ID: 1115342553

View in Genome Browser
Species Human (GRCh38)
Location 14:32307949-32307971
Sequence CATAGGAAACAGATGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115342546_1115342553 11 Left 1115342546 14:32307915-32307937 CCAGTTATCTCTTACGGGGCATT No data
Right 1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG No data
1115342545_1115342553 12 Left 1115342545 14:32307914-32307936 CCCAGTTATCTCTTACGGGGCAT No data
Right 1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG No data
1115342544_1115342553 13 Left 1115342544 14:32307913-32307935 CCCCAGTTATCTCTTACGGGGCA No data
Right 1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115342553 Original CRISPR CATAGGAAACAGATGCAGGG AGG Intergenic
No off target data available for this crispr