ID: 1115341754

View in Genome Browser
Species Human (GRCh38)
Location 14:32300243-32300265
Sequence TTCCAGTTCATTAGCTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115341745_1115341754 14 Left 1115341745 14:32300206-32300228 CCAGGGGACCCATTCTTCCTTGG No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341744_1115341754 15 Left 1115341744 14:32300205-32300227 CCCAGGGGACCCATTCTTCCTTG No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341747_1115341754 6 Left 1115341747 14:32300214-32300236 CCCATTCTTCCTTGGCTCCCTTT No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341750_1115341754 -3 Left 1115341750 14:32300223-32300245 CCTTGGCTCCCTTTGGATCCTTC No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341743_1115341754 16 Left 1115341743 14:32300204-32300226 CCCCAGGGGACCCATTCTTCCTT No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341742_1115341754 28 Left 1115341742 14:32300192-32300214 CCTCTCTGTATGCCCCAGGGGAC No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data
1115341748_1115341754 5 Left 1115341748 14:32300215-32300237 CCATTCTTCCTTGGCTCCCTTTG No data
Right 1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115341754 Original CRISPR TTCCAGTTCATTAGCTAAGA AGG Intergenic
No off target data available for this crispr