ID: 1115296260

View in Genome Browser
Species Human (GRCh38)
Location 14:31830753-31830775
Sequence CAGGCAGGATACTTTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115296260 Original CRISPR CAGGCAGGATACTTTGATCT GGG Intronic
900500434 1:3001848-3001870 CAGGCAGAATGCATGGATCTGGG - Intergenic
901536955 1:9888787-9888809 CAGGCGGGCTACTCTGATCTCGG - Intronic
902545569 1:17187529-17187551 CAGGCAGGAGGTTGTGATCTGGG - Intergenic
904120771 1:28196308-28196330 GAGGCAGGATAGTTTGAGCCCGG + Intergenic
906699861 1:47850010-47850032 AAGGCAGGGGAATTTGATCTGGG - Intronic
908390088 1:63676314-63676336 AAAGCAGGATACTGTGTTCTTGG - Intergenic
912215131 1:107601203-107601225 CAGGGAGGATGCCTGGATCTTGG + Intronic
912262058 1:108120399-108120421 CAGGCAGGATAGGTACATCTGGG - Intergenic
916891024 1:169112567-169112589 CAGGCAGTAGCCCTTGATCTAGG - Intronic
919613826 1:199779778-199779800 CAGGCTGGATTGTGTGATCTCGG - Intergenic
921210011 1:212886917-212886939 GAGGCAGCATATTTTGCTCTGGG + Intronic
924085412 1:240446501-240446523 CAGGAAGTATATTTTGATCCAGG - Intronic
924402323 1:243699112-243699134 CAGGGAGTGTACTTTGTTCTGGG - Intronic
1063151869 10:3344425-3344447 CAGGCAGGAAACTTTCATGCTGG + Intergenic
1063858326 10:10280453-10280475 CAGGCAGAATATTTTCTTCTTGG - Intergenic
1065179145 10:23107387-23107409 CAGGCAGAATACCTTGGTCAAGG - Intronic
1069295590 10:66840182-66840204 CAGTCAGTCTACTCTGATCTGGG - Intronic
1069951416 10:72021048-72021070 CAGGCTGGGTACTTTGCCCTAGG - Intergenic
1071372994 10:84972463-84972485 CAGGCAGGTCTCTTTGAGCTGGG - Intergenic
1071450671 10:85789535-85789557 TAGGAAGCATACTTGGATCTGGG - Intronic
1072657055 10:97337128-97337150 CAGGAATGAGACTTGGATCTAGG - Intergenic
1073036875 10:100570082-100570104 CAGCCGGGACACTTTCATCTCGG - Intergenic
1073595527 10:104795882-104795904 CAACCAAGATTCTTTGATCTTGG + Intronic
1074279053 10:112033780-112033802 CAGGTAGGAAACTATGATCCAGG - Intergenic
1075084481 10:119405313-119405335 CAGGCAGGATATTGTTCTCTGGG + Intronic
1076835824 10:133020585-133020607 CAGGCGGGATCCCTGGATCTTGG - Intergenic
1077532422 11:3103464-3103486 CAAGCAGGATAATTTTCTCTGGG + Intronic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1087048084 11:93860986-93861008 AAGGCAGGATAATTTGAAGTGGG - Intergenic
1089232423 11:116991143-116991165 AAGGCAGGTTACTTTTATATTGG - Intronic
1092439831 12:8490560-8490582 CAGGCAGGTCACTTGAATCTAGG + Intergenic
1098404072 12:70105377-70105399 TATGCAGGATACTTTGAGGTGGG + Intergenic
1098773657 12:74586238-74586260 CATTCAGGATACTTTGGTCTTGG - Intergenic
1099114904 12:78611876-78611898 CAGCCAAGCTACTTTGATTTTGG - Intergenic
1099465280 12:82978215-82978237 GAGGCAGGATATTTTAAACTAGG + Intronic
1099674479 12:85741522-85741544 CAGGTAGAATACTTTGCTCTTGG + Intergenic
1100138481 12:91585932-91585954 CGGGCAGGATGTTTTGATGTTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102464764 12:113122173-113122195 CAGGCAGTATAGTTAGTTCTAGG + Intronic
1103298251 12:119906638-119906660 AAGGCAGGATACCTTGAAGTGGG - Intergenic
1105567771 13:21568064-21568086 CAGGAAGGATACTGTGGTCCAGG - Intronic
1105982218 13:25529496-25529518 AAGGAAGGATACTTTGGTCATGG + Intronic
1106752767 13:32791928-32791950 CAGTCAGGGTCCTTTCATCTGGG - Intergenic
1108734867 13:53272358-53272380 CAGGAAGGATATTTTGCTTTGGG + Intergenic
1109463924 13:62701976-62701998 CAGGCTGGATGGTGTGATCTCGG - Intergenic
1114385878 14:22253889-22253911 CAGGCAGGATAATCTTATCAAGG + Intergenic
1115296260 14:31830753-31830775 CAGGCAGGATACTTTGATCTGGG + Intronic
1116456464 14:45125990-45126012 CAGGGAGGATCCTTTGAGCCTGG - Intronic
1118003505 14:61544823-61544845 CAGGGAGGACCCTGTGATCTTGG + Intronic
1126201900 15:45995888-45995910 AAGGCAGGATACTTTGAAGCAGG + Intergenic
1127282394 15:57503357-57503379 CTGGCAGGGTACTCTGACCTTGG - Intronic
1127726899 15:61759220-61759242 CAGAAAGGATACTTTGTGCTGGG - Intergenic
1130420352 15:83739858-83739880 CAGGCAGGATGCTGTGTTCCAGG - Intronic
1133342834 16:5048119-5048141 CAGGAAGGATTCTGTGAGCTTGG - Intronic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1135845335 16:25913430-25913452 CAGGGAGTCTACCTTGATCTTGG + Intronic
1136369369 16:29826333-29826355 CAGCCAGGATGCCTGGATCTTGG - Intronic
1136427276 16:30177380-30177402 CAGGCAGGGTGCTTTGTGCTGGG - Intergenic
1139972440 16:70784527-70784549 CAGGCAAGCTTCTTTGCTCTAGG + Intronic
1142519057 17:492342-492364 CAGAGAGGATTCTTGGATCTTGG + Intergenic
1145763130 17:27439038-27439060 CAGGCAGATCACTTTCATCTAGG + Intergenic
1145967877 17:28933446-28933468 GAGCCAGGAAACTTTGATTTGGG - Intronic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1148117722 17:45186983-45187005 CAGACAGGACCCCTTGATCTTGG + Intergenic
1148173811 17:45547299-45547321 CAGGCAGAATAACTTGCTCTGGG + Intergenic
1148275457 17:46298148-46298170 CAGGCAGAATAACTTGCTCTGGG - Intronic
1148297563 17:46515727-46515749 CAGGCAGAATAACTTGCTCTGGG - Intronic
1148362115 17:47020206-47020228 CAGGCAGAATAACTTGCTCTGGG - Intronic
1150405023 17:64894221-64894243 CAGGCAGAATAACTTGCTCTGGG + Intronic
1151333359 17:73424217-73424239 CAGGCAGGACACTGGGATCGGGG + Intronic
1152047660 17:77948612-77948634 CAGGCAGGATGGTGTGATATGGG - Intergenic
1152778138 17:82214561-82214583 AAGGGAGGATCCTTTGAGCTCGG + Intergenic
1156419153 18:36932314-36932336 GAGGCAGGATTCTTTGAGCCAGG - Intronic
1164707328 19:30329785-30329807 CTGACAGGATAGTTTGCTCTGGG + Intronic
928129849 2:28641639-28641661 CAGGCAGTATACTAGGATCTGGG + Intronic
928963367 2:36952810-36952832 CAGGGAGGAGCCTGTGATCTGGG - Intronic
929537816 2:42794615-42794637 CAGGCCAGATCCTTTGAGCTTGG - Intergenic
929545066 2:42850409-42850431 CAGGCAGGCTAATTTGAACCTGG + Intergenic
931061598 2:58535464-58535486 CAGGCACTTTACTTTGTTCTGGG - Intergenic
931980532 2:67689272-67689294 CAGGCAGGATGCTTCAATTTGGG - Intergenic
933212007 2:79581071-79581093 CAGCCATGATACATTCATCTTGG - Intronic
933547142 2:83729154-83729176 AAGGCAGGATTCTTTGGTCATGG - Intergenic
935089222 2:99878231-99878253 CAGGCAGGTCAATTTGACCTTGG + Intronic
939905882 2:147914121-147914143 CAGAGAGGATGCATTGATCTGGG + Intronic
940027180 2:149220491-149220513 CAGGTAGGAGCCTATGATCTTGG - Intergenic
941749719 2:169121342-169121364 CAGGCAGTATGCATTGATGTTGG - Intergenic
941997691 2:171616338-171616360 CTGGAGGGATACTTTGAACTAGG + Intergenic
944118471 2:196213998-196214020 CAGGCAGGATATTTGCATATTGG - Intronic
947738494 2:232473414-232473436 CAGGCTGCATTCTTTGATCCTGG + Intergenic
948683336 2:239652749-239652771 GAGGCAGGATAGCTTGAGCTCGG - Intergenic
1170484770 20:16805274-16805296 CAGGCAGGATGCTAAGACCTAGG - Intergenic
1173259552 20:41421534-41421556 CAGGCAGCAGACTTTCATCATGG + Exonic
1174248167 20:49197754-49197776 CAGTCTGGATAGCTTGATCTTGG + Intergenic
1176067605 20:63206669-63206691 CAGGCTGGATACAGTGACCTGGG + Intronic
1178753714 21:35327774-35327796 CAGTCAAGATATTTTGATCCTGG + Intronic
1182193323 22:28487758-28487780 CAGGGAGGATATTTTGATATTGG - Intronic
950155352 3:10717774-10717796 CAGTCAGGACAGTGTGATCTCGG - Intergenic
950802603 3:15566560-15566582 GAGGCAGGATCCGTTGAACTTGG + Intronic
952152744 3:30610139-30610161 CAGGCAGGATGCTCAGACCTGGG + Intronic
957430131 3:80094013-80094035 CAGTTAGGATACTATTATCTAGG + Intergenic
960465544 3:117993193-117993215 GTGGCAGGATCCTTTGAGCTAGG + Intergenic
962223198 3:133581610-133581632 CAGCCAGGAAACTTTGAACATGG - Intronic
963081129 3:141394593-141394615 CAGGCATGCTAGTTTGCTCTGGG + Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
967219647 3:187237732-187237754 CAGGCAGGGTGCTTGGGTCTTGG + Intronic
972168042 4:36311233-36311255 CAGGCAGGATACCCAGATCCTGG + Intronic
972191012 4:36590711-36590733 CAGACAGGATACTTAGCACTGGG - Intergenic
974103863 4:57445655-57445677 CAGGCAGGAGGCTTGGATCCTGG + Intergenic
974213304 4:58811153-58811175 CAGGCAGGACACTTGGCTGTAGG + Intergenic
975106980 4:70578793-70578815 CAGGCTGTCTACTTTGCTCTGGG - Intergenic
975888680 4:78997571-78997593 GAGCCAGGATACTTTTATTTAGG + Intergenic
977676636 4:99755429-99755451 CAGGCAGGAGAGCTTTATCTGGG + Intergenic
978134669 4:105243007-105243029 CTGGCATGAGTCTTTGATCTGGG - Intronic
979791371 4:124785421-124785443 CAGTCAGTAAATTTTGATCTTGG - Intergenic
982834996 4:160112431-160112453 GAGGCAGGAGACTCTGAACTCGG + Intergenic
983686497 4:170415594-170415616 CAGGCAGGATTCCTTGATGCAGG + Intergenic
987283234 5:16431358-16431380 CAGAAATGATATTTTGATCTTGG - Intergenic
987771176 5:22307507-22307529 CAGGCATGATACTGTGTGCTTGG - Intronic
987804986 5:22752868-22752890 CCGGCAGGATACTTCTTTCTTGG + Intronic
988463280 5:31461980-31462002 CATCCAGGATAATTTGATTTTGG + Intronic
988899713 5:35718827-35718849 TAGGCAGGAAAATTGGATCTAGG - Intronic
993891055 5:93474342-93474364 TAGGCAGTATACTTGGTTCTGGG - Intergenic
999236978 5:150104340-150104362 CAAGCAGCATCCTTTGATCGTGG - Intronic
1002081510 5:176740336-176740358 CAGGCAGGATGCATGGACCTTGG + Intergenic
1002902310 6:1419424-1419446 CAGGAAGGATCCTTTGAGCCAGG + Intergenic
1004180505 6:13376905-13376927 AAGGCAAGATACTTTAAACTAGG + Intronic
1005174043 6:23023827-23023849 AAGTCAGGAGGCTTTGATCTTGG + Intergenic
1005198493 6:23316332-23316354 CAGGCAGGAAATTTGGATCTGGG + Intergenic
1008369422 6:50715547-50715569 CTGGCAGGAGTCTTTGATCTGGG - Exonic
1008671457 6:53773305-53773327 TAGGCAGGACATTTTGCTCTGGG - Intergenic
1010997858 6:82553995-82554017 CTGGCAGGATACTTTGAGTCTGG - Intergenic
1012651746 6:101762462-101762484 CAGGCAGGATTATTTGAACCAGG - Intronic
1015774367 6:136798697-136798719 CAGGTAGGATAATTTGAAGTGGG - Intergenic
1018297399 6:162363804-162363826 CGGGCAGGACCTTTTGATCTTGG - Intronic
1018653044 6:166007186-166007208 CAGGCAGGACAATTTCATCAGGG - Intergenic
1018817168 6:167342319-167342341 ATGACAGCATACTTTGATCTGGG - Intronic
1019219742 6:170464122-170464144 CAGGCAGGCTGCTTTGGCCTGGG - Intergenic
1020131398 7:5560697-5560719 CAGCCAGGAAACTTTGATTAAGG + Intronic
1020510588 7:9051671-9051693 CAGGCTGGCTACTATGGTCTGGG + Intergenic
1024884162 7:54123213-54123235 CAGCCAGGATTCTTGGGTCTAGG - Intergenic
1027906400 7:84188595-84188617 CAGGCAGGCTACTTCATTCTTGG + Intronic
1029259314 7:99291099-99291121 CATGCAGGTTACCTGGATCTTGG + Intergenic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1032474293 7:132201900-132201922 CAGGCAAGGTACCTTGCTCTGGG - Intronic
1033991708 7:147295887-147295909 CAGCAAGGATCCTTTAATCTGGG + Intronic
1034403456 7:150883738-150883760 CTTGCAGGATAATTTGATGTTGG - Intergenic
1035969645 8:4233603-4233625 CAACCAGGACACCTTGATCTTGG + Intronic
1038927326 8:32154844-32154866 CAGCAAGGATACTTGGATGTTGG + Intronic
1039434220 8:37548484-37548506 CATGCTGGATCCTTTGATCAGGG - Intergenic
1041828621 8:62126937-62126959 AAGGCACGATTTTTTGATCTTGG - Intergenic
1042103864 8:65302970-65302992 AAGGCAAGTTGCTTTGATCTTGG - Intergenic
1043838280 8:85069246-85069268 AAGGCAGAATACTTTGACCTAGG + Intergenic
1045877336 8:106997357-106997379 CAGTCATGTTACTTTGATCTTGG + Intergenic
1048996033 8:139794215-139794237 CAGGCAGGATTCTTGGTGCTGGG - Intronic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049279523 8:141737220-141737242 GAGGCAGGATGCTTGGTTCTGGG + Intergenic
1049371132 8:142267973-142267995 CAGGAAGGAGACTGTGGTCTTGG - Intronic
1051745569 9:20291894-20291916 AAGGCAGGATGCTATGCTCTGGG + Intergenic
1052645612 9:31230126-31230148 CAGGCAGGCTTCCTTGAGCTGGG + Intergenic
1059000459 9:110343095-110343117 GAGGGAGGATTGTTTGATCTTGG + Intergenic
1059215332 9:112556295-112556317 CAGGCAGCAGACTTTGCCCTGGG - Intronic
1187478640 X:19634666-19634688 AAGGCAGGATACTTGGGACTAGG + Intronic
1187574049 X:20535041-20535063 CTGGCAGGATTCTTTGCCCTGGG - Intergenic
1194176836 X:90661439-90661461 TAGGTAGGGTACTTTGCTCTGGG + Intergenic
1194498536 X:94650408-94650430 CTGGCAGGATACTTTTATTGTGG + Intergenic
1196327747 X:114428265-114428287 CAGGCAGAACATTTTGATATGGG + Intergenic
1198229017 X:134672054-134672076 CAGGCAGTGTACTTTGTACTGGG - Intronic
1198712828 X:139524062-139524084 CAGGCAGGCCTCCTTGATCTGGG - Intergenic
1199055319 X:143287223-143287245 CAGTCAGGATATTTTTCTCTGGG - Intergenic
1200523459 Y:4242290-4242312 TAGGTAGGGTACTTTGCTCTGGG + Intergenic
1201643786 Y:16205291-16205313 AAGGCAGGATATTTTGAAGTGGG - Intergenic
1201659029 Y:16380030-16380052 AAGGCAGGATATTTTGAAGTGGG + Intergenic