ID: 1115336737

View in Genome Browser
Species Human (GRCh38)
Location 14:32249778-32249800
Sequence TCACCCTGATGGGTGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115336737_1115336742 16 Left 1115336737 14:32249778-32249800 CCATGAGCCACCCATCAGGGTGA No data
Right 1115336742 14:32249817-32249839 AGTGAGGAGCCGAGCCTCTTTGG No data
1115336737_1115336741 0 Left 1115336737 14:32249778-32249800 CCATGAGCCACCCATCAGGGTGA No data
Right 1115336741 14:32249801-32249823 GCTGAGAGATCAGCTCAGTGAGG No data
1115336737_1115336743 24 Left 1115336737 14:32249778-32249800 CCATGAGCCACCCATCAGGGTGA No data
Right 1115336743 14:32249825-32249847 GCCGAGCCTCTTTGGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115336737 Original CRISPR TCACCCTGATGGGTGGCTCA TGG (reversed) Intergenic