ID: 1115322508

View in Genome Browser
Species Human (GRCh38)
Location 14:32098922-32098944
Sequence CTCGGTTACAGTGTGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115322506_1115322508 28 Left 1115322506 14:32098871-32098893 CCTAAGAGTAATTTGAACATAGA 0: 1
1: 0
2: 2
3: 26
4: 288
Right 1115322508 14:32098922-32098944 CTCGGTTACAGTGTGAAGAATGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115322508 Original CRISPR CTCGGTTACAGTGTGAAGAA TGG Intronic
905782672 1:40726432-40726454 CTGGGTGACAGTGTGGAGAGAGG - Intronic
908628362 1:66073216-66073238 CTAGGTGACATTGTAAAGAAAGG - Intronic
911751844 1:101504591-101504613 CTCGTTGTCAGTGTGAACAAGGG + Intergenic
913185904 1:116371001-116371023 CTGTGTTCCGGTGTGAAGAAAGG - Intergenic
913189823 1:116404142-116404164 CTCAGTTACAGTTTGAGGACTGG + Intronic
916763069 1:167834333-167834355 CTAGATGATAGTGTGAAGAAAGG - Intronic
916822011 1:168409095-168409117 CACGGATACCCTGTGAAGAATGG + Intergenic
917754036 1:178081401-178081423 CTTGGCAACAGCGTGAAGAAAGG + Intergenic
920977801 1:210801994-210802016 CCTGGTCACAGTGTAAAGAATGG - Intronic
1066051689 10:31642546-31642568 GTCGGCTACAGTGTGAAAAATGG - Intergenic
1068165695 10:53329655-53329677 CTCCTATACATTGTGAAGAAGGG - Intergenic
1068351534 10:55852745-55852767 CTGGGCTACATTCTGAAGAAAGG + Intergenic
1069907001 10:71737917-71737939 CTTGGTTCCAGTGGGTAGAAGGG - Intronic
1073510083 10:104037469-104037491 CTGGGATACAGTGTCAACAAGGG - Intronic
1073573745 10:104603210-104603232 CTCGGAAACTGTTTGAAGAAAGG - Intergenic
1074580973 10:114719079-114719101 CTGGGTTACAGTGAAAAGTAGGG + Intergenic
1075703260 10:124482999-124483021 CTCAGTGACAGTTTGCAGAAGGG + Intronic
1077578176 11:3400012-3400034 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1077914565 11:6602952-6602974 GTCGGTTACAGTGTGGAGGATGG - Intronic
1079950972 11:26803958-26803980 TTTGGTTACTGTGTGAAGAATGG - Intergenic
1081210843 11:40331791-40331813 CTCAGTCCCAGTCTGAAGAATGG - Intronic
1081333013 11:41827010-41827032 CTCAGGGACAGAGTGAAGAATGG + Intergenic
1081558683 11:44191816-44191838 CTCAGTGACAGCGTGGAGAAAGG - Intronic
1084232916 11:67766185-67766207 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1089413998 11:118271774-118271796 CTCAGTTACAGTATGGAGAAAGG + Intergenic
1090943068 11:131405663-131405685 GTAGGTTACTGTTTGAAGAATGG - Intronic
1091033670 11:132214039-132214061 CACAGTTACAGTGTCAAGAATGG - Intronic
1091217009 11:133908264-133908286 CTTGGTTCCTGGGTGAAGAAGGG - Intergenic
1092080609 12:5713049-5713071 CTCTGACACAGTGTGGAGAATGG + Intronic
1092492432 12:8957431-8957453 ATCTGTTAAATTGTGAAGAAGGG - Intronic
1093047346 12:14463670-14463692 CCTGGTTACAGTATGGAGAATGG + Intronic
1094046835 12:26176888-26176910 CTTGGCAACAGTGTGAATAATGG - Intronic
1094497975 12:31001069-31001091 CGCAGCTACAGTGTGAAGAGTGG - Intergenic
1094709558 12:32947876-32947898 CTAGGTTACAGTGTGATGCATGG + Intergenic
1096096759 12:48940579-48940601 CTTGGTTACAGTTTGCTGAAGGG - Intronic
1100948626 12:99819273-99819295 CTAGATTACAGAGTGAATAAAGG + Intronic
1106049777 13:26179407-26179429 CTCAGCTACAGTGTGAAGTGAGG - Intronic
1106154340 13:27138850-27138872 CTCTGTTACAGGGTGAATATGGG - Intronic
1107758886 13:43655022-43655044 CTGTGTCACAGAGTGAAGAAAGG - Intronic
1108465250 13:50708554-50708576 ATCAATAACAGTGTGAAGAAAGG + Intronic
1110307711 13:74009361-74009383 CACGGTAACCTTGTGAAGAAAGG + Intronic
1115322508 14:32098922-32098944 CTCGGTTACAGTGTGAAGAATGG + Intronic
1117002244 14:51382610-51382632 CTTGGTGACTGGGTGAAGAAAGG + Intergenic
1120932273 14:89860759-89860781 CTGGGTTACAGTGTGAAAACAGG + Intronic
1121430014 14:93879876-93879898 CAAGGTCACAGTGTGAGGAAAGG - Intergenic
1125335440 15:38622009-38622031 CTGGGTTCAAGTGGGAAGAAAGG + Intergenic
1127624567 15:60767646-60767668 CTCGGGTACAGTGAGAAGTGTGG - Intronic
1138317066 16:56079219-56079241 GTCTGTTATTGTGTGAAGAATGG - Intergenic
1140363425 16:74363601-74363623 CTTGGTCAGAGTGTGAGGAAAGG - Intergenic
1143012161 17:3872080-3872102 CTCGGTCACAATGGGAAGAGTGG + Intronic
1144229806 17:13190630-13190652 ATGGGCTACTGTGTGAAGAATGG + Intergenic
1148289779 17:46434710-46434732 TCCAGTTACAGTGTGGAGAATGG - Intergenic
1148311947 17:46652282-46652304 TCCAGTTACAGTGTGGAGAATGG - Intronic
1151086019 17:71381643-71381665 CTCAGTTACAGTTTCAGGAATGG + Intergenic
1151945886 17:77319643-77319665 TTGGGGTACAGGGTGAAGAAGGG + Intronic
1155194578 18:23461405-23461427 CTGTGTTACAGTGTGAAGAATGG + Intronic
1156679669 18:39573155-39573177 CTCAGTTACAGTCTGTAGCAAGG - Intergenic
1158267180 18:55672764-55672786 CTCGGTTATAGTGAGGAGAGAGG - Intergenic
1158837216 18:61343593-61343615 CTCAGGTACAGTGTGATGAGTGG - Intronic
1159703164 18:71655207-71655229 TTAGGATACAGTGGGAAGAAAGG - Intergenic
1168227136 19:55003757-55003779 CTCAGTTTCAGCGGGAAGAAGGG + Intergenic
926411887 2:12613296-12613318 CTGTGTTACAGTGGGAGGAAAGG + Intergenic
927701562 2:25272374-25272396 CTCAGTTACAGTGAAAAAAAGGG - Intronic
927780949 2:25939016-25939038 CTGGGTGACAGAGTGAGGAAGGG - Intronic
927839888 2:26433904-26433926 CTCTGTTACAGTGTGGAAAGTGG - Intronic
928467596 2:31537257-31537279 CAAGGTTACAGGGTCAAGAAAGG - Intronic
930980015 2:57513027-57513049 CATAGTTACACTGTGAAGAACGG - Intergenic
932771861 2:74504955-74504977 CTGAGTTTCATTGTGAAGAAGGG - Intergenic
932805367 2:74778495-74778517 CTCAACTACAGTGGGAAGAATGG - Intergenic
938471635 2:131568422-131568444 CTCTGTAACAGAGTGAAGAGAGG - Intergenic
938748508 2:134305013-134305035 CTTGGGTACGGTTTGAAGAAAGG - Intronic
940911021 2:159210129-159210151 CTCAGTTCCAGTTTGCAGAATGG + Intronic
945813348 2:214574284-214574306 TTGTGTTACAGAGTGAAGAAAGG + Intronic
948889902 2:240902440-240902462 CTCGGCTGCTGTGTGCAGAATGG + Intergenic
1170059772 20:12246811-12246833 CTCCATCATAGTGTGAAGAAAGG - Intergenic
1170735481 20:19010636-19010658 CTCAGTTCCAATGTTAAGAAAGG - Intergenic
1172784318 20:37456521-37456543 CTTGGTCCCAGAGTGAAGAAGGG - Intergenic
1183289522 22:36991071-36991093 CTCTACTCCAGTGTGAAGAAAGG + Intergenic
1184842335 22:47059298-47059320 CTCTCTTACAGCGTCAAGAAAGG - Intronic
952624080 3:35382835-35382857 CTTGGTTGCAATGTGGAGAATGG + Intergenic
955201298 3:56854498-56854520 CTCGGGTTCAGTGTGGGGAATGG + Intronic
959429322 3:106233150-106233172 TCTGGTGACAGTGTGAAGAATGG - Intergenic
959867182 3:111284083-111284105 CTCAGGTTCAGTATGAAGAAGGG - Intergenic
960543805 3:118889313-118889335 ATCAGCTACAGTGTGGAGAATGG + Intergenic
961881665 3:130065788-130065810 CTATGTGACAGAGTGAAGAAAGG - Intergenic
961980943 3:131077883-131077905 CTTGGTAACACTCTGAAGAAAGG - Intronic
962061579 3:131933191-131933213 CTCTGGATCAGTGTGAAGAATGG + Intronic
962452712 3:135533972-135533994 ATAGCTTACAGTGTGAAAAAAGG - Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
967534108 3:190582684-190582706 ACTGGTTACTGTGTGAAGAATGG - Intronic
967786560 3:193503195-193503217 CTCAGTCAGAGTCTGAAGAATGG + Intronic
967846662 3:194048578-194048600 TTTGGTTACAGTGTGAGGGATGG - Intergenic
969822246 4:9729689-9729711 CTATGTGACAGAGTGAAGAAAGG + Intergenic
970695667 4:18674021-18674043 CTTGGTTGCAGTGTGGAGAATGG + Intergenic
971959435 4:33466870-33466892 CTCGGTTTCATTGAGAAGGAAGG + Intergenic
972294490 4:37723624-37723646 CTGGCTCACAGTGTGAAAAAAGG - Intergenic
975222295 4:71826726-71826748 CTCGGTTCCACTGTGAAAAATGG - Intergenic
979433182 4:120657077-120657099 CTGGGCAACAGAGTGAAGAAAGG + Intergenic
981931129 4:150190340-150190362 CTGGGAAACAGTGTGAGGAAAGG + Intronic
983771735 4:171558346-171558368 CTCGGATAAACTGTGAAGGAAGG - Intergenic
984218673 4:176946238-176946260 CTTGGATACAGTGAGAGGAAGGG + Intergenic
986035500 5:3933310-3933332 CTCGGACACAATGTGGAGAACGG - Intergenic
988282863 5:29172874-29172896 CTCAGTTACAGTGTGACTATTGG + Intergenic
989544454 5:42656988-42657010 CAGGGTTACAGTGATAAGAAAGG - Intronic
993436918 5:87908412-87908434 CTCAGTTACTCTGTGAAGATAGG + Intergenic
994796345 5:104305621-104305643 TTTGGTGACACTGTGAAGAATGG - Intergenic
995365737 5:111358125-111358147 GTAAGTTACACTGTGAAGAATGG + Intronic
995544279 5:113214739-113214761 CTTGGCTACAGTGTGGAAAATGG - Intronic
996884045 5:128334736-128334758 CTGGGTTACTCAGTGAAGAAGGG - Exonic
997139610 5:131364632-131364654 CTGGGCTACAGTGTGCAGTATGG - Intronic
1003282605 6:4706973-4706995 CTTGGTTACAGTGTTCAGGATGG + Intronic
1003344113 6:5249846-5249868 GTGGGATTCAGTGTGAAGAAAGG + Intronic
1006825008 6:36928432-36928454 GGGGGTTGCAGTGTGAAGAATGG - Intronic
1008764766 6:54898347-54898369 CTCTGTTCAAGTGTGAAGCAGGG + Intronic
1011643213 6:89433685-89433707 CTCGCTTGCAGTTTGAAGGAAGG + Intronic
1011741605 6:90366182-90366204 CTCTATTACAGAATGAAGAACGG - Intergenic
1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG + Intergenic
1016912631 6:149214389-149214411 GTGGGTTGCAGTGTGGAGAATGG - Intergenic
1020070522 7:5223973-5223995 CTGGGTGAGAGTCTGAAGAACGG - Intronic
1020316600 7:6909810-6909832 CTATGTGACAGAGTGAAGAAAGG - Intergenic
1022251998 7:28617611-28617633 CTGGGTGAAACTGTGAAGAAGGG - Intronic
1022401287 7:30040599-30040621 CATGGTTGGAGTGTGAAGAAGGG + Intronic
1024611409 7:51067580-51067602 CTCTGTTACAGTGTGACTAGTGG - Intronic
1028586976 7:92461907-92461929 CTCTGGTACAGTGTGAACACAGG + Intergenic
1032895205 7:136242539-136242561 CCCGGTTACAGAGTGGAGTAAGG + Intergenic
1036579207 8:10057035-10057057 CTTGGTCACAGTGTGTAAAAGGG - Intronic
1038142921 8:24865813-24865835 CTCTGTTTGAGTGTAAAGAAAGG - Intergenic
1038743379 8:30235068-30235090 CTTGGTTACAGGAAGAAGAAGGG - Intergenic
1042289641 8:67155760-67155782 CTGGGTGACAGAGTGAAAAAAGG + Intronic
1043002535 8:74777250-74777272 CTTAGTGACAGTGTGAGGAAGGG + Intronic
1045044343 8:98260056-98260078 ATCACTTACAGTGAGAAGAAGGG + Intronic
1046200446 8:110920802-110920824 CTGGGATACAGTGAGAAGACTGG + Intergenic
1054811799 9:69441000-69441022 CTCGGTTTCAGCGTCCAGAATGG - Exonic
1059151511 9:111953598-111953620 CTCCATGACAGTATGAAGAATGG + Intergenic
1189718525 X:43890478-43890500 CTGGTGTACAATGTGAAGAATGG - Intergenic
1192596108 X:72410117-72410139 CTAGGTTACAATGGGAACAATGG + Intronic
1195334708 X:103840402-103840424 CTTGGTGAGAGTGTGAAGAAAGG + Intergenic
1196790166 X:119457545-119457567 CTCAGTTGCTGTGTGGAGAATGG + Intergenic
1198238149 X:134756436-134756458 CTAGGGTACAATGTGAAGTATGG + Intronic
1201406938 Y:13659038-13659060 CATGGTTACAGGGTCAAGAATGG + Intergenic