ID: 1115303813

View in Genome Browser
Species Human (GRCh38)
Location 14:31913960-31913982
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115303804_1115303813 22 Left 1115303804 14:31913915-31913937 CCCTAGCGGGTAGGAGATTGCAG No data
Right 1115303813 14:31913960-31913982 GCTATTGGTCGGGCATGGTTCGG No data
1115303805_1115303813 21 Left 1115303805 14:31913916-31913938 CCTAGCGGGTAGGAGATTGCAGC No data
Right 1115303813 14:31913960-31913982 GCTATTGGTCGGGCATGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115303813 Original CRISPR GCTATTGGTCGGGCATGGTT CGG Intergenic
No off target data available for this crispr