ID: 1115314056

View in Genome Browser
Species Human (GRCh38)
Location 14:32007956-32007978
Sequence GTGAACTCCCTGACAGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115314054_1115314056 14 Left 1115314054 14:32007919-32007941 CCTTTTGGAAACTAGGGCCTTTC 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG 0: 1
1: 0
2: 2
3: 12
4: 133
1115314055_1115314056 -3 Left 1115314055 14:32007936-32007958 CCTTTCTCATCACTGTGTAAGTG 0: 1
1: 1
2: 1
3: 21
4: 225
Right 1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG 0: 1
1: 0
2: 2
3: 12
4: 133
1115314053_1115314056 15 Left 1115314053 14:32007918-32007940 CCCTTTTGGAAACTAGGGCCTTT 0: 1
1: 0
2: 2
3: 25
4: 331
Right 1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG 0: 1
1: 0
2: 2
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115314056 Original CRISPR GTGAACTCCCTGACAGTTCT AGG Intronic
902436621 1:16402141-16402163 CTTAACTCCCCGACACTTCTGGG - Intronic
903855932 1:26337544-26337566 GTGGGGTCCCTGAGAGTTCTCGG - Exonic
903938573 1:26913386-26913408 GTGAGCTCCCAGACACTCCTGGG - Intronic
907558415 1:55365986-55366008 TTGAACTGCCTAACAATTCTTGG - Intergenic
911507007 1:98765920-98765942 GTGCTCTCCCTGATGGTTCTAGG + Intergenic
911529812 1:99031214-99031236 ATGCTCTCTCTGACAGTTCTAGG - Intergenic
912822385 1:112878524-112878546 GTGAAGTCCCTGAAACCTCTGGG + Intergenic
915141563 1:153771506-153771528 GCCCACTCCCTGACTGTTCTAGG + Intronic
915821640 1:159030701-159030723 GTGAACTCCATGAGGGTCCTTGG + Intronic
922345679 1:224694357-224694379 CTAAAGTCCCTGACAGTTTTAGG - Intronic
924796923 1:247299465-247299487 GTGTATTCCCTGACAGTTCTGGG - Exonic
1064593866 10:16923189-16923211 GTGAACTCCTTGGCAGAACTCGG + Intronic
1066663408 10:37758838-37758860 GTAAAATCTCAGACAGTTCTGGG + Intergenic
1070161712 10:73870866-73870888 GTGAACTCCTGGAGAGATCTGGG - Intronic
1070762416 10:79032530-79032552 GTGTTATCCCTCACAGTTCTTGG - Intergenic
1071278483 10:84077712-84077734 CTCAACTCCCTGACACTTCCAGG + Intergenic
1071816670 10:89239406-89239428 GTGAACTCTCATACAATTCTAGG - Intronic
1071870513 10:89789422-89789444 GTGAAGTCTGTGAGAGTTCTTGG + Intergenic
1076384535 10:130046857-130046879 GGGAGCTCCCTGACCTTTCTGGG + Intergenic
1076995151 11:294132-294154 GTGAACTTCCTGACAGGCATGGG + Exonic
1080944553 11:36956842-36956864 GTTAACTCCCTCACACTTCTGGG + Intergenic
1084645190 11:70452726-70452748 GGGAACTCCCTGTGGGTTCTGGG + Intergenic
1087460868 11:98445517-98445539 GTGATCTCATTGACAGTTCCTGG + Intergenic
1088608781 11:111557077-111557099 GGGAACTCCGTGACTGTCCTTGG + Intronic
1088819945 11:113448394-113448416 GGGAACTCCCTGGCTATTCTTGG + Intronic
1088871599 11:113894775-113894797 GTGAACTCCCAGATATTTCCTGG - Intergenic
1089744814 11:120609238-120609260 GTGAAGTCGAAGACAGTTCTGGG + Intronic
1095374464 12:41509530-41509552 GTGAAATCTCTGACAGTCCGTGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1099569419 12:84297069-84297091 ATGAAGTCACTTACAGTTCTAGG + Intergenic
1099869963 12:88334625-88334647 ATGAACTCCCTGACTCATCTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1105598817 13:21866866-21866888 GTGAACTCTGTGAGAGTCCTTGG + Intergenic
1105972389 13:25441493-25441515 GTGAAATACTTGACCGTTCTGGG + Intronic
1106420686 13:29583160-29583182 GTGGGCTCCTTTACAGTTCTGGG - Intronic
1110096112 13:71523308-71523330 CTGAAGTCCTTGACAGTTTTTGG + Intronic
1113175081 13:107554593-107554615 GGCAACTCCCTGCCAGTTCTTGG - Intronic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1116044819 14:39731880-39731902 GTGGACTCTCTGAGAGTCCTTGG + Intergenic
1116509254 14:45723460-45723482 GTGATTCCCCTGATAGTTCTGGG + Intergenic
1118741928 14:68745915-68745937 GTGAATTCCCAAACAGTTATGGG - Intergenic
1118795230 14:69137572-69137594 GTGAAGGCCCTAACACTTCTAGG + Intronic
1120433430 14:84449168-84449190 GTGAACTCCTGGCAAGTTCTAGG - Intergenic
1122984025 14:105203954-105203976 GTGAGCTTCCTGGCAGTTCGGGG - Intergenic
1126124373 15:45282199-45282221 ATGAACTCTCTCACACTTCTGGG - Intergenic
1129896261 15:79108687-79108709 CTGAACTCACTTATAGTTCTAGG - Intergenic
1129917644 15:79288483-79288505 GTTAACTCCCTCATACTTCTTGG + Intergenic
1133389141 16:5395127-5395149 GGGAACTACCTGCCAGTTTTGGG + Intergenic
1134308430 16:13054440-13054462 TTGAACTCCCCGATATTTCTAGG + Intronic
1137063631 16:35814468-35814490 GTCAGCTCACTCACAGTTCTGGG + Intergenic
1138307965 16:55995528-55995550 GTGATCTCAGTGACAGTGCTGGG - Intergenic
1139593876 16:67947321-67947343 GGGAACTCACCGCCAGTTCTTGG + Exonic
1140922876 16:79554970-79554992 CTGAACTCACTCACATTTCTGGG - Intergenic
1141495789 16:84408495-84408517 GTGAGTTCCCTGACAGCGCTCGG + Intronic
1141574784 16:84956858-84956880 ATGATCTCTCTGAAAGTTCTAGG - Intergenic
1144511177 17:15878287-15878309 TTGAACTACCTGATAGTCCTAGG + Intergenic
1148025868 17:44587259-44587281 CTTAACTCCCTAAGAGTTCTGGG + Intergenic
1151410229 17:73920389-73920411 GTGTATTCTCTCACAGTTCTGGG - Intergenic
1153479210 18:5530304-5530326 GTGAACTCCTTAACAGTTTCTGG - Intronic
1164801189 19:31078245-31078267 GTGAGCTCTCTGTCAGTACTTGG - Intergenic
1166270000 19:41707948-41707970 ATGTTCTCCCTGACAGTCCTGGG - Intronic
1166657392 19:44622409-44622431 TTGAACTCCCAGACTGTGCTGGG - Intronic
1167178530 19:47883397-47883419 TTGAACTCAAGGACAGTTCTGGG + Intronic
927055047 2:19359346-19359368 GTGAAATCTCAGAGAGTTCTGGG - Intergenic
927198843 2:20566148-20566170 GTGAACTCCCTGTCAGTGCCGGG - Intronic
928783229 2:34849937-34849959 GTGTATTCTCTCACAGTTCTGGG - Intergenic
930919533 2:56735354-56735376 GTGATCCCTCTGACAGATCTGGG + Intergenic
935147709 2:100407392-100407414 GGGAAGTCACTGTCAGTTCTTGG + Intronic
938040127 2:128068936-128068958 CAGCAATCCCTGACAGTTCTGGG - Intergenic
939549576 2:143597852-143597874 GTTTATTCCCTCACAGTTCTGGG + Intronic
941310924 2:163930480-163930502 GTGAGCTCCCTGATAGCCCTGGG + Intergenic
943650882 2:190456514-190456536 GGGAACTCCCTGGCTGCTCTAGG + Intronic
943996145 2:194768221-194768243 GTGAACTGTCTTACAGTTGTTGG + Intergenic
944185968 2:196949176-196949198 ATTAACTCACTGACACTTCTGGG + Intergenic
944469973 2:200042469-200042491 GTGCACCCCTTGACAGTTATAGG + Intergenic
948695422 2:239730805-239730827 CTGAACTCCCTAACAGCTGTTGG - Intergenic
1169166755 20:3430693-3430715 GTAACCTCCCCGACATTTCTTGG - Intergenic
1169475988 20:5931616-5931638 GTGTTCCCTCTGACAGTTCTAGG - Intergenic
1171996943 20:31738884-31738906 GTGAACTCCCTGAACCTTCAAGG + Intergenic
1172957495 20:38771419-38771441 GTGCACTCCAAGACAGTTCGGGG - Intronic
1176093535 20:63329380-63329402 CTGGGCTCCATGACAGTTCTGGG - Intronic
1182022479 22:27092317-27092339 GAGAAGTCCCTGCCAGCTCTCGG + Intergenic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
950988958 3:17410504-17410526 GTGATTTCTCTGACAGATCTGGG + Intronic
952958545 3:38575692-38575714 GTGAACAGCCTGGCAGGTCTGGG + Intronic
954318048 3:49811954-49811976 GTGAACTTCCTGGGAGCTCTGGG + Exonic
957882728 3:86241524-86241546 GAGAACTCACTCACATTTCTAGG + Intergenic
960970769 3:123138676-123138698 GTGGACTCCTTGACAGTTACAGG - Intronic
964185479 3:153937521-153937543 GTGTACTTCCAGACAGGTCTGGG + Intergenic
965005465 3:163017431-163017453 GTGATTTCTCTGACAGATCTGGG + Intergenic
966502279 3:180656853-180656875 GGTAACTCCCTGACATTGCTAGG - Intronic
967696733 3:192541677-192541699 AAGAACTCCCTTACATTTCTTGG + Intronic
968925886 4:3547832-3547854 GTGGACTCTCTGACGGTCCTCGG + Intergenic
973797661 4:54444761-54444783 GGGAATTTCCTGACAGTTTTAGG - Intergenic
975243752 4:72094248-72094270 GTGGACTCCATGAGAGTTCTTGG + Intronic
977200511 4:94109306-94109328 ATGCACTCTCTGACAGGTCTAGG - Intergenic
977553257 4:98464473-98464495 GTGACCTCCCTGCCAGTTCCCGG + Intergenic
978928046 4:114274187-114274209 CTGAATTCTCTGACAGCTCTAGG + Intergenic
981698436 4:147582231-147582253 GTGAGCTCCCTGACAGTGCAGGG - Intergenic
982372944 4:154654402-154654424 ATGCTCTCTCTGACAGTTCTAGG - Intronic
982566332 4:156991769-156991791 GTCAATTCCCTGGCACTTCTGGG - Intergenic
985833338 5:2251906-2251928 GTGAGCTCACAGACAGGTCTCGG + Intergenic
986666351 5:10108189-10108211 GTGTTCTCTCTCACAGTTCTGGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989398385 5:40982694-40982716 GTGTACTCCCTGAAAACTCTGGG - Exonic
991002543 5:61796899-61796921 GTTAAGTCCCTGACATTTCAGGG - Intergenic
991649586 5:68838441-68838463 GTGAACGCCCCAACACTTCTGGG + Intergenic
994887857 5:105588357-105588379 TTGAACTCTCTCATAGTTCTGGG + Intergenic
999101465 5:149029079-149029101 GTGAACTCGCTGAGAGATTTGGG - Intronic
999856340 5:155598779-155598801 GTGAACTTCCTGGCAAGTCTGGG - Intergenic
1000225195 5:159254672-159254694 ATGAACCCCCTGGCATTTCTAGG - Intergenic
1006653177 6:35568142-35568164 ATAAACTTCCTGACTGTTCTGGG - Intergenic
1007374997 6:41450591-41450613 GTGAACTCCCTGAGTGATCCTGG + Intergenic
1007405442 6:41633268-41633290 GTGCTCTCTCTGACAGCTCTGGG - Intergenic
1010098013 6:72069333-72069355 GTTAGCTCCCTGACTGTTCAGGG - Intronic
1010486324 6:76418758-76418780 ATGAACTGCCTGGCAGTTATGGG - Intergenic
1010506323 6:76664407-76664429 TTCAAGTCCCTGACTGTTCTAGG + Intergenic
1012993560 6:105950119-105950141 AAGAACTCCCTGGCATTTCTGGG + Intergenic
1015692505 6:135940528-135940550 CTGAACTCCCTGACAGTGCCTGG - Intronic
1016351705 6:143176221-143176243 GTGGACTCCATGAGGGTTCTTGG + Intronic
1016824031 6:148371791-148371813 GTGAAGTACCTGCCAGTTCTTGG + Intronic
1017326368 6:153145698-153145720 GTGGACTCTCTGACGGTCCTTGG + Intergenic
1017558852 6:155605074-155605096 GTGAAACCCATGCCAGTTCTTGG + Intergenic
1018727705 6:166626810-166626832 TTGAACTCCCTGACGGGTCTCGG + Intronic
1021014513 7:15516697-15516719 GTGAAATAACTGACAGTTTTTGG - Intronic
1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG + Intronic
1022142947 7:27509080-27509102 TTGAACTGCCTGCCAGTCCTTGG + Intergenic
1023032396 7:36101902-36101924 GTGAACACCGTGTCTGTTCTGGG - Intergenic
1026137761 7:67678436-67678458 GTTTACTCACTGACAGTCCTGGG - Intergenic
1026728091 7:72887296-72887318 GTGAACTCTGTGTCAATTCTGGG + Intronic
1027115745 7:75478490-75478512 GTGAACTCTGTGTCAATTCTGGG - Intronic
1029721795 7:102372155-102372177 GTGAACTCTGTGTCAATTCTGGG + Intronic
1035317677 7:158006980-158007002 ATGTACTCCGTCACAGTTCTGGG + Intronic
1037881248 8:22574558-22574580 CAGAACTCCCCTACAGTTCTGGG + Intronic
1043406535 8:79940379-79940401 GTGAACTCCTTTACTGTTCCAGG + Intronic
1045690987 8:104759524-104759546 GTTAACTCCCTCACACTTGTAGG + Intronic
1045714003 8:105020307-105020329 GTTACCTCCCTAACATTTCTAGG - Intronic
1047749626 8:127870409-127870431 ATGCACTCTCTCACAGTTCTGGG - Intergenic
1048526979 8:135212136-135212158 GTTAACTCTCTCTCAGTTCTGGG - Intergenic
1053800768 9:41763010-41763032 GTGGACTCTCTGACGGTCCTCGG + Intergenic
1054189199 9:61975162-61975184 GTGGACTCTCTGACGGTCCTCGG + Intergenic
1058787126 9:108400495-108400517 GTGAACTCCCTCACAGTCCTTGG + Intergenic
1058900234 9:109435679-109435701 GTCATTTCACTGACAGTTCTTGG + Intronic
1189254436 X:39626987-39627009 GTAAACTCCCTGGCACTTCTAGG - Intergenic
1190252603 X:48738371-48738393 GTGAACTCCCTGAGCTATCTGGG - Intergenic
1193472999 X:81929167-81929189 ATGCTCTCCCTGACAGCTCTAGG + Intergenic
1198313671 X:135445249-135445271 GTGAGCTCCCTTTCAGTCCTGGG - Intergenic
1200851935 Y:7892194-7892216 GTGAACACCCTGCTAGATCTAGG + Intergenic