ID: 1115323662

View in Genome Browser
Species Human (GRCh38)
Location 14:32113383-32113405
Sequence CCCTCCCCTTGTTATATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115323657_1115323662 29 Left 1115323657 14:32113331-32113353 CCTTTGTAGCAGTGTCATTAATT 0: 1
1: 0
2: 0
3: 5
4: 158
Right 1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115323662 Original CRISPR CCCTCCCCTTGTTATATGTA TGG Intronic
906218446 1:44058591-44058613 CCATCGCCCTTTTATATGTAAGG + Intergenic
911453000 1:98089831-98089853 CCCTCCCTTTATTATAGATAAGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914911158 1:151788110-151788132 CCCTCCCTTCGTTATTTGCAGGG - Intronic
915179697 1:154047618-154047640 CCATCCCTTTGTTTCATGTAAGG + Intronic
916347419 1:163809523-163809545 CCTTCCCCTTCATTTATGTAGGG + Intergenic
916408949 1:164525739-164525761 CCCTCCCCCATTAATATGTAGGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
923666642 1:236004076-236004098 CCCTCCCTTTGTTAGATCTGAGG - Intronic
923913760 1:238480087-238480109 CCCTCCCCTTCCTGTATGGAAGG + Intergenic
1064054978 10:12089583-12089605 CGCTTGTCTTGTTATATGTATGG - Intronic
1066077726 10:31897138-31897160 CCCTCCCCTTGTCAGAGCTATGG - Intronic
1068870563 10:61939325-61939347 GCCTCCCTTTGTTCCATGTATGG + Intronic
1071046346 10:81383974-81383996 CTCTACCCTTCTTTTATGTAAGG + Intergenic
1074157259 10:110809951-110809973 GCCTCCGCTTTTTATATCTATGG - Intronic
1074321143 10:112403732-112403754 CCCTTCCCTTATTATATTTTAGG + Intronic
1077770006 11:5207071-5207093 CCCTCCCATTGCTATAAGGATGG + Intergenic
1078496090 11:11818661-11818683 CCCTCCCCTTGCTCTATCTCTGG + Intergenic
1080851837 11:36077299-36077321 CCCTTCTCTTCTTATATGGAGGG + Intronic
1081299797 11:41436867-41436889 CTTTCCCCTTCTTAAATGTAGGG - Intronic
1085826242 11:79850876-79850898 TCCTCCCCTTGTGCTAAGTAAGG - Intergenic
1086057321 11:82662098-82662120 TCCTTCCCTTGTTGTATTTAAGG - Intergenic
1086369668 11:86143809-86143831 CCCTCCCCTGGTCATATGTTAGG - Intergenic
1089943488 11:122443249-122443271 CCCTTCTCTTGTTAGATGTGTGG - Intergenic
1098270800 12:68768320-68768342 CCCTCCCCAAGTTCTATTTACGG - Exonic
1104527168 12:129534979-129535001 GCCTCCCCTTGTTATATAATTGG - Intronic
1105293126 13:19066354-19066376 CCATACCCTTGTGATATTTATGG - Intergenic
1105314671 13:19246231-19246253 CTCTCACTTTGTTCTATGTAAGG + Intergenic
1106285139 13:28312156-28312178 CCCTCCCTTTGTAGTACGTAAGG - Intronic
1106469285 13:30040211-30040233 TCCTCCCCCTTTTGTATGTAGGG - Intergenic
1110448725 13:75617634-75617656 TCCTCCCCTTTTTATAGGCAGGG + Intergenic
1111905861 13:94255570-94255592 CCCTCCTCTTTTTCTATCTAAGG + Intronic
1112737058 13:102431961-102431983 CCAACCCCTTATTAGATGTATGG + Intergenic
1113304363 13:109060695-109060717 CCCTCCCTTTGCTATATAAATGG - Intronic
1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG + Intronic
1118058635 14:62110395-62110417 CTATCACCTTGTCATATGTATGG - Exonic
1119596124 14:75935721-75935743 TCCTCCCCTTTTTATATGAAGGG - Intronic
1120444165 14:84572568-84572590 CCCTTACCTTTTTATCTGTAGGG + Intergenic
1128691939 15:69731316-69731338 CCCTCCCCTGCTTCTATGTGTGG + Intergenic
1134145864 16:11761240-11761262 CCTTCCCTTTAGTATATGTATGG - Intronic
1135059726 16:19260929-19260951 CCCTCTCCATGTTATAGGTAAGG - Intronic
1136300487 16:29331216-29331238 TCCTCCTCTTGTTCTTTGTAGGG + Intergenic
1141262326 16:82465027-82465049 CTCTCTCCTTGTTATCTGGATGG + Intergenic
1147481994 17:40774709-40774731 CCCTTCTCTTGTTATAGGGAAGG + Intergenic
1147557574 17:41489175-41489197 CCCTCCCCTTGCTGTAGGAAGGG - Intronic
1149421543 17:56515580-56515602 CACTACCCTTGTTGTTTGTAAGG - Intergenic
1150511951 17:65763177-65763199 ACCTCTCCTTTTTATACGTAAGG + Intronic
1152496583 17:80676975-80676997 CCCTCACCTTTCTATATGTTTGG - Intronic
1157346309 18:46838328-46838350 CCATCCCCATGTTATAAATAAGG + Intronic
1162407771 19:10485991-10486013 CCATCGCATTTTTATATGTAGGG - Intergenic
925937397 2:8778116-8778138 ACCTCCCCATCTTATTTGTATGG - Intronic
928382738 2:30834056-30834078 ACCTCCACTTGTTATAATTAAGG - Intergenic
931813803 2:65880510-65880532 CACTCCCCTAGTTGTATATACGG + Intergenic
932530383 2:72523962-72523984 CCCTTCCCTTGTTCTTTGTATGG - Intronic
933011000 2:77063255-77063277 GCCTCCCCTTGTTCTTTTTATGG + Intronic
937257274 2:120564465-120564487 CCCTCCTCTTGTTTAATGTACGG - Intergenic
1169545267 20:6643665-6643687 TCCTCCCCTTATTATAGATATGG + Intergenic
1170557383 20:17525694-17525716 CCCTCCCCTTGTTCCCTATAAGG + Intronic
1172358160 20:34293974-34293996 CTCTCCCTTTCTGATATGTAAGG + Intronic
1173643908 20:44621961-44621983 CCCTCCCCTTCTCATATGCCTGG + Intronic
1178240034 21:30888769-30888791 ACCTCCCCTTGGTATCTGGATGG - Intergenic
949198378 3:1340885-1340907 CTCTCACCTTTTTATATGTGAGG + Intronic
950269779 3:11604702-11604724 CCAGCCCCTTGTTGTATGGAGGG - Intronic
954156903 3:48690461-48690483 CCCTCCCCTTTGTAGAGGTAAGG - Intronic
954256364 3:49410036-49410058 CTCTCCCCTTGTTAACTGGATGG - Intronic
954821437 3:53332501-53332523 ACCTCCCCTTGTTCTTTTTATGG + Intronic
954958837 3:54546964-54546986 CCCTCCTCTTGTCATATAAATGG - Intronic
959159471 3:102706188-102706210 CCATTGCCTTGTTATATGTCTGG + Intergenic
959474412 3:106791249-106791271 CCCTCCCCTTTTCATAGGCAGGG - Intergenic
962640269 3:137378206-137378228 CACTTCCCTTGTTAGCTGTATGG + Intergenic
965499252 3:169438052-169438074 TCATCCCCATTTTATATGTAAGG + Intronic
967194893 3:187017563-187017585 CCTTCCCCTTTTTCTTTGTAGGG + Intronic
967452836 3:189646262-189646284 CCCTCCCCTTGTCAGTTGTATGG - Intronic
975663293 4:76708543-76708565 CCCTCCCCTGGTTATACCAATGG + Intronic
981603540 4:146519015-146519037 CCCTCCACTTGTTCGATATATGG + Intronic
985034573 4:185825063-185825085 CCCTCCCCTGGGTATAGGTCAGG + Intronic
985197971 4:187452321-187452343 CCCTCTCCTTGTCATGTGGATGG + Intergenic
985866557 5:2518789-2518811 CTTTCCCCTTGTTATGTTTATGG + Intergenic
987630127 5:20459554-20459576 CCTTCCCCTTGTGAAATGAAGGG - Intronic
990354890 5:54957290-54957312 CCCTCCTGTTGATATATGTCTGG - Intronic
993628923 5:90260073-90260095 CCCTCCCCATGTTCCCTGTAGGG - Intergenic
997600696 5:135136427-135136449 CCCTTCCCTGGTGATCTGTAAGG - Intronic
998198439 5:140097132-140097154 CCCTCCCCTTCTTATATTGCAGG - Intergenic
1000073476 5:157763130-157763152 CTATCCCCTTGATATATGTGAGG + Intergenic
1001303331 5:170553701-170553723 CCCTCTCCTTCTTACTTGTAAGG - Intronic
1003459490 6:6317262-6317284 TCATCCCCATGTTATATGTTAGG - Intronic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1004942972 6:20580638-20580660 CCCTCTCCAGGTTATAAGTAAGG + Intronic
1013612877 6:111811606-111811628 CCCTACCCTCATCATATGTAAGG - Intronic
1024293507 7:47824631-47824653 CCTTTCCCTTGTTTTATTTAGGG + Intronic
1029960067 7:104681208-104681230 ATCTCCCCTTGTAAAATGTAAGG + Intronic
1033227439 7:139572916-139572938 CCCTCCAGTGTTTATATGTAAGG + Exonic
1033658351 7:143388023-143388045 CCCTTCCCCTGTTATTTGTGTGG + Intronic
1037275109 8:17169739-17169761 CTCTCCCCTCATTTTATGTATGG - Intronic
1038961491 8:32525151-32525173 CCCTCTCCTTGTGAAAGGTAGGG + Intronic
1040352210 8:46581019-46581041 CCCTTCCCTTGTGATCTTTATGG + Intergenic
1040743085 8:50604522-50604544 CCCTCCCCTTTTTACAGGCAGGG + Intronic
1042161322 8:65898840-65898862 CCCACCCATTGTTTTATGTCTGG + Intergenic
1043826505 8:84935999-84936021 CCCTCCACTTGTTAAATCTGTGG + Intergenic
1048027200 8:130597607-130597629 CCATCCCCTTGTTACTTGAAGGG - Intergenic
1056701692 9:88916477-88916499 CCCTTCCCTTGTTCTCTGGAAGG + Intergenic
1056719054 9:89057952-89057974 GCCTCCCCTTCCTATATGTTTGG - Intronic
1058406846 9:104686385-104686407 ATTTCCACTTGTTATATGTAGGG + Intergenic
1186444152 X:9611826-9611848 CCATCCCCATTTTATATGTGAGG + Intronic
1187111679 X:16308244-16308266 CCCTCTCATTGTTTTATATAAGG + Intergenic
1193085683 X:77446709-77446731 CCCTCCCCTTGGAATCTGCAAGG + Intergenic
1196505263 X:116434783-116434805 CCCTTGCCTTGTGATATGTTTGG + Intergenic
1198273386 X:135077179-135077201 CCCTCACGATTTTATATGTATGG + Intergenic