ID: 1115303804

View in Genome Browser
Species Human (GRCh38)
Location 14:31913915-31913937
Sequence CTGCAATCTCCTACCCGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115303804_1115303814 25 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303814 14:31913963-31913985 ATTGGTCGGGCATGGTTCGGTGG No data
1115303804_1115303807 -8 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303807 14:31913930-31913952 GATTGCAGCAGCTCAGCTTTGGG No data
1115303804_1115303812 17 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303812 14:31913955-31913977 GGTGAGCTATTGGTCGGGCATGG No data
1115303804_1115303809 7 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303809 14:31913945-31913967 GCTTTGGGATGGTGAGCTATTGG No data
1115303804_1115303811 12 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303811 14:31913950-31913972 GGGATGGTGAGCTATTGGTCGGG No data
1115303804_1115303813 22 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303813 14:31913960-31913982 GCTATTGGTCGGGCATGGTTCGG No data
1115303804_1115303806 -9 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303806 14:31913929-31913951 AGATTGCAGCAGCTCAGCTTTGG No data
1115303804_1115303810 11 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303810 14:31913949-31913971 TGGGATGGTGAGCTATTGGTCGG No data
1115303804_1115303808 -4 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303808 14:31913934-31913956 GCAGCAGCTCAGCTTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115303804 Original CRISPR CTGCAATCTCCTACCCGCTA GGG (reversed) Intergenic