ID: 1115327248

View in Genome Browser
Species Human (GRCh38)
Location 14:32153815-32153837
Sequence GGCTCAACACTTTGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115327240_1115327248 28 Left 1115327240 14:32153764-32153786 CCTGCTGCAACCAGGTTTTCTGA 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG 0: 1
1: 1
2: 1
3: 19
4: 236
1115327241_1115327248 18 Left 1115327241 14:32153774-32153796 CCAGGTTTTCTGAAAGTTAAAAA 0: 1
1: 0
2: 5
3: 45
4: 539
Right 1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG 0: 1
1: 1
2: 1
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115327248 Original CRISPR GGCTCAACACTTTGGGGAGC TGG Intronic
900183067 1:1320859-1320881 GGCTGCACCCTGTGGGGAGCAGG - Intronic
901857769 1:12055287-12055309 GGGACAACACTTTGCAGAGCTGG + Intergenic
904100914 1:28026361-28026383 ATTTCAACACTTTGGGAAGCTGG + Intronic
904196900 1:28792551-28792573 ATCTCAACACTTTGGGAGGCTGG + Intergenic
905424357 1:37871203-37871225 ATCCCAACACTTTGGGAAGCTGG + Intronic
906662236 1:47591007-47591029 GGCCCAGCCCTCTGGGGAGCGGG + Intergenic
908115564 1:60936760-60936782 GGCAAAACACTTTGGAGGGCTGG - Intronic
909433364 1:75615194-75615216 GTCTCGACAGGTTGGGGAGCAGG + Intergenic
910595448 1:88975780-88975802 GTCTCAGCACTTTGGGAGGCTGG + Intronic
911095671 1:94053077-94053099 TGCTGAACACTTTGAGGTGCTGG + Intronic
911452790 1:98086167-98086189 GGCTCAGTACTTTGGGAGGCTGG + Intergenic
912722095 1:112028838-112028860 GCTTCCACACTCTGGGGAGCTGG + Intergenic
914243090 1:145865675-145865697 TCCCCAGCACTTTGGGGAGCTGG + Intergenic
920220574 1:204396939-204396961 ATCTCAACACTTTGGGAGGCAGG + Intergenic
920384306 1:205557522-205557544 ATCTCAACACTTCGGGGGGCAGG + Intergenic
924373724 1:243384233-243384255 GGCTCATCACTTTGCAGAGTTGG + Intronic
1063473889 10:6311494-6311516 GGCCCAGCACTCTGGGAAGCTGG + Intergenic
1064186293 10:13164804-13164826 ATCTCAACACTTTGGGAGGCCGG + Intronic
1064684284 10:17843808-17843830 TGCTCCAGACTTTGTGGAGCAGG + Intronic
1066006835 10:31153668-31153690 GACTCAGCACTTTGTGGAGTGGG - Intergenic
1066618230 10:37317708-37317730 GGCTCCAAAAATTGGGGAGCAGG + Intronic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1067922380 10:50472922-50472944 GGATTAACAGTGTGGGGAGCAGG - Intronic
1068326558 10:55496054-55496076 GGCTGAATATTTTGGGGAGGAGG + Intronic
1069863087 10:71483314-71483336 GGTTGAACTTTTTGGGGAGCAGG + Intronic
1070244119 10:74714020-74714042 ATCTCAGCACTTTGGGAAGCTGG + Intergenic
1070712056 10:78689927-78689949 ACCTCAGCTCTTTGGGGAGCAGG + Intergenic
1072110337 10:92313647-92313669 ATCCCAACACTTTGGGAAGCTGG + Intronic
1072194191 10:93101603-93101625 AGCCCAGCACTTTGGGCAGCTGG - Intergenic
1073384855 10:103117392-103117414 GTCTCAGCACTTTTGGGGGCTGG + Intronic
1075615696 10:123889737-123889759 GGCTCATCAACTTGGGGATCTGG - Intronic
1075716170 10:124557073-124557095 GCCTCAACACTTCGAGGAGTTGG - Intronic
1076361118 10:129889516-129889538 GGCTGCAGAGTTTGGGGAGCAGG - Intronic
1078457237 11:11484824-11484846 GGCTCCACTCCTTGGGGACCTGG - Intronic
1079014520 11:16857265-16857287 GGCCCAGCCCTTTGGGAAGCTGG - Intronic
1081543328 11:44051823-44051845 GGCCCACCACTTTGGGGAAAAGG - Intronic
1089468520 11:118702140-118702162 ATCTCAACACTTTGGGCAGGAGG - Intergenic
1089807031 11:121099635-121099657 GGCTTATCACTTTGGGAAGCTGG - Intergenic
1091221699 11:133933491-133933513 ATCTCAACACTTTGGGAGGCTGG + Intronic
1092462784 12:8700463-8700485 TGTTCCACACTTTGGGAAGCAGG + Exonic
1097024382 12:56043578-56043600 ACCTCAACACTTTGGGAGGCTGG + Intronic
1097031128 12:56090250-56090272 ATCCCAACACTTTGGGAAGCTGG - Intronic
1097632256 12:62078678-62078700 AGCTTAGCCCTTTGGGGAGCTGG + Intronic
1097980834 12:65736699-65736721 TGCTTAACATTTTAGGGAGCAGG + Intergenic
1100070162 12:90706236-90706258 GGCGCAGCACTTTGGGAGGCCGG - Intergenic
1102171361 12:110845006-110845028 GGCTCATCGCTTTGGCAAGCTGG + Intergenic
1103374296 12:120443317-120443339 GTCTTAACACTTTGGGAAGCTGG - Intronic
1105341200 13:19527813-19527835 GGATCAACTCTTCTGGGAGCAGG + Intronic
1106265404 13:28105229-28105251 GGCTCAAGCCTCTGGGTAGCTGG + Intergenic
1113118972 13:106905990-106906012 GGCTCAACTCATAGGGGAGGAGG - Intergenic
1114239163 14:20850105-20850127 GTCTCAGCACTTTGGGAAGCTGG - Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1115524391 14:34265323-34265345 ATCTCAGCACTTTGGGAAGCCGG + Intronic
1117065948 14:52013638-52013660 GGCACCCCATTTTGGGGAGCGGG - Intronic
1117306956 14:54487141-54487163 ATCTCAACACTTTGGGAGGCCGG + Intronic
1120929750 14:89836525-89836547 GGCTCTTCACCATGGGGAGCAGG + Intronic
1123000035 14:105288535-105288557 GTCCCAACACTTTGGGAGGCCGG + Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124463708 15:29917595-29917617 GGCTCCAGGCTTAGGGGAGCAGG + Intronic
1126999906 15:54490604-54490626 GCCTCTACACTTTGGAAAGCAGG - Intronic
1127964338 15:63912490-63912512 CGCACATCACTTTGGGGAGAGGG + Intronic
1128484957 15:68076034-68076056 ATCTCAACACTTTGGGGAGGCGG - Intronic
1129717211 15:77859521-77859543 GGCCCAACACTTTCGGGGGTGGG - Intergenic
1129741095 15:77989995-77990017 GGCTGAGCACTGGGGGGAGCAGG - Intronic
1131467518 15:92667645-92667667 GGCTCCACACTGTGGGGAACAGG - Intronic
1131639355 15:94273591-94273613 TGCTCAGCTCTTTGGAGAGCAGG - Intronic
1134057159 16:11177768-11177790 GGCTCAGCACTTTGAGGAGGAGG + Intronic
1134196927 16:12166458-12166480 GGCTCTCCACTTGGAGGAGCTGG + Intronic
1138043161 16:53696939-53696961 ATCTCAGCACTTTGGGGGGCTGG + Intronic
1139383371 16:66548589-66548611 GTCTCAACACTGGGGGGAGAGGG + Intronic
1139681680 16:68569647-68569669 ATCTCAACACTTTGGGAGGCTGG + Intronic
1140917997 16:79510786-79510808 GGCCCCACACATTGGGTAGCTGG + Intergenic
1143589232 17:7870977-7870999 ATCTCCACACTTTGGGAAGCTGG - Intronic
1145006343 17:19340525-19340547 ATCCCAACACTTTGGGAAGCTGG + Intronic
1145013227 17:19381657-19381679 TGCTCAAGTCTTTGAGGAGCCGG + Exonic
1145976767 17:28988449-28988471 GGCTAGGCACTTTGGGGAGCAGG - Intronic
1145989941 17:29073379-29073401 GGTCTGACACTTTGGGGAGCAGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148476602 17:47932844-47932866 GGTTAAACTGTTTGGGGAGCTGG - Intergenic
1148553738 17:48565442-48565464 GCCCAAACCCTTTGGGGAGCAGG - Intronic
1148613395 17:48980472-48980494 ATCCCAACACTTTGGGGGGCTGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150377647 17:64695147-64695169 TGCACCACACTTTGAGGAGCAGG - Intergenic
1150504280 17:65682242-65682264 ATCCCAACACTTTGGGAAGCCGG - Intronic
1150711204 17:67532213-67532235 GGCTCCACTCATGGGGGAGCCGG + Intronic
1150777021 17:68089348-68089370 TGCACCACACTTTGAGGAGCAGG + Intergenic
1152038547 17:77888625-77888647 ATCCCAACACTTTGGGGGGCCGG + Intergenic
1203171879 17_GL000205v2_random:155985-156007 GGTTGAACTCTTTGGGGACCTGG + Intergenic
1203173858 17_GL000205v2_random:176770-176792 GGATGAACTCTTTGGGGACCTGG - Intergenic
1156826251 18:41433342-41433364 GGCAAAAAACTTTGTGGAGCTGG + Intergenic
1158457356 18:57619938-57619960 ATCTCAACACTTTGGGAGGCCGG - Intronic
1158890086 18:61864486-61864508 CGGTGAACACTTTGAGGAGCTGG - Intronic
1159597295 18:70394790-70394812 GGCTCATCACATGGGGGAGTAGG + Intergenic
1159726889 18:71971982-71972004 GGCCCATCACATGGGGGAGCAGG + Intergenic
1159864688 18:73690265-73690287 GAATCAACACTTTGGGGCACTGG + Intergenic
1162880219 19:13653341-13653363 ATCTCAACACTTTGGGAGGCTGG + Intergenic
1162960646 19:14124042-14124064 ATCTCAACACTTTGGGAGGCTGG - Intronic
1163902830 19:20121431-20121453 ATCTCAGCACTTTGGGAAGCCGG - Intronic
1164674938 19:30094724-30094746 GGCTCAAGACAGTCGGGAGCAGG + Intergenic
1164968501 19:32509422-32509444 CGCTCATTTCTTTGGGGAGCAGG - Intergenic
1166124645 19:40706710-40706732 ATCCCAACACTTTGGGAAGCTGG - Intronic
1167069132 19:47209499-47209521 TGCTCATCACTCAGGGGAGCTGG - Exonic
934095349 2:88597002-88597024 GGCTCAAAACTTTAGGAAACAGG + Intronic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
937125083 2:119469743-119469765 GTCTCAGCACTTTGGGAGGCTGG - Intronic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
938635906 2:133226044-133226066 ATCTCAACACTTTGGGAGGCTGG - Intronic
938800690 2:134760882-134760904 GGCTCATGCCTTTGGGAAGCCGG + Intergenic
940936994 2:159507003-159507025 GGTGCAATACTTTGTGGAGCAGG + Intronic
941763810 2:169274329-169274351 ATCCCAACACTTTGGGAAGCCGG + Intronic
941923298 2:170872620-170872642 GTCTCAGCACTTTGGGAAACTGG + Intergenic
942355360 2:175106581-175106603 ATCCCAACACTTTGGGAAGCTGG + Intronic
942725471 2:179002068-179002090 ATCCCAACACTTTGGGAAGCTGG - Intronic
944661863 2:201928192-201928214 ATCTCAGCACTTTGGGGAGATGG - Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
946765123 2:223033400-223033422 GGGTGAACAGTTTGGGGACCAGG + Intergenic
947391377 2:229642969-229642991 GGCCCAGCACTTTGGGAGGCGGG + Intronic
948166925 2:235870145-235870167 GGCTTGAGACTTTGGGTAGCTGG - Intronic
1169010933 20:2249792-2249814 ATCTCAACACTTTGGGAGGCTGG - Intergenic
1169145793 20:3251605-3251627 GCAACAACACTTTGGGGAGCGGG + Exonic
1171122933 20:22581759-22581781 GGGTCGAGACTTTGGGGAGACGG - Exonic
1172156894 20:32832712-32832734 ATCTCAACACTTAGGGAAGCAGG - Intronic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1175578294 20:60079120-60079142 GTCTCAGCACTTTGCAGAGCTGG + Intergenic
1176068365 20:63212545-63212567 AGCTCCTCACTTTGGTGAGCAGG - Intronic
1176085232 20:63292834-63292856 GGCTGCCCACTGTGGGGAGCAGG - Intergenic
1176327861 21:5517822-5517844 GGTTGAACTCTTTGGGGACCTGG + Intergenic
1176329849 21:5538416-5538438 GGATGAACTCTTTGGGGACCTGG - Intergenic
1176397908 21:6282535-6282557 GGATGAACTCTTTGGGGACCTGG + Intergenic
1176399896 21:6303129-6303151 GGTTGAACTCTTTGGGGACCTGG - Intergenic
1176437261 21:6685975-6685997 GGTTGAACTCTTTGGGGACCTGG + Intergenic
1176439249 21:6706569-6706591 GGATGAACTCTTTGGGGACCTGG - Intergenic
1176461523 21:7013045-7013067 GGTTGAACTCTTTGGGGACCTGG + Intergenic
1176463511 21:7033638-7033660 GGATGAACTCTTTGGGGACCTGG - Intergenic
1176485084 21:7394823-7394845 GGTTGAACTCTTTGGGGACCTGG + Intergenic
1176487072 21:7415417-7415439 GGATGAACTCTTTGGGGACCTGG - Intergenic
1177515763 21:22148910-22148932 GGATTAAGACTTTGGGGAACTGG + Intergenic
1179959507 21:44760137-44760159 TGCTCAGCACTCTGAGGAGCAGG - Intergenic
1181173625 22:21023794-21023816 GGCTCAGGACTTGGGGCAGCAGG - Intronic
1181519109 22:23435251-23435273 GGCTCTACTCTGTGGGGGGCAGG - Intergenic
1182128683 22:27834941-27834963 GGCTGACCACTGTGGGAAGCGGG + Intergenic
1182721956 22:32410214-32410236 GCCTCAACAGTCTAGGGAGCTGG + Intronic
1183221981 22:36520800-36520822 GTCCCAGCACTTTGGGAAGCTGG + Intronic
949540388 3:5027410-5027432 GTCCCAACACTTTGGGAGGCCGG - Intergenic
950569371 3:13790682-13790704 GGCTCAACCCAATGGGAAGCAGG - Intergenic
951348680 3:21578066-21578088 GTCCCAGCACTTTGGGAAGCCGG - Intronic
952300941 3:32104300-32104322 ATCTCAACACTTTGGGAGGCCGG - Intergenic
952340321 3:32440152-32440174 ATCACAGCACTTTGGGGAGCTGG + Intronic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
954220475 3:49150505-49150527 GACTCCTCACTTTGGGCAGCTGG + Intergenic
954279541 3:49566530-49566552 ATCTCAGCACTTTGGGAAGCTGG + Intronic
955975452 3:64475597-64475619 TGCCCAACTATTTGGGGAGCTGG + Intergenic
960542748 3:118879641-118879663 AGCCCAACACTTTGGGGAGAAGG - Intergenic
962957337 3:140278348-140278370 GGCTCAACACTTGAGCGAGCGGG + Intronic
965811049 3:172592167-172592189 GGCTCCACTTGTTGGGGAGCAGG + Intergenic
967451515 3:189629123-189629145 ATCCCAACACTTTGGGAAGCCGG + Intergenic
967608568 3:191477642-191477664 AGCTCCAGATTTTGGGGAGCAGG - Intergenic
967984307 3:195083909-195083931 GCCTCAGCACCTTGAGGAGCTGG - Intronic
968011308 3:195280052-195280074 ACCCCAACACTTTGGGAAGCTGG + Intronic
968631275 4:1653437-1653459 GGCTCAGCACGTTGTGGGGCGGG - Intronic
970462404 4:16288136-16288158 GGATCAACACTCTGGGGAGTGGG + Intergenic
972399706 4:38689214-38689236 GTATCAACACTTTGGGGGGGCGG - Intronic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
975494851 4:75026598-75026620 GGCTTGATAGTTTGGGGAGCAGG - Intronic
978587817 4:110292503-110292525 GGCTCTCCAGTTTAGGGAGCTGG - Intergenic
980107578 4:128602250-128602272 CTGTCACCACTTTGGGGAGCTGG + Intergenic
980877942 4:138680762-138680784 GGCTGATCATTTTGTGGAGCTGG - Intergenic
982260707 4:153491950-153491972 ATCCCAACACTTTGGGGAGTGGG - Intronic
984518574 4:180772648-180772670 GTCTCAGCACTTTGGGAGGCCGG - Intergenic
985522518 5:383815-383837 ATCTCAACACTTTGGGAGGCCGG - Intronic
985617992 5:936172-936194 GGCTCAACACTTTAGTCATCGGG + Intergenic
987063282 5:14262784-14262806 GGACCTACACTGTGGGGAGCAGG + Intronic
989751717 5:44902746-44902768 GTCTCAGCACTTTGGGAAGCCGG - Intergenic
990273982 5:54175902-54175924 ATCTCAGCACTTTGGGCAGCCGG - Intronic
991969377 5:72123881-72123903 ATCTCAACACTTTGGGAAGTGGG - Intronic
992100261 5:73400956-73400978 GGCACAACACTTTTGGCAACCGG - Intergenic
993413678 5:87600926-87600948 GGCTCCACTCGTTGGGGGGCAGG + Intergenic
993475742 5:88361944-88361966 GGCTGATCACATTGGGGAACAGG - Intergenic
994320562 5:98389916-98389938 AGTTAAACACTTTGGGGAGTAGG - Intergenic
996493533 5:124127246-124127268 GGCCCAACACTTTGGGAGGCTGG - Intergenic
996723626 5:126654151-126654173 GGCTCAACACTTTGAGATGATGG + Intergenic
997483127 5:134204713-134204735 ATCTCAACACTTTGGGAGGCTGG - Intronic
997635351 5:135400043-135400065 GGCTCCACACTTTGGAGGGAGGG - Intergenic
998610333 5:143681763-143681785 GGCTCACGCCTTTGGGAAGCTGG - Intergenic
1000975871 5:167763801-167763823 AGCTCAACAAGTTGGAGAGCCGG - Intronic
1000990558 5:167907648-167907670 GTCCCAACACTTTGGGAACCTGG + Intronic
1003174179 6:3743105-3743127 GGCTCAACACTTGCGGTAACTGG + Intronic
1007903093 6:45430129-45430151 TGCTGGACACTTTTGGGAGCAGG + Intronic
1010020106 6:71149655-71149677 GGCTCACTACTTTGGGAGGCCGG + Intergenic
1010391291 6:75340954-75340976 ATCTCAGCACTTTGGGAAGCCGG - Intronic
1011883834 6:92066442-92066464 GGTTTAACACTTTGGGGACTTGG - Intergenic
1012597676 6:101058857-101058879 TGCCCACCACATTGGGGAGCAGG + Intergenic
1014329366 6:120041775-120041797 GTCTCCACACTTTGGGAAGAAGG - Intergenic
1015007572 6:128302134-128302156 ATCTCAACACTTTGGGAGGCCGG + Intronic
1017306695 6:152926658-152926680 GTCTCAGCACTTTGGGAGGCCGG + Intergenic
1017938422 6:159027964-159027986 CACTCAACACTTTTGGGAACTGG - Intergenic
1018712707 6:166508196-166508218 TGCTCACCTCTTTGGAGAGCCGG + Exonic
1018729484 6:166637861-166637883 GGATCCCCACTTTGGGGAGTGGG - Intronic
1018926439 6:168209939-168209961 GCCTCATCTCTGTGGGGAGCAGG - Intergenic
1019592173 7:1841075-1841097 GGCTCTACTCTGTGGGGGGCAGG + Intronic
1021300054 7:18961518-18961540 GTCTTAACAATTTGGGGAGAAGG + Intronic
1021792176 7:24216810-24216832 TGCTCAACACCTTGGCCAGCTGG - Intergenic
1025104222 7:56157633-56157655 AGAGCAAAACTTTGGGGAGCAGG + Intergenic
1026242850 7:68592107-68592129 ATCTCAGCACTTTGGGAAGCCGG - Intergenic
1026620956 7:71949630-71949652 AGCTCAGCACTTTGGGAGGCCGG - Intronic
1027151830 7:75738860-75738882 GGCTCAGCACCTTGGGCAGTGGG + Exonic
1027385787 7:77658707-77658729 GTCCCAACACTTCGGGGTGCCGG + Intergenic
1032072354 7:128816052-128816074 GGCACAACCCTTCGGGGAGGTGG + Intronic
1033459509 7:141532696-141532718 GGCTCTGCACTTAGGGGATCAGG - Intergenic
1034643743 7:152625914-152625936 GGCTCATCACATGGGGAAGCAGG + Intergenic
1035529215 8:337821-337843 AGCTACACACGTTGGGGAGCAGG + Intergenic
1036933396 8:12977760-12977782 ATCTCAACACTTTGGGAGGCTGG + Intronic
1037343043 8:17867815-17867837 CGCCCAACACTTTGGGAGGCCGG + Intronic
1041284282 8:56244397-56244419 GGACCAACACTTTGGGGAATGGG + Intergenic
1043456292 8:80415671-80415693 ATCTCAACACTTTGGGAGGCGGG - Intergenic
1044369227 8:91389504-91389526 GGCTCAAGACTATGGAGAGAAGG - Intronic
1046282351 8:112050338-112050360 GGCTCAACAAAGTTGGGAGCTGG + Intergenic
1046740659 8:117825122-117825144 GTCCCAACACTTTGGGAGGCCGG - Intronic
1047772823 8:128044099-128044121 GTCTCAACACTTTGGGAGCCTGG - Intergenic
1049084490 8:140467988-140468010 ATCCCAACACTTTGGGAAGCAGG - Intergenic
1050819111 9:9855725-9855747 GGGCGAACACTTTTGGGAGCTGG + Intronic
1052325520 9:27213412-27213434 GGCTGAAAACTTTGGGGAACAGG - Intronic
1052559735 9:30070039-30070061 ATCCCAACACTTTGGGAAGCCGG + Intergenic
1056608087 9:88103798-88103820 ATCTCAACACTTTGGGAAGCTGG - Intergenic
1059128568 9:111719649-111719671 AGATCAACACTTTGGGGAGCTGG - Intronic
1060342259 9:122788131-122788153 ATCCCAACACTTTGGGAAGCTGG + Intergenic
1060946984 9:127575476-127575498 GTCCCAGCACTTTGGGAAGCTGG - Intronic
1061718398 9:132536178-132536200 GGTACAAAACTTAGGGGAGCTGG + Intronic
1062296954 9:135835724-135835746 AGCCCAGCACTTTGGGAAGCCGG + Intronic
1203432246 Un_GL000195v1:101910-101932 GGATGAACTCTTTGGGGACCTGG + Intergenic
1185738458 X:2511507-2511529 GGGCAAACACTTTGGGGATCTGG + Intergenic
1186175143 X:6918818-6918840 GTATCATCACTTTGGGGATCAGG + Intergenic
1186656165 X:11614209-11614231 TTCTCAACACTTGGGGGAGAAGG - Intronic
1187092109 X:16107539-16107561 ATCCCAACACTTTGGGAAGCCGG - Intergenic
1188079405 X:25817829-25817851 AAATCAACACTTTGGGGAGATGG - Intergenic
1188423612 X:30021127-30021149 ATCTCAACACTTTGGGAGGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1195208152 X:102624876-102624898 GGCTCTACTTGTTGGGGAGCAGG + Intergenic
1195692480 X:107638680-107638702 GGCTCAGCACTTTGGGGAGCAGG - Intronic
1198034779 X:132790887-132790909 ATCTCAACACTTTGGGAAGCCGG + Intronic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic