ID: 1115306747 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:31941576-31941598 |
| Sequence | CTGGGATACCATATGGTGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115306747_1115306753 | 2 | Left | 1115306747 | 14:31941576-31941598 | CCAGGCACCATATGGTATCCCAG | No data | ||
| Right | 1115306753 | 14:31941601-31941623 | ACCATACTAAGCCCTTTCTATGG | No data | ||||
| 1115306747_1115306755 | 6 | Left | 1115306747 | 14:31941576-31941598 | CCAGGCACCATATGGTATCCCAG | No data | ||
| Right | 1115306755 | 14:31941605-31941627 | TACTAAGCCCTTTCTATGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115306747 | Original CRISPR | CTGGGATACCATATGGTGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||