ID: 1115334268

View in Genome Browser
Species Human (GRCh38)
Location 14:32229484-32229506
Sequence CACTGCCCAAATCAAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115334268_1115334274 24 Left 1115334268 14:32229484-32229506 CCAGGTCTTTGATTTGGGCAGTG No data
Right 1115334274 14:32229531-32229553 ACAGGGACCATAGAAAGAAATGG No data
1115334268_1115334272 7 Left 1115334268 14:32229484-32229506 CCAGGTCTTTGATTTGGGCAGTG No data
Right 1115334272 14:32229514-32229536 GTGGTGCCATCAATAAGACAGGG No data
1115334268_1115334275 25 Left 1115334268 14:32229484-32229506 CCAGGTCTTTGATTTGGGCAGTG No data
Right 1115334275 14:32229532-32229554 CAGGGACCATAGAAAGAAATGGG No data
1115334268_1115334276 30 Left 1115334268 14:32229484-32229506 CCAGGTCTTTGATTTGGGCAGTG No data
Right 1115334276 14:32229537-32229559 ACCATAGAAAGAAATGGGTGAGG No data
1115334268_1115334271 6 Left 1115334268 14:32229484-32229506 CCAGGTCTTTGATTTGGGCAGTG No data
Right 1115334271 14:32229513-32229535 TGTGGTGCCATCAATAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115334268 Original CRISPR CACTGCCCAAATCAAAGACC TGG (reversed) Intergenic
No off target data available for this crispr