ID: 1115328874

View in Genome Browser
Species Human (GRCh38)
Location 14:32171958-32171980
Sequence GTCTTTCCACACTCTAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115328873_1115328874 -8 Left 1115328873 14:32171943-32171965 CCTCAGATAATATTTGTCTTTCC No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328872_1115328874 -7 Left 1115328872 14:32171942-32171964 CCCTCAGATAATATTTGTCTTTC No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328868_1115328874 8 Left 1115328868 14:32171927-32171949 CCCACCTCACTCCTACCCTCAGA No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328870_1115328874 4 Left 1115328870 14:32171931-32171953 CCTCACTCCTACCCTCAGATAAT No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328867_1115328874 13 Left 1115328867 14:32171922-32171944 CCTTTCCCACCTCACTCCTACCC No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328871_1115328874 -3 Left 1115328871 14:32171938-32171960 CCTACCCTCAGATAATATTTGTC No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data
1115328869_1115328874 7 Left 1115328869 14:32171928-32171950 CCACCTCACTCCTACCCTCAGAT No data
Right 1115328874 14:32171958-32171980 GTCTTTCCACACTCTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115328874 Original CRISPR GTCTTTCCACACTCTAAGAG AGG Intergenic
No off target data available for this crispr