergenic
976864889 4:89712727-89712749 GAGAGCTGTATTTTAGCTTCAGG - Intergenic
979077091 4:116285371-116285393 AACTTGTGGATTTTAACTTATGG + Intergenic
980461780 4:133124914-133124936 GACAGCTGGGGATTAGCTTAAGG + Intergenic
985312979 4:188623341-188623363 TTCTGCTGGATTTTATTTTATGG + Intergenic
990334852 5:54762579-54762601 GACACCTTGATTTTAGCTGAGGG - Intergenic
995712684 5:115051052-115051074 GACTTTTGGATTTTTGTTTAGGG - Intergenic
997717811 5:136055186-136055208 GAGGGCTGTATTTTAGTTTAGGG - Intronic
1002859015 6:1063478-1063500 TACTGCTGGACTTTTGCTCAAGG + Intergenic
1004971530 6:20916011-20916033 GACTGCTGGAGTTTAGAGTTGGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007260838 6:40561935-40561957 GACTGATGGTTTTCTGCTTAGGG - Intronic
1007482539 6:42159536-42159558 GACTGCTGGATTTGGGCTCTGGG - Intronic
1010472453 6:76244695-76244717 GCCTCCTGGATTTCATCTTAAGG + Intergenic
1013066351 6:106687763-106687785 GACTGGTAGATTTTACTTTAGGG + Intergenic
1013297470 6:108770758-108770780 GACTCCAGGCTTTTAGCTTGTGG + Intergenic
1015291819 6:131546216-131546238 GACTGCTGGAAATGAGCTTTTGG + Intergenic
1022075311 7:26963032-26963054 GATTGCTGGATCATAGATTATGG - Intronic
1025279679 7:57618091-57618113 GTCTATTGGAATTTAGCTTATGG - Intergenic
1025305052 7:57847410-57847432 GTCTATTGGAATTTAGCTTATGG + Intergenic
1026586121 7:71657583-71657605 GACAGCTGGATAGTAGCTTCAGG - Intronic
1031691360 7:124791789-124791811 GACTGCTGTATTTGAGATTCTGG - Intergenic
1032199845 7:129812134-129812156 GACTGCTTGACTGTTGCTTAGGG + Intergenic
1037703688 8:21297447-21297469 GACATCTTGATTTTAGCTTTTGG - Intergenic
1041921455 8:63186900-63186922 GGCTGCTGGATTATAGTTTGAGG - Exonic
1044110673 8:88269000-88269022 GATTGCTGCTTTTTACCTTAGGG - Intronic
1044677075 8:94740160-94740182 GATGCCTTGATTTTAGCTTAGGG + Intronic
1045657451 8:104401654-104401676 GACTGGTCAATTTTGGCTTAAGG - Intronic
1049296921 8:141845773-141845795 GCCTGCTGGTTTTTATTTTATGG - Intergenic
1051905336 9:22088500-22088522 GAATGCTGGTTCTTAGCCTAGGG - Intergenic
1052265353 9:26565603-26565625 CAATGCAGGATTTTAGCTAATGG + Intergenic
1053625710 9:39868256-39868278 GCCTGCTGGATTTTGGATTTGGG + Intergenic
1053893507 9:42719386-42719408 GACTGCTGGATTTTGGATTTGGG + Intergenic
1054218178 9:62382445-62382467 GCCTGCTGGATTTTGGATTTGGG - Intergenic
1055430224 9:76236127-76236149 GATTGATGGAATTTAGCTTTGGG - Intronic
1058505783 9:105664616-105664638 AACTGATGGATTTGAGATTAGGG + Intergenic
1061338682 9:129961368-129961390 GACTTGTGGATCTGAGCTTAGGG + Intronic
1203377471 Un_KI270442v1:387488-387510 CACTGATGTATTTTAACTTAAGG + Intergenic
1185926549 X:4153416-4153438 GACACCTTGATTTTAGCTTAGGG + Intergenic
1193602323 X:83522865-83522887 GACTGCTAGATGTTAGCTGCAGG + Intergenic
1197362595 X:125524675-125524697 GACTGCTGGAACTAAGATTAAGG - Intergenic
1197910200 X:131474369-131474391 TACTGCAGAATTTTAGCTTTTGG - Intergenic