ID: 1115307047

View in Genome Browser
Species Human (GRCh38)
Location 14:31944308-31944330
Sequence CATGGTAAACACTTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115307047_1115307058 -3 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307058 14:31944328-31944350 ATGCTGGTGCCATGGGGCTGGGG No data
1115307047_1115307060 2 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307060 14:31944333-31944355 GGTGCCATGGGGCTGGGGCTGGG No data
1115307047_1115307054 -9 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307054 14:31944322-31944344 TTTACCATGCTGGTGCCATGGGG No data
1115307047_1115307056 -5 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307056 14:31944326-31944348 CCATGCTGGTGCCATGGGGCTGG No data
1115307047_1115307057 -4 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307057 14:31944327-31944349 CATGCTGGTGCCATGGGGCTGGG No data
1115307047_1115307059 1 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307059 14:31944332-31944354 TGGTGCCATGGGGCTGGGGCTGG No data
1115307047_1115307053 -10 Left 1115307047 14:31944308-31944330 CCTCCCTCCAAGTGTTTACCATG No data
Right 1115307053 14:31944321-31944343 GTTTACCATGCTGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115307047 Original CRISPR CATGGTAAACACTTGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr