ID: 1115324657

View in Genome Browser
Species Human (GRCh38)
Location 14:32126304-32126326
Sequence CTAGAGTCTCAGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 2, 1: 0, 2: 18, 3: 56, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115324657_1115324664 12 Left 1115324657 14:32126304-32126326 CCATGTTCCCTCTGAGACTCTAG 0: 2
1: 0
2: 18
3: 56
4: 310
Right 1115324664 14:32126339-32126361 TGCCTCTTTCTTGCTTCTGGTGG 0: 1
1: 10
2: 111
3: 303
4: 1325
1115324657_1115324666 15 Left 1115324657 14:32126304-32126326 CCATGTTCCCTCTGAGACTCTAG 0: 2
1: 0
2: 18
3: 56
4: 310
Right 1115324666 14:32126342-32126364 CTCTTTCTTGCTTCTGGTGGTGG 0: 1
1: 4
2: 35
3: 114
4: 565
1115324657_1115324667 29 Left 1115324657 14:32126304-32126326 CCATGTTCCCTCTGAGACTCTAG 0: 2
1: 0
2: 18
3: 56
4: 310
Right 1115324667 14:32126356-32126378 TGGTGGTGGCTGTCAATCCCTGG 0: 1
1: 5
2: 20
3: 119
4: 372
1115324657_1115324663 9 Left 1115324657 14:32126304-32126326 CCATGTTCCCTCTGAGACTCTAG 0: 2
1: 0
2: 18
3: 56
4: 310
Right 1115324663 14:32126336-32126358 CCTTGCCTCTTTCTTGCTTCTGG 0: 1
1: 12
2: 101
3: 297
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115324657 Original CRISPR CTAGAGTCTCAGAGGGAACA TGG (reversed) Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900496914 1:2979870-2979892 CGAGATTCTCAGTGGGAAGAGGG + Intergenic
900502068 1:3011257-3011279 CCAGAGTCTCAGAGGGAGCAGGG - Intergenic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
904887004 1:33746368-33746390 CTAAAGTTTCAGAGGGAAGATGG + Intronic
905184498 1:36186806-36186828 CTAGAGATTGAGAGGGAGCATGG + Intergenic
905269667 1:36779273-36779295 TCAGAGAGTCAGAGGGAACATGG - Intergenic
905656378 1:39688630-39688652 CTAGAGTTTCAGGGGGCCCATGG - Intronic
905844636 1:41218520-41218542 CCAGAGTCTCTGAGGGAGCATGG + Intronic
906010116 1:42515274-42515296 CCAGAGTCTCAAAAGGAATATGG + Intronic
906807373 1:48792287-48792309 CCAGAATCTCAGTGGGAGCATGG + Intronic
907664876 1:56425967-56425989 CTACAGTCTAGGAGGGAAAATGG - Intergenic
908626717 1:66052835-66052857 CTGGATTCTCAGAGGAAACCTGG - Intronic
911243853 1:95495540-95495562 CTAGAGTCTTTGAGGGAGTAAGG - Intergenic
911256961 1:95644328-95644350 CGAGAGTCTTAGAGGGAACATGG - Intergenic
911276195 1:95862057-95862079 CTGGAGTCTCAGTGTGGACAAGG - Intergenic
912167562 1:107057956-107057978 CTAGAGGCTATGAGGGAAAAGGG - Exonic
912244795 1:107950191-107950213 TTAGAATCTCAGAGAGAACCAGG - Intronic
912403085 1:109412474-109412496 CTAGAGTCTTTGAGGGAAAGAGG - Intronic
912591666 1:110827378-110827400 CCAGAGTTTCAGAGGGATCATGG - Intergenic
913075746 1:115338929-115338951 CTACAGTTTCAGAGGGGCCAAGG - Intergenic
913220240 1:116654323-116654345 CTGCAGTCTCAGAGGGCTCACGG + Intronic
915122773 1:153641685-153641707 ATAGATTCTCAGAGGAAAAATGG + Intronic
916413623 1:164572585-164572607 CTAGTGTGACAGAGGGAGCATGG + Intronic
916501300 1:165389639-165389661 CTAGAGACCCAGAGGGCAAAGGG - Intergenic
917581661 1:176384645-176384667 CCATAGTCCCACAGGGAACATGG - Intergenic
917975938 1:180237648-180237670 CCAGACTGACAGAGGGAACAGGG - Intronic
919131239 1:193453173-193453195 CTAGAGACTCAGAGGGAGTCAGG + Intergenic
919407362 1:197201502-197201524 CTAGGGTCTCCGAGGGAGTACGG - Intergenic
919661381 1:200251299-200251321 CAAGTGTGTAAGAGGGAACAAGG - Intergenic
920833634 1:209487678-209487700 CCAGAGTCTCAGAGGAAGCAGGG + Intergenic
921251887 1:213305872-213305894 CTAGATTCTCAGAAGTTACAGGG - Intergenic
921252911 1:213314035-213314057 CTGGAGTCTCGGAGGAAGCAGGG - Intergenic
922173713 1:223178564-223178586 CTAAAGCATCAGTGGGAACAGGG + Intergenic
923149974 1:231224204-231224226 CTAGAGTCGCACAGGGTCCAGGG + Exonic
923311229 1:232737397-232737419 GCAGAGTCCCAGAGGGAGCACGG - Intergenic
923889521 1:238196971-238196993 TCAGAGTCTCAGATGGAGCATGG + Intergenic
924091154 1:240502341-240502363 CAAGAGTTTCAGAGGAAAAAGGG - Intronic
924635957 1:245788088-245788110 CTAGATTAGCACAGGGAACAGGG + Intronic
1063178369 10:3572152-3572174 AGAGAGTCTCATAAGGAACATGG + Intergenic
1063751765 10:8957207-8957229 CCAGTGTCTCAGAGGAAGCATGG - Intergenic
1064824964 10:19388064-19388086 CCAGAATCTAAGAGGGGACATGG - Intronic
1065038878 10:21670582-21670604 CTAGAGGGTCAGAGGGCAAAGGG + Exonic
1065191245 10:23211150-23211172 CCAGGGTCTCAGGGGGAGCATGG - Intronic
1065602306 10:27381775-27381797 CAAGAGTCAAAGAGGGGACAAGG - Intergenic
1065984174 10:30932971-30932993 CATGAGCCTCTGAGGGAACATGG + Intronic
1067047834 10:42995683-42995705 CCCGAGCCTCAGAGGGAGCATGG - Intergenic
1067138132 10:43629781-43629803 CTACAGTTTCAGAGGGAGCACGG + Intergenic
1070478798 10:76858792-76858814 CTAGGGTCTCAGAGACAGCATGG - Intergenic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1071688709 10:87792244-87792266 CTAGACTCCCAGAAGGAAAATGG - Intronic
1074824675 10:117206219-117206241 CTAGAGCCTTAGAGGGAGTATGG - Intronic
1074933807 10:118157810-118157832 CTAGAGCCTCAAAGGCAGCATGG + Intergenic
1074966985 10:118499965-118499987 TCAGACTCTCAGAGGGAACGTGG + Intergenic
1075512621 10:123084597-123084619 CCAGAGTCTCCGAGGGAACAAGG + Intergenic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1078562204 11:12382668-12382690 TTAGAGTCCAAGAGAGAACAAGG + Intronic
1080113809 11:28599424-28599446 CTGGAGTCTTAAAGGGAAAATGG + Intergenic
1080657405 11:34268730-34268752 CCAGGGTCCCAGAGGAAACAGGG - Intronic
1081048702 11:38310546-38310568 CTAGAGCCTCAGAAGGAGCGTGG + Intergenic
1081635415 11:44718343-44718365 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
1083160073 11:60849230-60849252 CTAGAGTCTCAGTGTGCCCAAGG + Intronic
1083652380 11:64211019-64211041 CTAGGGTCTCAGCGGGGACTAGG - Intronic
1084408777 11:68994115-68994137 CTAGAGCCTCAGGGGGCGCATGG + Intergenic
1084591264 11:70092042-70092064 CTGGAGTCTTAGAGGGAGCGCGG - Intronic
1084836848 11:71808180-71808202 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1087076439 11:94130443-94130465 CTGGAGTCTGAGAGTGAATATGG + Intronic
1088500912 11:110481307-110481329 CCAGAATCTCAGAGGGAGGATGG + Intergenic
1089003216 11:115069159-115069181 CCCGAGTCTCAGAGGGACCATGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1089633318 11:119796778-119796800 CTAGAGACCCAGGAGGAACAGGG - Intergenic
1091611525 12:2014536-2014558 TTAGAGTCTCACGGGGAAAATGG + Intronic
1092140800 12:6182178-6182200 CACGAGTCACAGAGGCAACAGGG + Intergenic
1092402386 12:8187924-8187946 CTTGACTCTCAGAAGGACCAAGG - Intronic
1094303447 12:28991933-28991955 TCAGAGTCTCGGAGGGAAAAAGG - Intergenic
1096649774 12:53056455-53056477 CCCGAGTCTCAGATGGAGCAAGG - Intronic
1096705484 12:53418953-53418975 TTAGAGTTTAAGAGGGAAAAGGG - Intergenic
1097160958 12:57046453-57046475 GTAGGGGCCCAGAGGGAACAGGG + Intronic
1097485238 12:60188844-60188866 TTAGAGTCTTAGAGAGAACAGGG + Intergenic
1098097931 12:66979887-66979909 TAAGAGTCTCAGAGGGAACCTGG + Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100480894 12:94977882-94977904 ATGGAGTATGAGAGGGAACAGGG + Intronic
1103166926 12:118778302-118778324 CTAGAGCCTCTGAGGGAACATGG + Intergenic
1103280202 12:119751482-119751504 CTAGTCTCTCAGAAAGAACAAGG + Intronic
1103341821 12:120224904-120224926 CTAGAGCCTCAGGAGGAACCTGG - Intronic
1103678175 12:122673012-122673034 CATGAGTCTCTCAGGGAACAGGG - Intergenic
1103916968 12:124380704-124380726 TCAGAGTCTCGCAGGGAACAGGG + Intronic
1104373388 12:128243618-128243640 AGAGAGTCTCAGAGGGTCCATGG - Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104428523 12:128697431-128697453 CCAGAGGTTCAGAGGGAGCAGGG + Intronic
1104528466 12:129547072-129547094 CTAGAGCCCCAGAGGAAGCAAGG - Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1107199894 13:37702009-37702031 CCAGAGTCTCAGAGAAAGCATGG - Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1109107392 13:58272512-58272534 TTAGAGCCTCAAAGTGAACAGGG - Intergenic
1109411128 13:61970971-61970993 CCAGAGTTTCAGTGGGAGCATGG - Intergenic
1110098377 13:71561552-71561574 CTAGTATCTCAAAGGGAGCATGG + Intronic
1110535586 13:76647237-76647259 CCAGATTCTCAGAGGGAGCATGG + Intergenic
1111973405 13:94940642-94940664 CCAGAGTCTCAGAGTGAGCATGG + Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1112821619 13:103344486-103344508 TTAGAGTTTCAGAAGGAAAAAGG - Intergenic
1113140577 13:107144355-107144377 CAAGAGGCTCAGAGGGAGCATGG + Intergenic
1114182342 14:20377493-20377515 CTAGAGAATGAGAGAGAACAAGG + Intronic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115932607 14:38513836-38513858 CCAGAGTCTCAGAGCAACCATGG - Intergenic
1116627771 14:47287990-47288012 CCAGAATCTCAGAGGGATGATGG + Intronic
1116768826 14:49103673-49103695 CTAGATTCTAAGAAGGAAAAAGG - Intergenic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1120419000 14:84258752-84258774 TCAGAGTTTCAGAGGGAGCATGG - Intergenic
1121512642 14:94523656-94523678 CCAGAGTCTCAGAAGGAGCGTGG - Intergenic
1121578769 14:95010652-95010674 CTTGAGTCCCAGGGGGAAGAAGG + Intergenic
1121998709 14:98628032-98628054 CTAAAGTCTCAGAGGGAGCATGG + Intergenic
1122031943 14:98918803-98918825 CCAGATTCTCAAAGGGCACAAGG + Intergenic
1124292642 15:28467655-28467677 CCAGAGTCACAGATGGAAAAGGG + Intergenic
1124620982 15:31273779-31273801 CTACAGTCTCAAAGGGAAAGAGG + Intergenic
1127708208 15:61567981-61568003 CTAGAGACTCCAAGGGAACCAGG - Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1130712006 15:86292592-86292614 CTAGTGTCTCAAAGGGCAGAGGG + Intronic
1132103250 15:99043159-99043181 CCAGAGTTACAGAGGGAGCATGG + Intergenic
1132298711 15:100763458-100763480 ACAGAGTCTCAGAGGAAAAAGGG + Intergenic
1134101406 16:11454616-11454638 CCAGAGCCTTAGAGAGAACATGG + Intronic
1134670541 16:16051722-16051744 CTAGACTCCCAGAGGGAAAGCGG + Intronic
1135134998 16:19880923-19880945 CTAGACACTCGGAGGGGACATGG - Intronic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1139274683 16:65716596-65716618 CTAAAGACTCAGTGGGAACAAGG + Intergenic
1140294564 16:73695790-73695812 CTAGAGTCAGACAGGGAAGAGGG - Intergenic
1140668272 16:77248066-77248088 CTAAAGTCCAAGAGGGAGCAAGG + Intronic
1140770203 16:78196642-78196664 CCAGAGTCTCAGTGGAGACAAGG - Intronic
1141162856 16:81640609-81640631 CTAGAGTCTCAGAAGCAATGTGG - Intronic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1142364716 16:89644158-89644180 CCAGAGGCTCAGGGGGACCACGG + Intergenic
1142837576 17:2599685-2599707 TTATATTCTCTGAGGGAACAGGG + Intronic
1143003356 17:3809990-3810012 CCAGAGGCTAAGAGGGAAGAGGG + Intergenic
1143542947 17:7580373-7580395 ATATAGGCTCAGAGGGAAGAAGG + Intronic
1144171593 17:12664517-12664539 CTAGATCCCCAAAGGGAACATGG + Intergenic
1145238772 17:21227309-21227331 CCAGAGCCTCTCAGGGAACACGG - Intergenic
1145732642 17:27203099-27203121 ATTGAGACTCACAGGGAACAGGG - Intergenic
1147453136 17:40518717-40518739 TGAGAGTGTGAGAGGGAACAGGG + Intergenic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1148390044 17:47265395-47265417 CCAGAGTCTCAGAGGGACCATGG - Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150375650 17:64679313-64679335 CCAAAGTCTCAGAGGGAGCGTGG + Intergenic
1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG + Intergenic
1152256535 17:79243276-79243298 CTGGAGTGTCAGAGTGAGCAGGG + Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1153712735 18:7816261-7816283 CTAGAGTCTCAGAGTTCATATGG + Intronic
1154492731 18:14933907-14933929 CTGGAGTCTGAGAGGAGACAGGG - Intergenic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1156432507 18:37091581-37091603 CTTGAGTCTCAGTGGGTACATGG - Intronic
1157366697 18:47071395-47071417 GAAGAGTGTCAGGGGGAACAGGG + Intronic
1158061271 18:53346382-53346404 TTATAGTCTCAGAGGGAATGTGG - Intronic
1158447335 18:57532785-57532807 GAAGAGACTCAGAGGGAAGACGG - Intergenic
1159434174 18:68394666-68394688 CTAGATCCTCGGAGGGAGCATGG - Intergenic
1160394129 18:78559499-78559521 CCAGAGTCTCAGAAGCAGCATGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1162602804 19:11682022-11682044 CCACACTCTCAGAGGGAAAATGG + Intergenic
1162691200 19:12433710-12433732 CCAGACTCTCAGAAGGAAGATGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167047957 19:47062268-47062290 CTAGAGCCTCAGAGGCAGCCTGG + Intergenic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
925307735 2:2861997-2862019 CCAGAGTGGCAGAGGGAGCACGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926230979 2:11003574-11003596 CCAGAGCTTCAGAGGGACCAGGG + Intergenic
926357599 2:12055893-12055915 CCAGAGTCTCAGCGGGAGCATGG - Intergenic
928224839 2:29439831-29439853 CCAGAGTCTCAGAGAGAACATGG + Intronic
929210454 2:39351185-39351207 TTAGAGCCTGAGAGGGAAAAGGG - Intronic
929898575 2:45982596-45982618 TGAGAGTCACAGAGAGAACATGG - Intronic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932228648 2:70063876-70063898 GTAGAGTGTAAGAAGGAACAGGG - Intergenic
936265306 2:111000593-111000615 CCAGGGTCTCAGAGGGAGCAGGG - Intronic
938418848 2:131127231-131127253 CCAGCATCTCAGAGGGAGCAAGG - Intronic
939475532 2:142681535-142681557 CTAGAGGCACAGAGGGACGAAGG + Intergenic
939600831 2:144188060-144188082 CTAGAGCCTCAGAGGGAGTGTGG + Intronic
940044768 2:149398015-149398037 CTAGAATTAAAGAGGGAACACGG + Intronic
941230488 2:162905735-162905757 CCAGAGTCTCAGAGGGACTGTGG + Intergenic
941307248 2:163885521-163885543 CCAGAGTCTCAAAGGGAGCATGG - Intergenic
945580425 2:211587550-211587572 CTAGAGACTTAGAGGGAGCATGG + Intronic
945917367 2:215718030-215718052 CCACAGTCTGAGAGGGAAAAGGG + Intergenic
946078425 2:217095548-217095570 AAGGAGTCTCAGAGGGAACATGG + Intergenic
946123195 2:217534691-217534713 GGAGAGTGCCAGAGGGAACAAGG - Intronic
946304424 2:218847586-218847608 CTAGAGTCCCCAAGGGAAGATGG + Intergenic
946493328 2:220171097-220171119 CCAGAGCCTCAGTGGGAGCACGG + Intergenic
946612105 2:221470144-221470166 CCAGAGAGTCAGAGGAAACATGG + Intronic
947380431 2:229540217-229540239 GTAGAGACTCAGGGGGAGCAGGG + Intronic
1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG + Intronic
1170354150 20:15473992-15474014 CTAGACTCACAGAGCTAACAGGG - Intronic
1171037954 20:21731529-21731551 CCAGAGTCTCAGAGGGAGCCTGG + Intergenic
1172029597 20:31972553-31972575 CTACAGGGTCAGAGGGGACAGGG - Intronic
1172909283 20:38394576-38394598 CCAGAGTCTCAAAGGGAGCATGG + Intergenic
1173104344 20:40118924-40118946 CCAGAATCTCAGAGGGAAAGTGG + Intergenic
1173352878 20:42261152-42261174 CCACAGTCTCAGAAGGACCATGG - Intronic
1176236366 20:64055599-64055621 GATGAGGCTCAGAGGGAACAAGG + Intronic
1176423687 21:6534840-6534862 CTAGAATCTCAGAGGGGGCGCGG - Intergenic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1176965438 21:15207209-15207231 CCAGGGTCTCAGAGGGAGCGGGG + Intergenic
1177535675 21:22423857-22423879 ATAGGGCCTCAGAGGGGACATGG - Intergenic
1178717973 21:34984120-34984142 CCAGATTCACAAAGGGAACAAGG + Intronic
1179419390 21:41223432-41223454 CTGGAGTCTCAGAGGATGCATGG - Intronic
1179593852 21:42429197-42429219 CTAGAATGTCAGAGGGAGCATGG + Intronic
1179699180 21:43143155-43143177 CTAGAATCTCAGAGGGGGCGCGG - Intergenic
1180821540 22:18832342-18832364 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181191438 22:21143703-21143725 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1181207760 22:21266807-21266829 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181430999 22:22881723-22881745 TTAGTGTCTCAGAAGGCACAGGG + Intronic
1182294398 22:29304687-29304709 CTGGAGCCTCAGAGGAAACCAGG - Intergenic
1182297455 22:29318205-29318227 TGAGAGTCTCCTAGGGAACATGG - Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1183237698 22:36631888-36631910 CTAGAGTCTGAGGTGGAAAAAGG + Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1203219160 22_KI270731v1_random:28609-28631 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1203271665 22_KI270734v1_random:58218-58240 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949327131 3:2879310-2879332 CCAGAGTCTCAAAGGGTGCATGG + Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950131069 3:10547073-10547095 GTAAAGTCTCGGAGGGCACAGGG - Intronic
950390208 3:12690595-12690617 CCAGAGTCTGAGAGGGAACGTGG + Intergenic
950917259 3:16658608-16658630 CAAGAGTCTCAAAGAGAATAGGG + Intronic
952101435 3:30017644-30017666 CTAGAACCTCAGAGGGAGCATGG + Intergenic
952540415 3:34361567-34361589 GCAGACTCTCAGAGGGAAGATGG - Intergenic
953373413 3:42408518-42408540 ATAGGGGCTCAGAGGGAAAATGG - Intronic
954859683 3:53677114-53677136 CTAGATTCCCAGGGGGACCATGG + Intronic
954962820 3:54581000-54581022 CTAGAGTGTCAGCAGGACCAAGG + Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956707079 3:72008307-72008329 CCAGAGTTTCAGAGGGAACATGG + Intergenic
957037263 3:75305901-75305923 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
957219016 3:77358191-77358213 CTAGAGTCTCCAAGAGAACATGG - Intronic
957717409 3:83946634-83946656 CCAGAGTCTCAGAAGAACCATGG - Intergenic
959138183 3:102451656-102451678 CCAGACTTTCAGAGGGAGCATGG - Intronic
959146709 3:102555443-102555465 CTAGAGGCTGTGAGGTAACAGGG + Intergenic
959850864 3:111084960-111084982 CCAGAGTTTCAAAGGGAACATGG - Intronic
961081095 3:124029032-124029054 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
962875854 3:139535632-139535654 CTGGGGTCGCAGAGGCAACAAGG - Intronic
964417352 3:156461291-156461313 CCAGAATGTCAGAGGGAGCATGG - Intronic
964621053 3:158720515-158720537 CCAGAGTCTCAGAGGAAGCATGG - Intronic
964919063 3:161873664-161873686 TTAGTGTCTCAGAGGGAAAAAGG - Intergenic
967119257 3:186368178-186368200 GTAGAATCTCAGAGACAACAGGG - Intergenic
967660917 3:192108867-192108889 CCAGAATCTTAGAGGGAGCATGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
969087171 4:4665169-4665191 CAAGAGCTTCAGAGGGAACATGG - Intergenic
969718453 4:8879844-8879866 CTAGAGCCTCAGAGAGAGCCTGG + Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
971716651 4:30186545-30186567 CTAAAGTCTTAGATGAAACATGG + Intergenic
971768988 4:30871790-30871812 CCAGAGTCTCAGAGTGACCATGG - Intronic
973194340 4:47422521-47422543 ATAGTGTTTCAGAGAGAACAGGG - Intronic
973540883 4:51934491-51934513 CTTGAGTCTCTCAGGGAGCAGGG + Intergenic
974276656 4:59729183-59729205 CTAGAGACTCAGAGTGATCTTGG - Intergenic
975531902 4:75408054-75408076 CTAGATTCTCTGTGGTAACAAGG - Intergenic
976784447 4:88802114-88802136 CTAGACTATAAGAGAGAACAGGG + Intronic
976876621 4:89861213-89861235 ATAGATTCACAGAGGGATCATGG + Intergenic
981009688 4:139912798-139912820 GCAGAGTCTCAGAGGAAGCACGG + Intronic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
982524276 4:156457531-156457553 CCACAGTCTCAGAAGAAACATGG + Intergenic
982924850 4:161322731-161322753 CTAGAGTTTAAGAGATAACATGG - Intergenic
983911327 4:173242781-173242803 CCAGAAATTCAGAGGGAACAAGG - Intronic
984473694 4:180211140-180211162 TTAGAGTTTCAGAGAGAGCATGG - Intergenic
985241172 4:187932297-187932319 CAGGATCCTCAGAGGGAACATGG + Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986545741 5:8894872-8894894 GTAGAGGCTCAGAGGGAAAAGGG - Intergenic
986920944 5:12679637-12679659 CTAAGGTTTCAGAGGGAGCATGG - Intergenic
987212665 5:15699309-15699331 CCACAGTCTCAGAGGGACCTTGG - Intronic
988846246 5:35130975-35130997 CCAGCATCTCAGAGGGAGCATGG + Intronic
989255525 5:39362458-39362480 CCAGAGTATCGGAGGGAGCACGG + Intronic
992263308 5:74992290-74992312 CCAGAGTCTCGGAGGGAGCATGG - Intergenic
992571188 5:78059303-78059325 CTAGAGCTCCAGAAGGAACATGG + Intronic
993565906 5:89475101-89475123 TAATAGTCTCAGAGGCAACATGG + Intergenic
993715957 5:91276091-91276113 CCAGAGTTTCAGAAGGAACATGG + Intergenic
995269020 5:110199796-110199818 CCAGAGTGTCAGAGGGAGCATGG + Intergenic
995601046 5:113796549-113796571 GTAGTGTCTCAGAGGGCATAAGG - Intergenic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
997438911 5:133895144-133895166 CCAGGGTCTCAGAGGAAACATGG - Intergenic
998278715 5:140783778-140783800 CTTGAGTCTCAGATGGGACTTGG + Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999003610 5:147951517-147951539 CTAGAGCCTGGGAGGGATCAGGG - Intergenic
999686297 5:154106195-154106217 GGAGGGTCTCAGAGGGAGCATGG + Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000177407 5:158770895-158770917 CTAAAGACTAAGAGGGAAAATGG - Intronic
1000254932 5:159528643-159528665 CTCGTGTCTCAGAGGTACCAGGG + Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000927494 5:167211640-167211662 CTATAGTCTCAGAGGGCAGTGGG + Intergenic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1002366961 5:178720587-178720609 GCAGAGTCTCAGAGGGAGCGGGG + Intronic
1002411210 5:179078215-179078237 ATAGAGTTTCAGAGAGAGCATGG + Intronic
1003267430 6:4578277-4578299 CTAGAGTCTCTCAGTGAACAGGG - Intergenic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004128422 6:12896607-12896629 CTAGAATCTCCCGGGGAACAGGG - Intronic
1004300475 6:14453093-14453115 CTAGAGGCTCAGTGGGGGCATGG + Intergenic
1006891971 6:37436533-37436555 CAAGAGCCTTTGAGGGAACATGG - Intronic
1010852252 6:80791921-80791943 ATAGAATCTCAGAGGTAAAAAGG + Intergenic
1011109527 6:83821705-83821727 TTAGAGTCTCATAAGGAGCACGG + Intergenic
1015286627 6:131492600-131492622 TATGAGTTTCAGAGGGAACATGG + Intergenic
1015498019 6:133901089-133901111 CTAAAGCCTCCAAGGGAACATGG + Intergenic
1015729691 6:136335143-136335165 CCAGAGCCTCAGAGGGAGCAGGG - Intergenic
1016134487 6:140522825-140522847 TTAGAGTCTCAGAGGGTATATGG - Intergenic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017564420 6:155668762-155668784 CTAGAGTCCTAGAGGGCACTGGG + Intergenic
1017946625 6:159101328-159101350 ATAGAATCACAGAGGGAAAATGG - Intergenic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1020117448 7:5483781-5483803 CCAGAGTCTCAGTGGGTGCAAGG + Intronic
1021233775 7:18117693-18117715 CCAGAGTCTGAGAGGGAGCGTGG + Intronic
1021673631 7:23058563-23058585 CTAGAGTGATAGAGGGAAGAAGG + Intergenic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1022850344 7:34255413-34255435 TCAGACTCTCAGAGGGAGCATGG + Intergenic
1023892160 7:44400664-44400686 CTAGAGTCTCTGCAGGAGCATGG - Intronic
1024377138 7:48652781-48652803 CTAGCGTCTTGGAGGGAGCATGG - Intergenic
1024538076 7:50454763-50454785 AAAGAGTCACAGAGGGAAGAAGG + Intronic
1026110751 7:67457170-67457192 CTAGGGTCTCAGAGGTAGGAGGG - Intergenic
1026490043 7:70855466-70855488 CTAGAGTCACAGACAGAGCAGGG - Intergenic
1027589944 7:80105880-80105902 CTAGAGCCTCAGAGGAAACATGG + Intergenic
1028923009 7:96327370-96327392 CCAGAGTCTCAGAGGGATCATGG + Intergenic
1029444159 7:100603569-100603591 TTAAAGTCTCAGAGGCAAAAAGG + Intronic
1029729370 7:102429458-102429480 CTGGAGTCTCAAAGGCCACAGGG + Intergenic
1031329999 7:120452810-120452832 CTAAAGTCTCCTAGAGAACATGG - Intronic
1033247608 7:139730991-139731013 CTGGAGTCTTCGAGGGAACGTGG + Intronic
1034249125 7:149674238-149674260 CTCAAGTCTGAGAGGGAAAAAGG - Intergenic
1034659405 7:152756517-152756539 CTAGAGTCTTCGAGAGAACATGG + Intergenic
1035044859 7:155957067-155957089 CCAGAGCCTCCGAGGGAACAGGG + Intergenic
1036275704 8:7349672-7349694 CTTGACTCTCAGAAGGACCAAGG + Intergenic
1036345651 8:7960685-7960707 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036840976 8:12121439-12121461 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1036862785 8:12367691-12367713 CTTGACTCTCAGAAGGACCAAGG - Intergenic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1038501988 8:28052606-28052628 CTGCAGTTTCAGAGGGAGCATGG + Intronic
1039124619 8:34187465-34187487 AAAGAGTCTTAGAGGAAACATGG - Intergenic
1039514810 8:38123740-38123762 CTAGAGTGTGAGTGGGAAGATGG - Intronic
1040720417 8:50314439-50314461 CTAGAGTAAAAGAGGGAACAGGG - Intronic
1041139187 8:54796693-54796715 CCAGAGTCTCAGAGGGAGTATGG + Intergenic
1041742862 8:61175745-61175767 CTAGACCCTAAGAGGGAACATGG + Intronic
1042093668 8:65188174-65188196 CAAGACTGTCAGAGGAAACATGG + Intergenic
1042664131 8:71187866-71187888 TTAGAGTCTCAGGGGCAAAATGG - Intergenic
1043788504 8:84432843-84432865 CCAGAGTCTCACAGGGAGCATGG + Intronic
1044927470 8:97221846-97221868 CTAGAGTCTCAGAGGCAGTGTGG + Intergenic
1045935945 8:107678993-107679015 TGAAAGTCTCAGAGGGAGCATGG - Intergenic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1046976890 8:120289124-120289146 CTAGAATCTGAGGGGGAAGAAGG - Intronic
1047406552 8:124590220-124590242 CTAGAATATCACAGGGAAAATGG - Intronic
1047668309 8:127116959-127116981 CTAGACTCTGAGAGAGAGCAAGG + Intergenic
1047916592 8:129590648-129590670 CTTGAGGCTCAGAGGGCTCAAGG - Intergenic
1049276900 8:141724508-141724530 CTAAAGTATCAGAGGCAACTAGG + Intergenic
1050166732 9:2772311-2772333 CTACAGTCTCATAGGTATCAAGG + Intronic
1051432162 9:16990604-16990626 CCAGAGGCTGAGAGGGACCAGGG + Intergenic
1051725922 9:20088366-20088388 CTAGAGAATCAGAGGCAACTAGG + Intergenic
1052121793 9:24727030-24727052 TCAGAGTCTCAGAGTAAACAAGG + Intergenic
1052306518 9:27016156-27016178 CTAGAGTCTCAGAGGAAGCATGG - Intronic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1054741823 9:68813842-68813864 ATCGAGTCTCAGAGGGAGCATGG + Intronic
1055023504 9:71694950-71694972 CTAGAGTGACTGAGGGACCATGG - Intronic
1055242606 9:74202233-74202255 CCAGACTCTCAGAAGGATCACGG + Intergenic
1056658346 9:88526885-88526907 CTAAGGTTTCAGAGGGAGCACGG + Intergenic
1059113589 9:111580072-111580094 CTATAGTCTTAGAAGGAAAAAGG - Intronic
1060189374 9:121582362-121582384 GCTGAGTCTCAGAGGGAACCAGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060487699 9:124059578-124059600 CCAGAGTCTCAGAGAGCACATGG + Intergenic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060657457 9:125381718-125381740 CTAGCGTCTCAGAGGGAGCACGG - Intergenic
1061396566 9:130346926-130346948 CTAGGGTCCCTGAGGGACCAAGG - Intronic
1185895212 X:3852329-3852351 GTAGACTCTCAGAGGACACAAGG - Intergenic
1185900330 X:3890754-3890776 GTAGACTCTCAGAGGACACAAGG - Intergenic
1185905446 X:3929185-3929207 GTAGACTCTCAGAGGACACAAGG - Intergenic
1186714462 X:12235753-12235775 TTAGAGTCTCAGAAAGAACATGG + Intronic
1186814695 X:13224992-13225014 CCAGAGTATTAGAGGGAGCATGG - Intergenic
1187212192 X:17242741-17242763 TTAGAGACTCTGAGGGACCATGG + Intergenic
1187548231 X:20274444-20274466 ACAGAGTCTCTGAGAGAACATGG + Intergenic
1188044937 X:25414806-25414828 CCAGAGTCTCAGAGAGACCATGG + Intergenic
1189136727 X:38558379-38558401 CCAGAGTCTCAGAGAGAGGATGG - Intronic
1189360770 X:40349173-40349195 CCAGAGTCTCAGAGGGAGCATGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1191603246 X:63033204-63033226 CTAGAATCTCAGTGGGAATATGG + Intergenic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1194574236 X:95592374-95592396 GTAAAGTTTCAGAGGGCACATGG - Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1195284536 X:103371255-103371277 CCAGAGTCTCTGAGGAAACATGG - Intergenic
1195928266 X:110048076-110048098 ATAGAGTGCCAGAGGAAACATGG - Intronic
1195958753 X:110363290-110363312 CTACAGACTGAGAGGGAATAGGG + Intronic
1196701104 X:118669802-118669824 CCAGAGTCTTAGAGGGAGCATGG - Intronic
1196940560 X:120771710-120771732 CTATAGTCTAATATGGAACATGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197278286 X:124505386-124505408 ATAGACTCTCAGAGGGGAAAGGG + Intronic
1197683443 X:129411672-129411694 CTAGAGTCTCAGACGTAGCGTGG + Intergenic
1199989852 X:152980827-152980849 CTAGAGCTTAAGAGGGAACTGGG + Intergenic
1202028462 Y:20549451-20549473 CTAGAGACTAAGAAGAAACAAGG - Intergenic