ID: 1115328869

View in Genome Browser
Species Human (GRCh38)
Location 14:32171928-32171950
Sequence ATCTGAGGGTAGGAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115328869_1115328874 7 Left 1115328869 14:32171928-32171950 CCACCTCACTCCTACCCTCAGAT No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115328869 Original CRISPR ATCTGAGGGTAGGAGTGAGG TGG (reversed) Intergenic
No off target data available for this crispr