ID: 1115312396

View in Genome Browser
Species Human (GRCh38)
Location 14:31992674-31992696
Sequence TCCACCTTGCATAAAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115312396_1115312397 -5 Left 1115312396 14:31992674-31992696 CCAGATCTTTTATGCAAGGTGGA No data
Right 1115312397 14:31992692-31992714 GTGGAAAATCACTGCTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115312396 Original CRISPR TCCACCTTGCATAAAAGATC TGG (reversed) Intergenic