ID: 1115310712

View in Genome Browser
Species Human (GRCh38)
Location 14:31975213-31975235
Sequence GGCTGTACACTCTGTGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115310712_1115310719 6 Left 1115310712 14:31975213-31975235 CCGGCTCCACAGAGTGTACAGCC No data
Right 1115310719 14:31975242-31975264 CACGCCTCTCCCACTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115310712 Original CRISPR GGCTGTACACTCTGTGGAGC CGG (reversed) Intergenic
No off target data available for this crispr