ID: 1115309687

View in Genome Browser
Species Human (GRCh38)
Location 14:31966685-31966707
Sequence CTGTGGAAATCTTGGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115309679_1115309687 27 Left 1115309679 14:31966635-31966657 CCTCAATATAGCAATTTTTGGAG No data
Right 1115309687 14:31966685-31966707 CTGTGGAAATCTTGGAAACAGGG No data
1115309677_1115309687 30 Left 1115309677 14:31966632-31966654 CCTCCTCAATATAGCAATTTTTG No data
Right 1115309687 14:31966685-31966707 CTGTGGAAATCTTGGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115309687 Original CRISPR CTGTGGAAATCTTGGAAACA GGG Intergenic
No off target data available for this crispr