ID: 1115306747

View in Genome Browser
Species Human (GRCh38)
Location 14:31941576-31941598
Sequence CTGGGATACCATATGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115306747_1115306753 2 Left 1115306747 14:31941576-31941598 CCAGGCACCATATGGTATCCCAG No data
Right 1115306753 14:31941601-31941623 ACCATACTAAGCCCTTTCTATGG No data
1115306747_1115306755 6 Left 1115306747 14:31941576-31941598 CCAGGCACCATATGGTATCCCAG No data
Right 1115306755 14:31941605-31941627 TACTAAGCCCTTTCTATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115306747 Original CRISPR CTGGGATACCATATGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr