ID: 1115321712

View in Genome Browser
Species Human (GRCh38)
Location 14:32087323-32087345
Sequence TTGGCTCTAACAGGTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115321712_1115321716 4 Left 1115321712 14:32087323-32087345 CCCTTAAAACCTGTTAGAGCCAA 0: 1
1: 0
2: 1
3: 14
4: 222
Right 1115321716 14:32087350-32087372 ATGAGATCTTTTGTCCATTGAGG 0: 1
1: 0
2: 1
3: 15
4: 177
1115321712_1115321717 7 Left 1115321712 14:32087323-32087345 CCCTTAAAACCTGTTAGAGCCAA 0: 1
1: 0
2: 1
3: 14
4: 222
Right 1115321717 14:32087353-32087375 AGATCTTTTGTCCATTGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115321712 Original CRISPR TTGGCTCTAACAGGTTTTAA GGG (reversed) Intronic
902611026 1:17597260-17597282 TTGCCTCTTACTGGTTTTTATGG + Intronic
903025172 1:20424018-20424040 TTAGTTTTAATAGGTTTTAATGG - Intergenic
903309213 1:22440198-22440220 TTAGCTCTAACAGGTTTTTTTGG + Intergenic
903398651 1:23021946-23021968 TTGGCTTTAGCATGTTTTCAGGG + Intronic
903790864 1:25891986-25892008 CTGGCTCTAAGAGCTTTTCAGGG - Intronic
906302921 1:44696843-44696865 TTGGCTCTTACAGGCTTTCTAGG - Intronic
907618060 1:55945143-55945165 TTGGGCCTCACAGTTTTTAAAGG + Intergenic
908020847 1:59897006-59897028 TTGTCTGTAACAGGTTGTTAAGG + Intronic
908896133 1:68902125-68902147 TTAGTTCTAATAGTTTTTAATGG - Intergenic
915075140 1:153302075-153302097 TTGTCTCTGACAGGTTAGAAGGG + Intronic
916400379 1:164441285-164441307 ATGGCTTTAACACATTTTAATGG - Intergenic
918601580 1:186369620-186369642 TTAGCTCTGACAGGTTTTTGTGG + Intronic
919189558 1:194198462-194198484 TTTACTCAAAGAGGTTTTAATGG + Intergenic
921163555 1:212489803-212489825 TTGGCCCTAAAAGGAATTAAGGG - Intergenic
922810730 1:228414264-228414286 TTGGCTCTAACATGCTTCCATGG + Intronic
924298211 1:242610676-242610698 TTGCCTCTAACAGGTATATAGGG - Intergenic
1065151711 10:22829628-22829650 TTGGATCTAATATTTTTTAAAGG - Intergenic
1065172175 10:23042438-23042460 TTGCCTTTAGCATGTTTTAAGGG + Intergenic
1065239449 10:23691303-23691325 TTGGTGCTAACTGGTTTTCAGGG + Intergenic
1066409944 10:35157853-35157875 TTAGATCTAACAGGTTTTTCTGG - Intronic
1067573689 10:47391176-47391198 TTAGCTCTAACAGTTTTTTGTGG + Intergenic
1067970144 10:50960461-50960483 TTGCCTCTTCCAGGTTTTGATGG - Intergenic
1069151659 10:64968837-64968859 TTTGCTTGAACAGATTTTAAAGG + Intergenic
1073187660 10:101626360-101626382 TTGGCTTTACCAGTTATTAATGG - Intronic
1073574345 10:104609246-104609268 TTGGATCTAATATTTTTTAAAGG + Intergenic
1074414272 10:113253503-113253525 TTGCCTCTTTCAGTTTTTAAAGG + Intergenic
1074658365 10:115620479-115620501 TTGTCTCTAAAATGGTTTAAGGG - Intronic
1075523655 10:123163415-123163437 TTACCTCTACCAGGCTTTAAGGG + Intronic
1077939023 11:6819630-6819652 TTCGTTCTAACAGGTTTTTTTGG - Intergenic
1078101099 11:8330759-8330781 TCGGCTCTATCTGGTTTTACAGG - Intergenic
1079050745 11:17156708-17156730 AGGGCTCTGACATGTTTTAAAGG - Intronic
1079469892 11:20768336-20768358 TTGGATCAAACAAGTTTAAAGGG + Intronic
1079558920 11:21796885-21796907 TTAGTTCTAACAGGTTTTTCTGG + Intergenic
1080038516 11:27734385-27734407 TTGGCTCTAAAAGTTTTCAAGGG + Intergenic
1080284319 11:30590998-30591020 TTTTCTTTACCAGGTTTTAATGG - Intergenic
1081052050 11:38353829-38353851 CTGGTTCTAACAGGTTTTTAGGG + Intergenic
1081190803 11:40100943-40100965 TTGGATCTAATATTTTTTAAAGG + Intergenic
1087432192 11:98068919-98068941 TTGGATCTAACATTTTTTAAAGG - Intergenic
1088559804 11:111102128-111102150 TTGGCTCCATCAGGTCTTCACGG + Intergenic
1090367786 11:126221960-126221982 TTGGCACAAACATGTTGTAAAGG + Intronic
1091929208 12:4381391-4381413 TTAGCTCTAACATGTTGTATGGG - Intergenic
1093944751 12:25094949-25094971 TTAGTTCTAACAGGTTTTTTTGG + Intronic
1094759101 12:33508836-33508858 TTAGTTCTAACAGTTTTTGATGG - Intergenic
1095333309 12:40995645-40995667 TTGGCTCTAATGGCTTGTAAGGG - Intronic
1096439376 12:51627014-51627036 TTGCCTCTAACAGGCAGTAATGG + Intronic
1097288575 12:57896057-57896079 TTAGCTCTGACAGCTTCTAAAGG - Intergenic
1097843983 12:64347722-64347744 TTGGATCAAATACGTTTTAAAGG + Intronic
1099112258 12:78575988-78576010 TTGGCTCTGAGAGCTTTTATTGG - Intergenic
1100680768 12:96917431-96917453 ATGGATCCAACAGCTTTTAAGGG - Intronic
1102337061 12:112090855-112090877 TTGTTGCTATCAGGTTTTAAAGG - Exonic
1105380283 13:19880840-19880862 TTAGTTCTAACAGTTTTTCAAGG + Intergenic
1107121483 13:36801255-36801277 TTGGCTGTAAGAGGTTTCCATGG - Intergenic
1107187276 13:37538406-37538428 TCAGCTCTAAAATGTTTTAATGG - Intergenic
1109018007 13:57044739-57044761 TTGGATCTATTAGGTATTAATGG + Intergenic
1110256729 13:73441109-73441131 TTGGATCTAATATTTTTTAAAGG + Intergenic
1111467082 13:88627833-88627855 TTGTCTCTCACAGGCTCTAAAGG - Intergenic
1111605700 13:90535971-90535993 GTGGCTGTAACAGATGTTAATGG + Intergenic
1112549717 13:100408476-100408498 TTGGATCTAATATTTTTTAAAGG - Intronic
1113296699 13:108967226-108967248 TTTACTCTAACAAGTTATAAAGG + Intronic
1114175187 14:20312068-20312090 TTGGCTTTTACAGGTTTTAAAGG + Intronic
1115321712 14:32087323-32087345 TTGGCTCTAACAGGTTTTAAGGG - Intronic
1116340481 14:43716632-43716654 TTGGTTCTAACAGTTTTTGGTGG - Intergenic
1116390317 14:44383684-44383706 TTGGATCTAATATTTTTTAAAGG - Intergenic
1116890637 14:50264567-50264589 GTGTTTCTAACAGGTTTTAATGG + Intronic
1117769422 14:59118099-59118121 CTGGCTCTGGCAGGTTTTACAGG + Intergenic
1119584261 14:75817638-75817660 TTGGCTATAAAATGTTCTAAGGG - Intronic
1120216688 14:81688072-81688094 TTTGTTCTCACAGGTTTTAAGGG + Intergenic
1121248171 14:92479070-92479092 TTAGTTCTAATAGGTTTTTATGG + Intronic
1124037326 15:26066922-26066944 TTGGTTCTAACAGTTTTTGGTGG + Intergenic
1126363023 15:47865564-47865586 TTGGCTCTTCCAGGTTTTGGTGG - Intergenic
1129389883 15:75215177-75215199 TTGGGTCTAAGAGGTTTACAGGG - Intergenic
1131548054 15:93332603-93332625 TTTTCTCTCACTGGTTTTAAGGG - Intergenic
1132277418 15:100581186-100581208 TTTCCTCTAACAGTTTTCAATGG + Intronic
1137698998 16:50482412-50482434 TTGGCCATGACAGGTGTTAAGGG + Intergenic
1137729606 16:50680093-50680115 TTGTCTCTTACAGGTTTCATTGG + Intronic
1138337243 16:56263023-56263045 TTGGTTCTCACAGGTTTCTAAGG - Intronic
1141417343 16:83886191-83886213 GTGGCTCTAACAGCTGTAAAGGG + Intergenic
1143718515 17:8793746-8793768 ATGGATCTAAAAGATTTTAAGGG - Intergenic
1147231764 17:39024624-39024646 TTTGGTCTAAGAGGTTTTGAAGG - Intergenic
1147670905 17:42176282-42176304 TTGGCTCAAACACGTTCTAAGGG + Exonic
1149290494 17:55213654-55213676 TGGGCTCTGAGATGTTTTAAGGG - Intergenic
1155013954 18:21813623-21813645 TTTTCTCAAACAGGTATTAAAGG - Intronic
1155906594 18:31459491-31459513 TGGGCTCTTTCAGGTTATAAAGG + Intronic
1157791535 18:50535985-50536007 TTGATTCTGACAGTTTTTAAAGG + Intergenic
1157853281 18:51078763-51078785 AAGGCTCTAAGACGTTTTAAAGG - Exonic
1159194881 18:65100570-65100592 TTGGCTCTAACCGTTTTTCTTGG + Intergenic
1160104768 18:75962962-75962984 TTGGCTGAAACAGCTGTTAATGG - Intergenic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1164661669 19:29977402-29977424 TTGGCTTTTACAAGTTTTAAAGG - Intronic
1165302463 19:34979427-34979449 GTGGATCGCACAGGTTTTAAGGG + Intergenic
1168458920 19:56538347-56538369 TTGGCTGTGACAGGTGCTAAGGG - Intergenic
925167306 2:1725234-1725256 TTAGTTCTAATAGTTTTTAATGG + Intronic
925686385 2:6478133-6478155 TTGGCCCAAACAGGACTTAAAGG - Intergenic
925945771 2:8862021-8862043 TTTCCTCTAACTGGTTTTCAAGG + Intronic
927835625 2:26396286-26396308 TATGGTCTAACAGGTTTTTATGG - Intergenic
928368483 2:30721705-30721727 TTCTCTTTAACAGGATTTAAAGG - Intergenic
928561707 2:32495188-32495210 TTTGCTCTAACATTTTCTAAAGG + Intronic
928901921 2:36328319-36328341 TTAGTTCTAATAGTTTTTAAGGG - Intergenic
933131247 2:78676659-78676681 TTGGATCTAATATTTTTTAAAGG - Intergenic
933551166 2:83777835-83777857 TTAGTTCTAACAGTTTTTGATGG + Intergenic
933608646 2:84410923-84410945 TTAGCTCTAACAGTTTTTGGTGG - Intergenic
933630833 2:84655207-84655229 TTGGCTGTCATAGGTGTTAAGGG - Intronic
939038279 2:137158747-137158769 TTGACTCTTACACGTGTTAAGGG + Intronic
939646894 2:144711067-144711089 AAGGCTCTGACAAGTTTTAAAGG + Intergenic
939771871 2:146331045-146331067 TTAGCTCTAATAGTTTTTAGTGG + Intergenic
940040860 2:149359097-149359119 TTGGCACAAACATATTTTAAAGG + Intronic
940791310 2:158032946-158032968 CTGGCCCTAACAGGCTTTTAGGG + Intronic
942406675 2:175663326-175663348 TTTGAACTAACAGGATTTAATGG - Intergenic
944237191 2:197451271-197451293 GTGACTCTTACAGGTCTTAAAGG - Intergenic
945333652 2:208567008-208567030 ATGGCCCAAACAGGTTTCAATGG + Intronic
945765278 2:213968687-213968709 CTGGCTCTATCAGGTGTTAATGG + Intronic
1168759491 20:339801-339823 TTGGCTCTGAGAGTTTTTACAGG + Intergenic
1168843136 20:922634-922656 TTAGCTCTCACAGGTTCTGAAGG - Intergenic
1170342450 20:15344599-15344621 TTAGCACAAACAGGTTTTCAAGG - Intronic
1173666843 20:44769159-44769181 TTTGCTGTAATGGGTTTTAAGGG - Intronic
1176253841 20:64140284-64140306 AAGGCTTTAACAGGTTTTATAGG - Intergenic
1177022639 21:15882454-15882476 TTGTCTTTTACAGGTTTTCAAGG + Intergenic
1177779711 21:25608811-25608833 GTGGCTCTAAGATGTTCTAAGGG - Intergenic
1178329402 21:31674444-31674466 TTGGCTCTCAAAGGGTTAAAAGG - Intronic
1178384784 21:32140238-32140260 TTGGCACTGACGGGTTTTACTGG + Intergenic
1178575452 21:33784626-33784648 TTGGCTTTATCAGGTTTGAGAGG - Intronic
1178619961 21:34165824-34165846 TTGGATCTAATATTTTTTAAAGG - Intergenic
949216475 3:1575579-1575601 TTGGTCCTAACTGGGTTTAATGG + Intergenic
951059554 3:18189154-18189176 TTTGCTTTCACTGGTTTTAAAGG - Intronic
951335146 3:21411791-21411813 TTGGCGTTAACATGTTTTTATGG + Intergenic
951345639 3:21544067-21544089 TTGGATCTAATATTTTTTAAAGG + Intronic
951719441 3:25682349-25682371 TTTGCTTTCACAGGATTTAAAGG + Intergenic
952193048 3:31043765-31043787 TTGGATCAAACATTTTTTAAGGG + Intergenic
952681037 3:36093072-36093094 TTTGCTATAATAGTTTTTAATGG + Intergenic
953017802 3:39095068-39095090 GTGTCTCTAACAAGTGTTAATGG - Exonic
954522820 3:51244560-51244582 TTAGTTCTAACAGGTTTTTTTGG + Intronic
954543440 3:51412295-51412317 TTTGCTGTAGGAGGTTTTAAAGG - Intronic
956142631 3:66161036-66161058 CTGGCTGTCACAGCTTTTAATGG + Intronic
956764789 3:72475323-72475345 TTGTTTCCAACAGTTTTTAAAGG + Intergenic
958989092 3:100821229-100821251 TTAGTTTTAACAGTTTTTAAAGG - Intronic
959089651 3:101888516-101888538 TTGGGTCTCACAGCTTTTTATGG + Intergenic
960785197 3:121364820-121364842 TTAGCTCTAACAGTTTTTTGTGG + Intronic
961912383 3:130331853-130331875 TTAGTTCTAACAGGTTTTTGTGG - Intergenic
965027809 3:163325281-163325303 TTGGATCTAATATTTTTTAAGGG + Intergenic
965533976 3:169805261-169805283 TTAGTTCTAACAGGTTTTTTTGG - Intronic
966574653 3:181486495-181486517 TTGGCTCTGTGAGGTTTTGATGG + Intergenic
966656154 3:182360681-182360703 TTGGCTCTATCTGATTTCAAAGG - Intergenic
967050692 3:185781497-185781519 TTGGCGTTAACAGGGTTAAAAGG + Intronic
970049072 4:11892260-11892282 TTAGTTCTAATAGCTTTTAATGG - Intergenic
970231909 4:13919638-13919660 CTGGCATTAACAGTTTTTAAAGG - Intergenic
970971864 4:21993953-21993975 TTAGCTCTGACATTTTTTAAAGG - Intergenic
971136089 4:23870105-23870127 TTAGATCTAACAGATTTTAATGG - Intronic
971637931 4:29087421-29087443 TTGCCTCTAACAGCTTATAGTGG + Intergenic
973040723 4:45466767-45466789 TTGCCTCTTCCAGGTTTTAGAGG - Intergenic
974134532 4:57798498-57798520 TTGTAGGTAACAGGTTTTAAAGG + Intergenic
974633282 4:64524217-64524239 TTAGTTCTAACAGTTTTTTATGG + Intergenic
976041452 4:80890239-80890261 TTGGTTCTAACAGCTTTTTGTGG - Intronic
978663886 4:111159656-111159678 TTAGTTCTAACAGATTTTTATGG - Intergenic
979347528 4:119606138-119606160 TTTGCTCTAAAAGTTTTCAATGG - Intronic
980244344 4:130219415-130219437 TTAGTTCTAACAGTTTTTGATGG + Intergenic
980722622 4:136717586-136717608 TTGGATCTAATATTTTTTAAAGG + Intergenic
980815301 4:137939589-137939611 TTAATTCTAACAGTTTTTAATGG - Intergenic
980870450 4:138605491-138605513 TTAGTTCTAATAGTTTTTAATGG - Intergenic
981255597 4:142657188-142657210 TTGGATCTAACATTTTTTAGAGG + Intronic
983321288 4:166199283-166199305 TTGGATCTAATATTTTTTAAAGG + Intergenic
983364917 4:166774323-166774345 ATGGGCCTATCAGGTTTTAAAGG + Intronic
984206859 4:176795459-176795481 TTGCCACTAGCAGATTTTAAAGG + Intergenic
984519163 4:180780084-180780106 TTAGCTCTAGCAGGTTTTTGGGG + Intergenic
987545420 5:19306029-19306051 AGGACTCTAACAGGTTTTCAAGG - Intergenic
987667801 5:20967143-20967165 TTGTCTCTTTCAGGTTTTAGTGG + Intergenic
988789130 5:34591299-34591321 TTGGCTATAAGAGCTTATAATGG + Intergenic
989712636 5:44418369-44418391 ATGTCTCTAACAGCTTTCAAGGG + Intergenic
990223653 5:53624708-53624730 TTATCTCTAACAGGTTTTTTTGG + Intronic
990443878 5:55874752-55874774 TTGGTTCTAATAGGTTTTTTAGG + Intronic
991361996 5:65830514-65830536 TTGGCTCTTACTGGTGGTAATGG - Intronic
992588207 5:78263383-78263405 TTGGTTCTAACAGTTTTTTGTGG + Intronic
995222598 5:109667803-109667825 TTTGCTCCAACAGGGATTAATGG + Intergenic
995830263 5:116347702-116347724 TTGGATCTAACATTTTTTAAAGG - Intronic
996026183 5:118648475-118648497 ATGCCTCTAACAAGTTTTTAAGG - Intergenic
999556638 5:152750489-152750511 TTAGCTTTAACAGGTTTTGGGGG - Intergenic
1002676626 5:180919658-180919680 TAAGTTCTAACAGGTTTTAGTGG - Intronic
1002676700 5:180921072-180921094 TTAGCTCTAACAGTTTTTTGTGG - Intronic
1002841056 6:907684-907706 TTGGGTGAAACAGGTTTTTATGG - Intergenic
1003301506 6:4887568-4887590 TTTGTTCTAATAGTTTTTAATGG + Intronic
1005493179 6:26365716-26365738 TTGGCCAGAACAGATTTTAAGGG - Intronic
1008815622 6:55561463-55561485 ATGGCTTTAACAGGTTCTACAGG - Intronic
1009518865 6:64656850-64656872 TTGGCTGTAAAAGGTTGAAATGG + Intronic
1009754185 6:67914155-67914177 TTAGTTCTAACATTTTTTAACGG - Intergenic
1010379247 6:75206901-75206923 TTGGCTCCGCGAGGTTTTAAGGG - Intergenic
1012331238 6:97990682-97990704 TTGGATAAAACAAGTTTTAAAGG + Intergenic
1012341879 6:98136605-98136627 TAGGCTCTAAGAGGTCTTACAGG + Intergenic
1012455543 6:99399877-99399899 TTTTGTATAACAGGTTTTAAAGG - Exonic
1013045959 6:106485380-106485402 TTAGTTCTAACAGGTTTTTTTGG + Intergenic
1013056158 6:106584876-106584898 TTAGCTCTCACAGGTTTTCTGGG - Intronic
1013410375 6:109878270-109878292 TTGGATCTAATATTTTTTAAAGG + Intergenic
1014750489 6:125250086-125250108 TTGGGTATAACAGGTTATAGAGG - Intronic
1014917019 6:127163046-127163068 TTGGCTAGAACAGGCTGTAAAGG - Intronic
1016680946 6:146828748-146828770 TTGGCAGTAACAGTTTTTAAAGG - Intergenic
1018153457 6:160962703-160962725 TTGACTCTAACAGTTTGTCAGGG - Intergenic
1019110504 6:169706942-169706964 TTAGGTCTAACAGGTTATGAAGG - Intronic
1020617300 7:10475997-10476019 TTAGCTCTATCATGTTCTAACGG + Intergenic
1020677080 7:11195785-11195807 TTGGCTTTAAAAGGTCTTATCGG + Intergenic
1021089145 7:16461514-16461536 TTGCCTCTAACATGTATAAAGGG - Exonic
1023952319 7:44856457-44856479 CTGGCACTAAGAGGTTATAATGG + Intergenic
1027279947 7:76601624-76601646 TTCCCTGTAACAGGCTTTAAAGG - Intergenic
1027568183 7:79825824-79825846 TTAGCTCTAAGAGGTTTTGGTGG + Intergenic
1028167500 7:87554865-87554887 TTTGCTCTAAGAAGTATTAATGG - Intronic
1028622376 7:92837843-92837865 TTTGCTTTAAGATGTTTTAAAGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1032251130 7:130258346-130258368 TTGGATCAAATAGTTTTTAAAGG + Intergenic
1036786028 8:11687771-11687793 ATGGCTCTGACAGGTTTTATTGG + Intronic
1040466664 8:47701874-47701896 TTGTTTCTAACAGGTTTTTTAGG + Intronic
1043146479 8:76661763-76661785 TTGGCTCTCTCATTTTTTAAAGG - Intergenic
1043401590 8:79890603-79890625 CTGGCTTTAATAGTTTTTAAGGG + Intergenic
1043708730 8:83385787-83385809 TTAGTTCTAAGAGGTTTTAGTGG - Intergenic
1044229665 8:89759188-89759210 TTGGTTTGTACAGGTTTTAAGGG + Intronic
1044363665 8:91318018-91318040 TAGGTTCTAAGAGGTTTCAAAGG - Intronic
1044694736 8:94911585-94911607 TTGTCTCTAAAAGGATTAAAGGG - Intronic
1051426702 9:16939250-16939272 TTAGTTCTAACAGTTTTTAGTGG - Intergenic
1051591795 9:18783579-18783601 GTGGCTTTAACATCTTTTAAAGG + Intronic
1052519591 9:29528787-29528809 TTAGTTCTAACAGGTTTATAGGG + Intergenic
1055182914 9:73411493-73411515 TAGGCTCTTACAAGTCTTAAAGG + Intergenic
1055378217 9:75674334-75674356 TTAGTTCTAACAGTTTTTCATGG + Intergenic
1055820886 9:80262127-80262149 TTAGTTCTAACAGGTTTTTGTGG - Intergenic
1057173754 9:92978989-92979011 TTAGTCCTAACAGTTTTTAATGG + Intronic
1057636056 9:96768468-96768490 TTGGCTCTAATAGTTTTTTGTGG - Intronic
1059844016 9:118251009-118251031 TTGGTGCTAACAGGTTAAAAGGG + Intergenic
1062074508 9:134577828-134577850 CTGGTTCTATCAGGTTTTGATGG - Intergenic
1186070113 X:5809953-5809975 TTGGCTTTAACTGGTATAAAAGG + Intergenic
1187787016 X:22903025-22903047 TTAGTTCTAACAGATTTTTATGG + Intergenic
1187865614 X:23720630-23720652 TTCTCTCTTACAGGTTTTAGAGG + Intronic
1188862679 X:35275706-35275728 TTGGATCTAACATTTTTTAAAGG - Intergenic
1189673149 X:43433614-43433636 TTCCCTCTAACAGGGTATAAGGG - Intergenic
1192279215 X:69666179-69666201 TTAGTTCTAACAGTTTTTTATGG + Intronic
1192779051 X:74275793-74275815 TTGGGTCTAGCTAGTTTTAATGG + Intergenic
1193274141 X:79566256-79566278 TTGTCTGTACCAGTTTTTAAGGG + Intergenic
1193455607 X:81728148-81728170 TTGTCTCTTGCAGGTTTCAAGGG - Intergenic
1195652766 X:107302496-107302518 TTTGCTCTAACTGGTTTCTAAGG - Intergenic
1199187649 X:144936058-144936080 TTGTGTCTAAAAGATTTTAAAGG - Intergenic
1200707427 Y:6454860-6454882 TTGGCTGTAACAGGAATTTATGG + Intergenic
1200929202 Y:8681896-8681918 TTGGCTGTAACAGGAATTTACGG + Intergenic
1201026685 Y:9709848-9709870 TTGGCTGTAACAGGAATTTATGG - Intergenic
1202150959 Y:21843355-21843377 TTGGCTGTAACAGGAGTTTATGG + Intergenic