ID: 1115308662

View in Genome Browser
Species Human (GRCh38)
Location 14:31957544-31957566
Sequence TTTCCGCCAAGGGGCACCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115308662_1115308668 -3 Left 1115308662 14:31957544-31957566 CCTTCGGTGCCCCTTGGCGGAAA No data
Right 1115308668 14:31957564-31957586 AAAGGCAAGGTACTTCCTAATGG No data
1115308662_1115308670 13 Left 1115308662 14:31957544-31957566 CCTTCGGTGCCCCTTGGCGGAAA No data
Right 1115308670 14:31957580-31957602 CTAATGGAGACTGATGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115308662 Original CRISPR TTTCCGCCAAGGGGCACCGA AGG (reversed) Intergenic
No off target data available for this crispr