ID: 1115298689

View in Genome Browser
Species Human (GRCh38)
Location 14:31859226-31859248
Sequence ACCTTTGGAAATCAGCAATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115298681_1115298689 20 Left 1115298681 14:31859183-31859205 CCCCAAGTGTCCTGGAAATTTGC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 197
1115298682_1115298689 19 Left 1115298682 14:31859184-31859206 CCCAAGTGTCCTGGAAATTTGCC 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 197
1115298685_1115298689 10 Left 1115298685 14:31859193-31859215 CCTGGAAATTTGCCTGGTACTGA 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 197
1115298683_1115298689 18 Left 1115298683 14:31859185-31859207 CCAAGTGTCCTGGAAATTTGCCT 0: 1
1: 0
2: 2
3: 22
4: 206
Right 1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 197
1115298687_1115298689 -2 Left 1115298687 14:31859205-31859227 CCTGGTACTGACATTAAGAGGAC 0: 1
1: 0
2: 2
3: 4
4: 80
Right 1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115298689 Original CRISPR ACCTTTGGAAATCAGCAATG TGG Exonic
900501409 1:3006792-3006814 AACTTTGGAACTGAGTAATGGGG + Intergenic
904965286 1:34367848-34367870 ACCTCTGAAGATCAGAAATGAGG + Intergenic
910091465 1:83469505-83469527 AGATTTGGAAATCAGAAGTGAGG - Intergenic
910208227 1:84768743-84768765 ATCTTTGCAAATGAGCCATGGGG + Intergenic
911209522 1:95124768-95124790 AACTTTTGAAATCAGAAATGAGG + Intronic
911296753 1:96126828-96126850 ACCTATCAAAATCATCAATGAGG - Intergenic
912199747 1:107443284-107443306 ACTTTTGGAAACCAGAAGTGAGG - Intronic
914229846 1:145755659-145755681 ATCTTTGGAACCCAGCAGTGGGG + Intronic
918975937 1:191486456-191486478 AACTTTGCATATCAGCAATAAGG + Intergenic
919474291 1:198015824-198015846 CCTTTTGGAAATAAGCAATGTGG - Intergenic
919966813 1:202535279-202535301 AGCATTGGAAATCATCACTGGGG + Intronic
920021006 1:202956820-202956842 TACTTTATAAATCAGCAATGGGG + Intronic
920830763 1:209463650-209463672 ACCTTAGGCAATCTGCAATCTGG - Intergenic
922727661 1:227930718-227930740 ACCTTTAAAAATCATAAATGAGG + Intronic
924170392 1:241333303-241333325 ACATGTGGAAATCTGCCATGGGG + Intronic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
1063884348 10:10562606-10562628 TCCCTTGGAAAACAGGAATGAGG + Intergenic
1064816574 10:19271899-19271921 ACCTTGAGAGATGAGCAATGAGG + Intronic
1065182184 10:23137376-23137398 AGCTTTTGAAATCAGCAAAAAGG + Intergenic
1065800676 10:29348993-29349015 ACCTTGTGAAATCAATAATGTGG - Intergenic
1068830422 10:61487965-61487987 ACCTTTGGAAAAAAGGAATCAGG - Intergenic
1070320921 10:75353932-75353954 AGCTTGGGAAATCGGCAAGGAGG + Intergenic
1070472327 10:76794811-76794833 AAATTTGGAAATAAGCAATCAGG - Intergenic
1070796941 10:79222393-79222415 ACCGTTGGAAACCAGCCCTGTGG + Intronic
1070810710 10:79296474-79296496 AACTATGGAAACCAGCAATATGG + Exonic
1071548583 10:86548093-86548115 ACCTTTGGAACTCGACAGTGGGG + Intergenic
1073679472 10:105686774-105686796 AGCTTTTGAAATCAGCAAAAAGG + Intergenic
1075928947 10:126277729-126277751 AGCTTTGGAAACAAGAAATGAGG - Intronic
1076909980 10:133382444-133382466 ATCTCTGGGAAACAGCAATGGGG - Intronic
1081333564 11:41834852-41834874 AGCTCTGCTAATCAGCAATGTGG + Intergenic
1081763912 11:45595937-45595959 AGCTTAGGAAATCAGGAAGGAGG + Intergenic
1089828948 11:121307625-121307647 TCATTTGGAAATCAGCATCGTGG + Exonic
1091057983 11:132436675-132436697 ACCACTGGAATTCAGCCATGGGG + Exonic
1092311355 12:7358178-7358200 CACTGTGGAAATCAGTAATGGGG + Intronic
1095252211 12:39992004-39992026 TCCTTTGTAAATCAGCTTTGGGG - Intronic
1095692697 12:45108418-45108440 ATCTTTGGGAATCAGCAAAATGG - Intergenic
1096919187 12:55065809-55065831 TCCTATGGAAATCAGCCATGTGG + Intergenic
1104164340 12:126212953-126212975 ACGATTGGAAACTAGCAATGTGG - Intergenic
1105472795 13:20707057-20707079 AGCTTTGGCAGTCAGCAATCTGG - Intronic
1106873705 13:34049204-34049226 CCCTTTGGAGGACAGCAATGAGG + Intergenic
1110481109 13:75977435-75977457 TCATTTGGAGAGCAGCAATGAGG + Intergenic
1110945327 13:81407454-81407476 AGCTTTGGTAATATGCAATGAGG - Intergenic
1111224895 13:85256450-85256472 ACCTTTGGAACTCCAGAATGAGG - Intergenic
1112464762 13:99634078-99634100 ATTTTTGGATTTCAGCAATGTGG - Intronic
1115298689 14:31859226-31859248 ACCTTTGGAAATCAGCAATGTGG + Exonic
1115447029 14:33502388-33502410 ATCTTTGGCTAACAGCAATGAGG - Intronic
1115666071 14:35549227-35549249 ACCAAAGGAAATCAGCTATGAGG - Exonic
1116105874 14:40504554-40504576 ACCCATGAAAATCAACAATGTGG - Intergenic
1117493494 14:56276423-56276445 ACCTATGGAAAGCAGAAACGTGG - Intronic
1118491943 14:66269522-66269544 ACAATTGGAAATCTGCCATGGGG - Intergenic
1127561055 15:60136298-60136320 ACCTTTCGTCCTCAGCAATGGGG + Intergenic
1132538560 16:496230-496252 AACTTTGGACCTCAGAAATGAGG + Intronic
1139044417 16:63039303-63039325 ACTTTTGGAAATCAGATAGGAGG + Intergenic
1140700751 16:77579457-77579479 TCCTTTGCAAATGAGCAAAGAGG - Intergenic
1143760284 17:9097774-9097796 ATCTTTCTAAATCAGCAGTGTGG + Intronic
1146389062 17:32404410-32404432 ATCTTGGGAAACCAGCAATGAGG + Intergenic
1149979390 17:61297582-61297604 CCCTGTGGAAATAAGCAAAGGGG + Intronic
1150990001 17:70246266-70246288 ACCTTGGGCAATCATGAATGTGG - Intergenic
1152496491 17:80676462-80676484 ACCTCTGGACATCAGCGCTGTGG + Intronic
1153874640 18:9358222-9358244 ATCTTTGGAAAGTAGGAATGGGG + Intronic
1156500262 18:37553058-37553080 AAGTTTGGAAATCTGGAATGAGG - Intronic
1156567475 18:38209897-38209919 AACATTGGAAATCAAGAATGAGG + Intergenic
1158317694 18:56229719-56229741 AACTCTGGAAATCAGAAAAGGGG + Intergenic
1159591496 18:70340035-70340057 GCCTTTGGAACTTAGGAATGGGG - Intronic
1159594900 18:70373368-70373390 ATCTTTGTAAATCACCAATCTGG + Intergenic
1160112819 18:76049442-76049464 ACCACTGGAAATCAGCCATTTGG - Intergenic
1160178685 18:76616206-76616228 CCCTTTGGAAATTAGCAATGAGG - Intergenic
1160305375 18:77729372-77729394 GCCATTGGAAAGGAGCAATGTGG + Intergenic
1167794369 19:51699855-51699877 ATTTGTGGAAATCAGTAATGTGG - Intergenic
1168068260 19:53932756-53932778 TCCATTGGAAAACTGCAATGTGG - Intronic
927897443 2:26792933-26792955 ACCTCTGGAAAAGAACAATGAGG + Intronic
927951627 2:27173887-27173909 ATCATTGAAAAGCAGCAATGAGG - Intergenic
928226242 2:29450553-29450575 AGCTCTGGAAATCAGCACTTGGG + Intronic
928287552 2:30006391-30006413 TGCCTTGGATATCAGCAATGTGG - Intergenic
928509908 2:31993587-31993609 AACTCTGGAAATCTGCAAAGGGG + Intronic
931756690 2:65381131-65381153 AGGTTTGGAAATGAGCAAAGGGG - Intronic
932711876 2:74071809-74071831 AGCTTTGGAAAACAGTGATGTGG - Intronic
936605104 2:113944216-113944238 AGGTTTGGAAATCAGCAGTCTGG + Intronic
938631643 2:133173916-133173938 ACATTTGGAAATCAGGAGAGGGG + Intronic
939389394 2:141546688-141546710 ACTTTTGAAAATGAGCATTGAGG + Intronic
940309660 2:152264550-152264572 AGCATTGAAAATCAGAAATGGGG + Intergenic
940483381 2:154265089-154265111 AATTTTGGAAATCAGAAAGGTGG + Intronic
941349653 2:164416243-164416265 ACATTTGGAAATCATTAATCTGG + Intergenic
942495257 2:176533468-176533490 CCTTTTGGAAAACAGCAAGGTGG + Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943411213 2:187550868-187550890 GCCTTGGGAAATGAGGAATGAGG + Intronic
946639340 2:221766574-221766596 ACTTTTGGATTTCAGCATTGTGG - Intergenic
947993065 2:234502160-234502182 AGCTTTGGAAGTCAGCACTCAGG + Intergenic
948614480 2:239189886-239189908 GCCTCTGGAACTCAGCGATGAGG + Exonic
1169054446 20:2609181-2609203 AGCTTAGGCAATCAGGAATGAGG - Intronic
1172340946 20:34157176-34157198 ACCTCTGGAGTTCAGCAACGTGG + Intergenic
1173507059 20:43595909-43595931 GTCTTTCGAAATCAGCAATTAGG + Intronic
1173945033 20:46943745-46943767 AGCTTTGGAGATGAGCAAGGCGG - Intronic
1174243345 20:49156631-49156653 ACACTTGGAAATCAGCAATGGGG - Intronic
1175303751 20:57961478-57961500 AGCTTTGGAGATCAGCAGGGAGG - Intergenic
1177427942 21:20949506-20949528 TTCTTTGGAAATTAGAAATGAGG - Intergenic
1178256362 21:31055937-31055959 ACCTTTAGAAATGAGCATGGTGG - Intergenic
1184044671 22:41965421-41965443 ACCTTTGGTGAACAGCAGTGAGG - Intergenic
1184573410 22:45341792-45341814 ACCTATGGGAGTCATCAATGGGG - Exonic
951165065 3:19475537-19475559 ACCTTTTGAAATAAACAGTGAGG - Intronic
952778060 3:37065620-37065642 ACCTTGGGAAATCAGCATCTGGG - Intronic
953272246 3:41457202-41457224 AGTCTTGCAAATCAGCAATGAGG + Intronic
955279902 3:57584599-57584621 GCCTTTGGGAATCAGAAATAAGG - Intronic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
956488280 3:69744096-69744118 ACCTTTGTGAATCAGCATTTGGG - Intronic
958635688 3:96742098-96742120 AGCTTTGTAAATCAGCACAGAGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961555179 3:127692312-127692334 ACCTTCATAAATCTGCAATGAGG + Exonic
962455264 3:135559449-135559471 AACTTTAGAAGTCAGAAATGAGG + Intergenic
963608656 3:147437620-147437642 ACCCTTGAAAGTCATCAATGAGG + Intronic
964128774 3:153264604-153264626 ACCTTTGTAAATTAGATATGTGG - Intergenic
966910754 3:184558577-184558599 GCCTTGGGCAATAAGCAATGAGG - Intronic
969999872 4:11354270-11354292 ACTTCTGCACATCAGCAATGTGG + Intergenic
971969683 4:33605447-33605469 AACTTTGGAACTGAGTAATGAGG - Intergenic
972155347 4:36154380-36154402 AACTTTGTAAATTAGCATTGAGG - Intronic
972589858 4:40474724-40474746 ACCTTTGGCAAAAAGCAATCAGG + Intronic
973610929 4:52635469-52635491 ACCATTGGAAATGAGCACTATGG - Intronic
973704021 4:53564123-53564145 ACTTTTGGAAAACAGCAGTGAGG - Intronic
973733623 4:53848232-53848254 ACCCTTGGAAAAAAGCAATGAGG - Intronic
974256799 4:59467572-59467594 AAGTTTAAAAATCAGCAATGTGG + Intergenic
976141579 4:81998778-81998800 TCCTCTGGAAATCAGAAATGAGG + Intronic
977298849 4:95244001-95244023 ACATTTGGAAATCAACACTTGGG + Intronic
977770519 4:100852248-100852270 AACTTTGGAAAGCAATAATGGGG - Intronic
978470365 4:109059957-109059979 AACTTTTGAAATCAGCCATAAGG + Intronic
978671772 4:111256736-111256758 ACCCTTTGAAATCAACAATTGGG - Intergenic
981583902 4:146279114-146279136 ACTTTTGGAAATAAGAAATTTGG + Intronic
981969989 4:150655865-150655887 ACCTTTGGAAAGTAGCTATTTGG - Intronic
982006606 4:151069268-151069290 ACCTTTGGAAATCTGGATAGAGG + Intergenic
982189510 4:152839946-152839968 ACCTCTGGGAAACAGCAAGGTGG - Intronic
985032858 4:185809070-185809092 ACATTTGAAAAACAACAATGAGG - Intronic
986223847 5:5794746-5794768 ACCGTTGGAAATGAGGAAAGAGG + Intergenic
988303492 5:29464837-29464859 ATCTCTTGAAATCAGCAATTTGG + Intergenic
989117035 5:37965091-37965113 ATCTTTGGAAATCAGCACTATGG + Intergenic
990377387 5:55185387-55185409 ACCTTTTGAAGGTAGCAATGGGG - Intergenic
991412004 5:66355025-66355047 ACATCTGGAAAACAGAAATGAGG + Intergenic
991616610 5:68503314-68503336 AGCTTTAGAAAACAGCTATGTGG + Intergenic
992699092 5:79322137-79322159 TCCTTTGGAAATGAGTAATGCGG - Exonic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
993792231 5:92222595-92222617 ACCTCTAGAAAACATCAATGGGG + Intergenic
995156208 5:108916350-108916372 AACTTTGGGAATCAACAATTTGG - Intronic
995411581 5:111863413-111863435 AGATTTGGAAATCAGAAAAGAGG + Intronic
995943470 5:117613115-117613137 TCCTCTGGAAATCAGAACTGGGG + Intergenic
996050676 5:118929459-118929481 ACGTACAGAAATCAGCAATGAGG - Intronic
999360058 5:150976652-150976674 ACTTCTGGATATCATCAATGTGG - Intergenic
999861887 5:155656987-155657009 GCCTTTTGAACTAAGCAATGGGG - Intergenic
1002361762 5:178677691-178677713 ACACTTAGAAATCAGCAGTGAGG - Intergenic
1004126142 6:12875660-12875682 ACATTTGGAAATCACTATTGTGG + Intronic
1006529535 6:34639417-34639439 TCCTTTGGAAATCTGGAAGGCGG + Intronic
1008368068 6:50705832-50705854 ACCTTTGGAAATTAGAAGGGAGG + Intergenic
1010656698 6:78519858-78519880 ACATTTAGAAATGAGCTATGGGG - Intergenic
1010783849 6:79976797-79976819 AGTTGTGGAAAGCAGCAATGTGG - Intergenic
1013936609 6:115603738-115603760 ACCTTTGAGCATCAGCCATGTGG - Intergenic
1013938967 6:115637131-115637153 ACCTATGGAAATGAGAAATGTGG - Intergenic
1014163393 6:118196099-118196121 ACGTATGGAAATCAGAAGTGAGG + Intronic
1014933007 6:127356206-127356228 AGCTTTTGAAATCAGCAAAAAGG + Intergenic
1014997175 6:128162770-128162792 ATACTTGGAAAACAGCAATGTGG + Intronic
1015836123 6:137421832-137421854 ACGTAAGGAAATCAGCAGTGAGG - Intergenic
1016692500 6:146954461-146954483 CCCTTTGCTCATCAGCAATGAGG + Intergenic
1016970907 6:149761845-149761867 AACTTTTGAAATCAACAATAAGG - Intronic
1016980830 6:149852441-149852463 GCCGATGGAAATCAGCCATGTGG - Intronic
1017486021 6:154902510-154902532 TCATTTGGAAATCAGCTAGGAGG + Intronic
1019169606 6:170125404-170125426 ACCTGTGCAAATAAGAAATGAGG + Intergenic
1021566680 7:22023463-22023485 ACTTGAGGAAATCAGAAATGTGG + Intergenic
1022935284 7:35169271-35169293 ACTTCTGGAAAACAGCAATCAGG - Intergenic
1024633091 7:51265203-51265225 ACCCTTGTAAAGCAGCAGTGAGG - Intronic
1027308313 7:76925950-76925972 AGATTTGGAAATCAGAAGTGAGG - Intergenic
1027383510 7:77637027-77637049 ACCTCTGAAAATGAGAAATGTGG + Exonic
1027452689 7:78350992-78351014 ACATTTAGAAATAATCAATGTGG + Intronic
1028831177 7:95327984-95328006 ACCATTTGATATCAGCACTGAGG - Intergenic
1029831237 7:103262047-103262069 ACTTCTGGAAAACAGCAATCAGG - Intergenic
1033217918 7:139507045-139507067 ATTTTTAAAAATCAGCAATGGGG + Intergenic
1037786461 8:21906196-21906218 ACCTTAGGAAATCGGAAACGTGG + Intergenic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1039715285 8:40101870-40101892 AACTCTGGAAATCAGAAGTGAGG + Intergenic
1040414708 8:47186106-47186128 ACCTATGAAAATCAGAGATGAGG - Intergenic
1042641248 8:70937627-70937649 ACCGCTGGAAATCTCCAATGAGG - Intergenic
1043352708 8:79379279-79379301 ACCTTTGGAAATGTGCCATTTGG - Intergenic
1044496667 8:92895393-92895415 GGCTTTGGAAATGTGCAATGGGG + Intronic
1045302407 8:100924242-100924264 AGCTTTTGAAATCAGCAAAAAGG - Exonic
1045449713 8:102310255-102310277 ACTTTTGGAAATGAGGAAGGAGG - Intronic
1046049883 8:109010248-109010270 TCCTTGGAAAATGAGCAATGAGG - Intergenic
1048005906 8:130419216-130419238 CCCAGTTGAAATCAGCAATGAGG - Intronic
1048117649 8:131543559-131543581 AGCCTTGGAAAACAGCAATATGG - Intergenic
1049185057 8:141245988-141246010 CCCTTTGAAAATCAGCAAACTGG - Intronic
1050029602 9:1371695-1371717 ACCTTGGGACATCAGCTCTGTGG + Intergenic
1053046367 9:34922447-34922469 AGCTTTTGAAATCAGCAAAAAGG - Intergenic
1055901090 9:81239089-81239111 ACATATTGAAATCAGCAAAGGGG + Intergenic
1056291655 9:85149620-85149642 ACCATTGAAAATCAACTATGGGG - Intergenic
1057686564 9:97239816-97239838 ACCTTTAGATACCAGCAATAAGG + Intergenic
1059092259 9:111372234-111372256 ACCTTGAGAACTCAGCAATTTGG + Intronic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1062178620 9:135178630-135178652 AGCTTTGGAAATCTGCACAGGGG + Intergenic
1186052747 X:5616743-5616765 ACCTTGGGAAATGAGGTATGGGG + Intergenic
1187014040 X:15308408-15308430 AGAATTGGAAAGCAGCAATGTGG - Intronic
1187067061 X:15851038-15851060 TCCTTGTGAAATCAGGAATGAGG - Intronic
1187385605 X:18845834-18845856 AACTTTGTACATCAGCAATTTGG - Intergenic
1188366058 X:29316358-29316380 ACCTTTGGCAATGAGGAAAGAGG - Intronic
1188735630 X:33711225-33711247 ACTTTTGAAAATCAGCAATCTGG + Intergenic
1189512385 X:41676020-41676042 AGCTTTTGAAATCAGCAAAAAGG - Intronic
1189541147 X:41991210-41991232 CACTATGGAAAACAGCAATGAGG + Intergenic
1190368781 X:49722243-49722265 GCCTTTGGAACACAGCCATGAGG - Intergenic
1192658648 X:73020074-73020096 ACATTTGCAAATCAATAATGTGG - Intergenic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1196196908 X:112846362-112846384 ATGTGTGGAAAACAGCAATGTGG + Intergenic
1196199345 X:112867913-112867935 ACATTTTGAAAAGAGCAATGTGG + Intergenic
1197156614 X:123276938-123276960 AGCTTTTGAAATTTGCAATGTGG - Intronic
1198178487 X:134180769-134180791 GCCTTTCGGAATGAGCAATGTGG + Intergenic
1199084363 X:143611612-143611634 ACCTGTAGAAATCAGTAGTGGGG - Intergenic
1200354438 X:155533512-155533534 AGCTTTGGAAATGGGTAATGGGG + Intronic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202302423 Y:23431033-23431055 AGCATTGGAAATCATCACTGGGG + Intergenic
1202568388 Y:26239561-26239583 AGCATTGGAAATCATCACTGGGG - Intergenic