ID: 1115318046

View in Genome Browser
Species Human (GRCh38)
Location 14:32046941-32046963
Sequence CAGAAAAATGTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115318041_1115318046 20 Left 1115318041 14:32046898-32046920 CCCCTTTCAGGCTCACAGAACTG No data
Right 1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG No data
1115318039_1115318046 27 Left 1115318039 14:32046891-32046913 CCACCAGCCCCTTTCAGGCTCAC No data
Right 1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG No data
1115318043_1115318046 18 Left 1115318043 14:32046900-32046922 CCTTTCAGGCTCACAGAACTGTT No data
Right 1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG No data
1115318042_1115318046 19 Left 1115318042 14:32046899-32046921 CCCTTTCAGGCTCACAGAACTGT No data
Right 1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG No data
1115318040_1115318046 24 Left 1115318040 14:32046894-32046916 CCAGCCCCTTTCAGGCTCACAGA No data
Right 1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115318046 Original CRISPR CAGAAAAATGTGAAGGAGGA AGG Intergenic
No off target data available for this crispr