ID: 1115344141

View in Genome Browser
Species Human (GRCh38)
Location 14:32324149-32324171
Sequence ATGTGGGGTGGAAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115344131_1115344141 29 Left 1115344131 14:32324097-32324119 CCAGCTTATCTTGCAATAGGTAT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG 0: 1
1: 0
2: 4
3: 54
4: 483
1115344135_1115344141 -4 Left 1115344135 14:32324130-32324152 CCAAGTTCTAACCAGTGGAATGT 0: 1
1: 2
2: 5
3: 32
4: 166
Right 1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG 0: 1
1: 0
2: 4
3: 54
4: 483
1115344133_1115344141 4 Left 1115344133 14:32324122-32324144 CCATTTGACCAAGTTCTAACCAG 0: 1
1: 0
2: 2
3: 30
4: 287
Right 1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG 0: 1
1: 0
2: 4
3: 54
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115344141 Original CRISPR ATGTGGGGTGGAAGTGAAGA AGG Intergenic
900768486 1:4521132-4521154 CTGTGTGGTGGAGGTGGAGATGG - Intergenic
900975157 1:6012103-6012125 ATGATGGGTGGAGGTGATGAAGG + Intronic
901350565 1:8592189-8592211 ATTTAGGGTGGAAGTGTAGTAGG - Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
902565787 1:17310469-17310491 ATGAGGGGCGGAGGTGAGGAGGG - Intronic
902568445 1:17331163-17331185 CTGTGGGGTGGCAGTGTGGATGG + Intronic
902790075 1:18761875-18761897 ATGTGGGGTAGAACCCAAGAGGG + Intergenic
903019978 1:20386991-20387013 ATGGGGGGAGGAGGGGAAGAGGG + Intergenic
903573956 1:24326333-24326355 AAGAGGGGTGGAGGGGAAGAGGG - Intronic
903573963 1:24326349-24326371 AAGAGGGGTGGAGGAGAAGAGGG - Intronic
903573968 1:24326365-24326387 AAGAGGGGTGGAGGAGAAGAGGG - Intronic
903573985 1:24326413-24326435 AAGAGGGGTGGAGGGGAAGAGGG - Intronic
903764163 1:25722780-25722802 ATGTGGGGCAGAAGAGAAGATGG + Intronic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
904256410 1:29257644-29257666 ATGGGGGCTGGAAGGGAAGTTGG + Intronic
904260412 1:29284542-29284564 CTGTGGCGTGGAAGTGCAGAAGG + Intronic
904730041 1:32583418-32583440 ATCTGGGGTGGGAGTTCAGATGG + Intronic
904775429 1:32902998-32903020 TTGTCAGGTGGAAGGGAAGATGG + Intergenic
906013060 1:42547735-42547757 ATGAGGGGAGGCTGTGAAGAGGG - Intronic
906995519 1:50789482-50789504 ATGTGGGATGAAAGAGAAGAAGG - Intronic
907430811 1:54410192-54410214 AAGTGAGGTGGGAGTGAAGACGG + Intronic
907648017 1:56263592-56263614 ATGTGGGGTAGAAGTGAGTGTGG + Intergenic
907701037 1:56788608-56788630 AAGTGGGGAGGGAGTGAAAAGGG - Intronic
908262433 1:62349480-62349502 TTGTGGGGGAGAAGTGAAGAGGG + Intergenic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910998205 1:93131856-93131878 AAATGGGGTGAAAGAGAAGATGG + Intronic
911233575 1:95385625-95385647 ATGTGGAGGGGAGGTGTAGAGGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912829641 1:112941033-112941055 AGATGGGGGAGAAGTGAAGAGGG + Intronic
913265512 1:117039292-117039314 AGGTGGGGTTGGAGTGAGGATGG + Intergenic
914323515 1:146588261-146588283 AGGTTGGGTGGAAGTCCAGATGG + Intergenic
915032880 1:152899219-152899241 AGGTGAGGTGGAAATGAACAGGG + Intergenic
915100886 1:153499133-153499155 ATGTAGGGTGGAAATGAGAAGGG - Intergenic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916121321 1:161530817-161530839 GAGCGGGGTGGAAGAGAAGACGG + Intergenic
916131091 1:161612422-161612444 GTGCGGGGGGGAAGAGAAGACGG + Intronic
916164515 1:161953816-161953838 AGGTGGGGTGAAATTGAAGCTGG - Intronic
916276414 1:162998944-162998966 ATGGAGGGTGGAAGAGGAGAAGG + Intergenic
916463931 1:165054268-165054290 GTGTGGGGGGAAAGTGATGAGGG - Intergenic
917036315 1:170750806-170750828 GTGTTGGGTTGAAGTGGAGAAGG - Intergenic
917598511 1:176553100-176553122 ATGTGTGATGGAATTGAGGAGGG + Intronic
917786529 1:178464505-178464527 ATAAGGGGTAGAGGTGAAGATGG - Intronic
918128039 1:181601556-181601578 ATGTGGGGTGTAAGACAAAATGG - Intronic
918152509 1:181810015-181810037 AGGTGGGGTGGAAGAGAAAAGGG + Intergenic
918203814 1:182291488-182291510 AACTGGGGTGGAGGTGAATATGG - Intergenic
919993063 1:202722407-202722429 AGGTGGTATGGAAATGAAGAGGG + Intergenic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920642332 1:207764454-207764476 ATACGGGGTGGACGTGAGGAAGG - Intronic
920665599 1:207960476-207960498 GTGTGGGGTAGAAATGAGGATGG - Intergenic
923480824 1:234381716-234381738 TTGTGCTGTGGCAGTGAAGAAGG + Intronic
924273447 1:242359228-242359250 CTGTGAGGTGGGAGTGAAGTAGG + Intronic
924276032 1:242388204-242388226 ATGTGAGGTTTAAGAGAAGAAGG + Intronic
924953940 1:248909616-248909638 AGGTGGGGTCGACCTGAAGATGG + Intronic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1063951948 10:11231544-11231566 ATGTGGGCTGGAAGATAAAAAGG + Intronic
1064288382 10:14012146-14012168 ATGTGGGGTGGGAGTTGAGGGGG + Intronic
1064583199 10:16814703-16814725 AAGTTGGGTGGAAGTGAATTTGG - Intronic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1065344454 10:24735521-24735543 ATGTGGGGTGGGAGAGAAAGAGG - Intergenic
1065365903 10:24936739-24936761 TTGTGGCCTGGAAGTAAAGAAGG - Intronic
1065669797 10:28103563-28103585 AAGTAAGGTGGAAATGAAGATGG - Intronic
1066287240 10:33980219-33980241 ATGTGATATGTAAGTGAAGATGG + Intergenic
1067267883 10:44762791-44762813 AGATGGGGTGGATGTTAAGATGG - Intergenic
1069342810 10:67431973-67431995 ATGTGGGTTGGAGGAGAAGGTGG - Intronic
1070272948 10:74975808-74975830 GTTGGGGGTGGAAGTGAAGAAGG - Exonic
1071676804 10:87662509-87662531 GTGAGGGGTGGAAATGATGAAGG - Intronic
1071949093 10:90682682-90682704 ATATGGGGTGGAGGAGTAGAAGG - Intergenic
1071967783 10:90870309-90870331 ATGTGTGGTGAAGGTGAATAAGG - Intergenic
1072642376 10:97221621-97221643 ATGTGAGGTTACAGTGAAGACGG + Intronic
1073542342 10:104324293-104324315 ATTTGGAGTGCAAGTGAAGAGGG - Intronic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1074827298 10:117223762-117223784 AGGTGGGGTGGACCTGAAGAGGG - Intergenic
1075072520 10:119328234-119328256 AGGTCGGGTGGAAGAGAAGAGGG + Intronic
1075188370 10:120283718-120283740 AGATGGTGTGGAAGTGAGGAGGG - Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1076690718 10:132222745-132222767 AGGTGGGGTCGCAGTGCAGACGG + Exonic
1076794283 10:132791205-132791227 AGGTGGGGTGGGAGGGGAGAGGG + Intergenic
1077295156 11:1823080-1823102 AAGTGGGCTGGAAGTGCAGCTGG + Intergenic
1077420434 11:2447453-2447475 ATGTGGGGTGGGACTGGAGGTGG + Intronic
1077501270 11:2910742-2910764 ATGTGGGTGGGAACTCAAGATGG + Intronic
1078494819 11:11806536-11806558 GTCAGGGGTGGAAGTGGAGAAGG - Intergenic
1078837313 11:15043258-15043280 ATGTGGAGGGGAGCTGAAGATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081563290 11:44239161-44239183 ATGTGGGGAGGCTATGAAGAAGG + Intronic
1081601831 11:44500656-44500678 ATGTGGGGAAGTAGTGATGATGG - Intergenic
1081910802 11:46698636-46698658 AGCTGGGGTGGATGTGAAGGAGG + Intronic
1083627659 11:64079748-64079770 ATGTGGAGTGGAGGTAAGGAGGG + Intronic
1083836276 11:65270619-65270641 ATGTGGGGTGTGAGAGAAAAAGG - Intronic
1083860184 11:65416309-65416331 ATGTGGGGTGGATTTGGACAGGG - Intergenic
1083884514 11:65565553-65565575 ATGAGGGATGGAAGTGATGAAGG + Intergenic
1083896301 11:65621608-65621630 ATGTGGGGTGGAAGCGTGGCCGG + Intronic
1084697629 11:70765096-70765118 AACTGAGGTGGAAGGGAAGAGGG + Intronic
1085365139 11:75934365-75934387 TGGTGGGGAGGAAGTGAGGATGG + Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1085907845 11:80786046-80786068 CTGTGGTGTGGTAGTGATGATGG + Intergenic
1086046021 11:82533051-82533073 ATGTGGGGTGGGAGAAAAGAAGG + Intergenic
1087958438 11:104318951-104318973 ATGTGGGGTCAGAGTGTAGAGGG - Intergenic
1088213323 11:107480622-107480644 ATTTGGGGTGGAAGGACAGAAGG - Intergenic
1088451306 11:109984160-109984182 ATGTGGATTGGAATTCAAGATGG - Intergenic
1089775318 11:120831746-120831768 ATGTGGGCTGGAAGTGGGGTCGG - Intronic
1090035858 11:123248980-123249002 TTGTGGAGTTTAAGTGAAGAGGG + Intergenic
1090142132 11:124276730-124276752 ATGTGGAGTGCCAGTTAAGAGGG + Intergenic
1090155690 11:124436186-124436208 ATTTGTGGTGGAAGTGGATATGG + Intergenic
1090177588 11:124664865-124664887 GGGTGGGGGGGAAGTGAACAGGG - Intronic
1090458047 11:126866638-126866660 GTGTGGGGGGGCAGTGAGGAGGG - Intronic
1091204298 11:133809097-133809119 AGCTGGGGAGAAAGTGAAGACGG - Intergenic
1091558085 12:1590903-1590925 GTGTGGGGAGGATGTGAAGGTGG - Intronic
1093298200 12:17417342-17417364 ATATGTGGTCTAAGTGAAGAAGG + Intergenic
1093667971 12:21836914-21836936 ATGTGGGGAGGATGTGGGGAGGG + Intronic
1094454912 12:30621299-30621321 GTGTTGGATGGAAGTGAGGAGGG + Intergenic
1095796290 12:46222423-46222445 ATATTGGGTGGAAGTGAGCATGG - Intronic
1096081680 12:48837486-48837508 GTGTGGGAGAGAAGTGAAGATGG + Intronic
1096466621 12:51850245-51850267 ATGTGGGCTGGAAAAGAAGTGGG - Intergenic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096924910 12:55133288-55133310 ATATGGGGTGGGAGTGGAGGTGG + Intergenic
1096996395 12:55840816-55840838 GTGTGGGGTGGAAGGGTGGAGGG + Exonic
1097705784 12:62866924-62866946 GTGTGGGGTGGAAGGGAGCAGGG - Intronic
1098862275 12:75723519-75723541 ATGGAGGGTAGAAGTGAGGAAGG - Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1099609252 12:84845814-84845836 AGGTGGGGTAGAAGAGAAGCAGG - Intergenic
1100099140 12:91081063-91081085 ATGTGTGATGGAAGTGAAGGGGG + Intergenic
1101425547 12:104585391-104585413 ATTTGGGTTGGAATAGAAGAGGG + Intronic
1101751573 12:107586509-107586531 ATGTCTGCTGGAGGTGAAGAAGG - Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1102626595 12:114240059-114240081 ATGAGCGGGGGAAGGGAAGATGG - Intergenic
1102645614 12:114401740-114401762 AGGTGGCTTGGAAGAGAAGAAGG - Intronic
1104842649 12:131832158-131832180 ATCTGGGGGGGAAGGGAAGGGGG + Intronic
1105308460 13:19185603-19185625 TTGTGGGGTTGAACTGGAGATGG - Intronic
1106414893 13:29538285-29538307 AAGTGGGGAGGAAATGAGGAGGG + Intronic
1106538786 13:30671812-30671834 AAGTGGGGTGGAGGTGGAGAAGG + Intergenic
1106650290 13:31683044-31683066 ATTTTGGGTGGTAGGGAAGATGG - Intergenic
1107057099 13:36118214-36118236 ATGAGGGGCTGAAGTGAACATGG + Intronic
1107118185 13:36769524-36769546 ATGTTGGGTTGCTGTGAAGAAGG + Intergenic
1107844498 13:44497636-44497658 AGGTGGGGTGTAAGTGATGATGG - Intronic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1109971771 13:69779721-69779743 ATTTATGCTGGAAGTGAAGATGG + Intronic
1110153994 13:72291571-72291593 ATGGGATGTGGCAGTGAAGAGGG - Intergenic
1110534826 13:76638997-76639019 AGGTAGGCTGGAAGTGAGGAGGG - Intergenic
1110693102 13:78455117-78455139 AACTGGGGTAGAAGTGATGATGG + Intergenic
1110714157 13:78682988-78683010 ATTTGGAGTGGAAGTGGGGAGGG + Intergenic
1112944125 13:104905165-104905187 GTGAAGAGTGGAAGTGAAGATGG - Intergenic
1113063545 13:106350878-106350900 TTTTGGGATGTAAGTGAAGATGG - Intergenic
1113403148 13:110013763-110013785 AGGTGTGGTGGAATAGAAGAGGG - Intergenic
1114577218 14:23726046-23726068 ATCAGGGGAGGAAGTCAAGAAGG - Intergenic
1115307972 14:31951629-31951651 ATGTGGCGTGGAGGGGAAGGAGG - Intergenic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1115871878 14:37813792-37813814 ATGTGGGGTGTGAGGAAAGAGGG - Intronic
1116612360 14:47092164-47092186 ATGTGTGGTAGCAGTGAACATGG + Intronic
1116984655 14:51205841-51205863 AGGTGAGGGGGAAGTGACGAAGG + Intergenic
1117090709 14:52247338-52247360 AGGTGAGGTGTAGGTGAAGATGG + Intergenic
1117799683 14:59430379-59430401 ATGTGGGAGGGAAGTGGAAATGG + Intronic
1119885404 14:78136459-78136481 GTTGGGGATGGAAGTGAAGAAGG + Intergenic
1119895912 14:78219926-78219948 ATGGAGGGTAGAAGGGAAGAGGG + Intergenic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1123882390 15:24688439-24688461 ATGAGAGGAGGAAGTGAAGGAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126204900 15:46034538-46034560 ATCTGAGGTGGATGTGAAGGAGG + Intergenic
1126469653 15:48994778-48994800 AGCTGGAGTGGAAGTGAGGAGGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128735867 15:70053603-70053625 ATGGGGGGGGGAGGTGAAAAAGG + Intronic
1129081777 15:73047523-73047545 AACTTGGGTAGAAGTGAAGATGG + Intergenic
1129593757 15:76942510-76942532 AAGGGGGGTGGATGGGAAGATGG + Intronic
1129877758 15:78987822-78987844 GTGTGGGGTACAAGTGCAGAAGG + Intronic
1129901757 15:79156917-79156939 TTGCAGGGTGGAAGTGAAGCTGG - Intergenic
1130141633 15:81230910-81230932 ATGGGGGATGCAGGTGAAGACGG + Intronic
1130148622 15:81294162-81294184 AGGAGGGGTGAAAGTGAAGGAGG + Intronic
1130770085 15:86915629-86915651 CGGTGGGGGGGAGGTGAAGAGGG - Intronic
1131035060 15:89216706-89216728 ATGTGCAGTGGAACTGAAGATGG - Intronic
1131197128 15:90364559-90364581 CTGAAGGGTGGCAGTGAAGATGG - Intronic
1132791776 16:1694117-1694139 TTCTGGGATGTAAGTGAAGAAGG + Intronic
1134506077 16:14808211-14808233 ATGTTGGGTGCAAATGAATAGGG + Intronic
1134574473 16:15320559-15320581 ATGTTGGGTGCAAATGAATAGGG - Intergenic
1134727943 16:16435744-16435766 ATGTTGGGTGCAAATGAATAGGG + Intergenic
1134850535 16:17475081-17475103 ATTTGGGGTGGAGGTGGGGAGGG - Intergenic
1134939493 16:18276082-18276104 ATGTTGGGTGCAAATGAATAGGG - Intergenic
1135108082 16:19668378-19668400 ATGGGAGGTGGAGGGGAAGACGG - Intronic
1137454069 16:48604938-48604960 AAGTGGGGTGGTCGGGAAGAGGG - Intronic
1137494988 16:48962668-48962690 GTTTGGGGTGGCAGTGAAGGTGG + Intergenic
1138320222 16:56105328-56105350 GTGTGGGGTGGAGGTGTGGAGGG - Intergenic
1138323220 16:56137426-56137448 AAGTGGCGAGGAAGTGGAGATGG - Intergenic
1138360259 16:56422433-56422455 AGGTGGGGAGGAGGTGAAGGAGG - Intronic
1138989870 16:62378001-62378023 AAGTGGGGTGGGAGAGAGGAGGG - Intergenic
1139054371 16:63164138-63164160 AGATGGGTTGGAAGTGAATATGG - Intergenic
1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG + Intergenic
1140010046 16:71122588-71122610 AGGTTGGGTGGAAGTCCAGATGG - Intronic
1140454231 16:75095497-75095519 ATGTGGGAAAGAAGTGAATAGGG - Intronic
1140733073 16:77873902-77873924 CTGTGGGTGGGAGGTGAAGATGG + Intronic
1141273447 16:82561750-82561772 ATGTGGTGTGGAAATGACAAAGG - Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1145037819 17:19553445-19553467 ATGTGGGAGGGAAGGAAAGATGG - Intronic
1145107138 17:20127658-20127680 ATCTGGGGTGAAAGTAAGGAGGG + Intronic
1145756271 17:27392825-27392847 GGGTGGCGGGGAAGTGAAGATGG - Intergenic
1146243658 17:31256858-31256880 ATGTGTAGTGTAACTGAAGATGG + Intronic
1146980611 17:37158057-37158079 ATGGGGTGTGGAAGTGAATGTGG + Intronic
1147341348 17:39754753-39754775 ATGGGGGGTGGGAGTGGACATGG - Intergenic
1149152017 17:53577963-53577985 ATGGGGGGTGCTACTGAAGAGGG - Intergenic
1149483244 17:57020477-57020499 AAGTGGACTGGAAGCGAAGAGGG - Intergenic
1149522309 17:57326793-57326815 ATGTGGCTTGGAAGTGGAGAGGG + Intronic
1149869317 17:60168321-60168343 TTTTGGGGGGGAGGTGAAGAAGG + Intronic
1150184728 17:63168506-63168528 ATGTAAGTTGGAAGTTAAGATGG - Intronic
1150343707 17:64388177-64388199 ATGTGGTGTGGAGGGGGAGAGGG + Intronic
1152596969 17:81242525-81242547 ATTTGGGGTGGCAGAAAAGAGGG - Intergenic
1153299918 18:3583403-3583425 AGGCAAGGTGGAAGTGAAGAAGG - Intronic
1153369051 18:4293801-4293823 AGGTTGGGTGGAGGTGAGGAAGG - Intronic
1154369438 18:13745674-13745696 CTGGGGGGTGGAAGTGAGTAGGG + Intronic
1155059839 18:22218853-22218875 TTATGGGGTGGGAGTGAGGAAGG + Intergenic
1155534405 18:26802028-26802050 GTGTGGGGAGGAGGTGGAGATGG + Intergenic
1155581548 18:27313862-27313884 ATGTGGGTTGGAAGAGAAGTGGG + Intergenic
1156174925 18:34532864-34532886 ATATAGGGTGGAATTGAAGGTGG + Intronic
1156392740 18:36665956-36665978 ATGGAGGGTGGAAATTAAGAGGG + Intronic
1157080115 18:44515435-44515457 ATGTGGGATGGAACTGGTGAGGG + Intergenic
1157165255 18:45352797-45352819 AAAGGGGGTGGCAGTGAAGAGGG + Intronic
1159060642 18:63510659-63510681 ATATGGTGTGGAAGAGAAGTTGG - Intergenic
1159482265 18:69004600-69004622 ATGAGGGGTGGAAGAAAAGCAGG - Intronic
1161397122 19:4050603-4050625 ATGTGCGCTGGAAGTGCAAAAGG + Intronic
1161415726 19:4145432-4145454 AGGTGGGGAGGAGGGGAAGAGGG + Intergenic
1161619498 19:5290793-5290815 GTGGGGGGTGGATGTGAAGGTGG - Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1163775367 19:19214167-19214189 AGGTGGGGGTGAAGTGAAGGAGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164727458 19:30475837-30475859 ATGTGGGCAGGAACTGAACATGG - Intronic
1164801526 19:31080771-31080793 ATTTATGGTGGAAGGGAAGAGGG + Intergenic
1165221018 19:34316956-34316978 CTGTGGGGTGGCAGTAAGGAGGG - Intronic
1165423138 19:35732220-35732242 ATGTGGTGGGTCAGTGAAGATGG - Exonic
1165494269 19:36142511-36142533 ATGAGGGGTGGTAGTGAATGGGG - Intronic
1165769701 19:38372183-38372205 ATCTTGGCTGGAAGTGCAGATGG - Intergenic
1165854406 19:38870986-38871008 CTGGGGGCTGGAAGTGAGGAGGG + Exonic
1167191292 19:47991763-47991785 AAGGGGGGAGGAGGTGAAGAAGG - Intronic
1167480236 19:49725868-49725890 ATGTGGGAGGGGAGTTAAGAAGG - Intergenic
1168097270 19:54122945-54122967 AAGTGGGGAGGAAGTGAGGCGGG + Intronic
925272744 2:2625196-2625218 ATGGGAGGTGGAATTGAAGTTGG - Intergenic
925993276 2:9270700-9270722 AGGTGGGGTGGAAGTGGGGATGG - Intronic
926570446 2:14523910-14523932 ATGAGGGGAAGAAGTGAATATGG - Intergenic
927004208 2:18831108-18831130 ATGTGGGGTGGCAGTGAACAGGG - Intergenic
927099728 2:19778843-19778865 ATCTGGGCTGCAGGTGAAGAGGG + Intergenic
928033513 2:27800910-27800932 ATTTGGGGAGGACGTGCAGAGGG + Intronic
929010946 2:37443528-37443550 ATTTGGGGTGGGAGTGAGGAAGG + Intergenic
929198966 2:39215089-39215111 ATGTTTGGTGGGAGTGAAAATGG - Intronic
929265013 2:39908936-39908958 ATGTGGCATGGAATTGAAGGTGG - Intergenic
931609455 2:64082795-64082817 ATATGGGGGAGAAGTGAGGATGG - Intergenic
931635013 2:64332991-64333013 AAGTGTGGTGGAAGGGAAGGGGG - Intergenic
932283599 2:70514913-70514935 CTGTTGGGTGGAGGAGAAGAGGG + Intronic
932320265 2:70817113-70817135 CTGGAGGGAGGAAGTGAAGAAGG + Intronic
932373392 2:71212260-71212282 ATGTGAGATGGAGGTGAAGATGG - Intronic
932460149 2:71876583-71876605 ATGCGGGGAGGCAGTGATGAGGG + Intergenic
932680291 2:73818609-73818631 ATGGGTGGGGGAAGGGAAGATGG + Intergenic
932892975 2:75611985-75612007 ATGAGAGGTGGGAGGGAAGACGG - Intergenic
932925534 2:75969300-75969322 AAGTGGCGAGGAAGTGAAGTAGG - Intergenic
932959670 2:76397939-76397961 ATGTGTTATGGAAGTGAACAGGG - Intergenic
933228166 2:79774806-79774828 AAGTGGGGTGAAAGTGAAAGAGG - Intronic
934609227 2:95722384-95722406 GTGTGGGGAGGAACTAAAGAAGG - Intergenic
935558644 2:104538187-104538209 AGGAGGGGTGGAAGTGGGGAGGG + Intergenic
935714353 2:105926878-105926900 CTGTGGGCTGGAAATCAAGATGG - Intergenic
936182094 2:110275834-110275856 ATTTGGGGAGCAAGTCAAGAAGG - Intergenic
936230474 2:110695839-110695861 ATTTGGGGAGCAAGTCAAGAAGG + Intergenic
936373512 2:111922102-111922124 GGGTGGGGTGGAACTGAACAGGG + Intronic
936542551 2:113363961-113363983 GTGTGGGGAGGAACTGAAGAAGG - Intergenic
937594054 2:123651862-123651884 ATGGGAGGTGGAAGTAGAGAGGG - Intergenic
937802725 2:126099187-126099209 ATGTGGGGAGGAAGTGGGAATGG + Intergenic
938646934 2:133341483-133341505 CTGTGGTGTGGACCTGAAGATGG - Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939133011 2:138260300-138260322 ATGTTGAATGGAAGTGATGAAGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940176902 2:150888107-150888129 ATGTGAGTTGGCAGTGGAGAAGG - Intergenic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941043809 2:160650481-160650503 AGTTAGGGTGGAACTGAAGAGGG - Intergenic
941377483 2:164749964-164749986 CTGAGGAGTGGCAGTGAAGAAGG - Intronic
941795587 2:169595538-169595560 ATGGGGACTGGAAGTGAGGATGG - Intronic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
942838727 2:180334031-180334053 GTGGGGGGTGGAAATGGAGATGG + Intergenic
942850244 2:180475732-180475754 CTGAGTGGTGGAAGAGAAGAGGG - Intergenic
944959429 2:204854324-204854346 AGGTGAGGTAGAAGTGATGAGGG + Intronic
945175988 2:207043951-207043973 AGGTGGGGAGGAAGAAAAGAAGG + Intergenic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
945869862 2:215215316-215215338 ATGTGGGGTGGGAGAGGAAAGGG + Intergenic
946530394 2:220564197-220564219 ACATGGGGTGAAAGTGGAGACGG - Intergenic
947524329 2:230869206-230869228 ATCAGGGATGGAAGAGAAGAGGG + Intronic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948790075 2:240372455-240372477 ATGTGGGAGGGATGGGAAGAGGG + Intergenic
1168782231 20:502898-502920 GTGTTGGGTGGAAGTGGTGAAGG - Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1170286623 20:14716685-14716707 AGGTGAGATAGAAGTGAAGATGG + Intronic
1171360243 20:24582201-24582223 AAGTGGGGAGGAAGTGCAGGGGG - Intronic
1171380024 20:24727739-24727761 ATGTGGGGTGGTAGTTATGGGGG + Intergenic
1172758379 20:37304403-37304425 ATGTGGGAAGGAAGGGAATAGGG - Intronic
1174506697 20:51022099-51022121 ATGCTGGGGAGAAGTGAAGAGGG - Intronic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1175355223 20:58360481-58360503 AAGAAGAGTGGAAGTGAAGAAGG + Exonic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175766957 20:61598599-61598621 GTGTGGGGAGGATGTGCAGAGGG + Intronic
1176366058 21:6033672-6033694 ATGAGGGGAAGAAGTAAAGATGG - Intergenic
1177206793 21:18019335-18019357 TAGTGGGGAGGAAGTGAGGATGG + Intronic
1177207326 21:18024844-18024866 ATGAGTGGTGGGAGTGCAGAAGG - Intronic
1177481996 21:21701923-21701945 ATGTGGAGTGGAACTTTAGATGG + Intergenic
1177925938 21:27215319-27215341 GTTTGGGGTGGGAGTGGAGAAGG + Intergenic
1179434622 21:41351678-41351700 AGGTGGAGTGGGAGTGAACATGG - Intronic
1179729823 21:43361415-43361437 ATGTGGAATGGAAGGAAAGATGG + Intergenic
1179757459 21:43504873-43504895 ATGAGGGGAAGAAGTAAAGATGG + Intergenic
1181526906 22:23495060-23495082 AGGAAGGGAGGAAGTGAAGAAGG - Intergenic
1181725363 22:24807059-24807081 ATGTGGGGTGGGAGTGGGGCGGG - Intronic
1182121588 22:27790684-27790706 AGGTGGGGGGGGAGTAAAGAAGG + Intronic
1182186981 22:28414650-28414672 ATATGGGGAAGAATTGAAGAGGG + Intronic
1182882868 22:33748375-33748397 ATGGGAGGTGGAAGTGGAGATGG - Intronic
1183228914 22:36568801-36568823 ATTTGGGGGGGACCTGAAGAAGG + Intronic
1183258265 22:36777024-36777046 TTGTGGGGTGGTTGTGGAGATGG + Intergenic
1184156379 22:42670164-42670186 TTGGGGGGTGGGAGTGAAGGGGG + Intergenic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
949573340 3:5314203-5314225 AGGTTGGGTGAAAGTAAAGAAGG + Intergenic
950134268 3:10569712-10569734 CTCTGGGGTGAAAGTGAAGGAGG + Intronic
950486732 3:13278347-13278369 ACGTGGGGTGGCAGTGTAGAGGG - Intergenic
950721739 3:14887797-14887819 AGGTGGGGGTGCAGTGAAGAAGG + Intronic
952228470 3:31403919-31403941 ATGTGCTGGGGAAGTGAGGAGGG + Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
954784714 3:53084411-53084433 ATGTGGGGTGGGAGAGCAGGGGG - Intronic
955633234 3:60997487-60997509 CTGTGGGGTGGGAGTGTTGAGGG + Intronic
956989511 3:74747172-74747194 ATGTGAGGTGAGAGTGAATAAGG + Intergenic
957289156 3:78255292-78255314 TTGTGGATTGGAAGTGGAGAAGG - Intergenic
958152714 3:89711861-89711883 ATGTGTGGTGGAAGAGGAAATGG - Intergenic
959958719 3:112271169-112271191 ATGTAGGGAGGAAGAGAATAGGG + Intronic
960291573 3:115891785-115891807 AAGTGTGATGGAAGAGAAGAGGG - Intronic
960973149 3:123153646-123153668 ATGGGGGGTGGGGGTGTAGAGGG - Intronic
963417934 3:145023008-145023030 ATAGAGGGTGGAAGTGATGAGGG - Intergenic
964714275 3:159705599-159705621 AGGTTTGGTGGAGGTGAAGATGG + Intronic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
965781009 3:172285927-172285949 ATATGAGTTGGAAGTAAAGAGGG + Exonic
966596506 3:181728693-181728715 GAGTGGGGTGGAAGTGCAGTTGG + Intergenic
966731368 3:183154028-183154050 ATGGTGGGTGGCAGTGAATAAGG + Exonic
967281596 3:187828764-187828786 ATTAGGGCAGGAAGTGAAGAAGG + Intergenic
967475235 3:189908819-189908841 ATGTGGGGAGGAAGTGAGTTAGG + Intergenic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
968278590 3:197458971-197458993 ATGTGAGATAGAAATGAAGATGG - Intergenic
968282970 3:197490787-197490809 AAGTGGGATGGGAGTGGAGAGGG + Intergenic
969068520 4:4511000-4511022 TTGTGGGGTGGAAGACAAGGGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969421786 4:7101857-7101879 GTGTGGGGTGGGAGTGGGGAAGG + Intergenic
969492529 4:7508181-7508203 ATGTAGGGAGGAAGGGAAGGGGG + Intronic
969717916 4:8877367-8877389 AGAGGGGGTGGAAGGGAAGAAGG + Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
971149660 4:24018477-24018499 ATGTGGGGTGAGGGTGATGAGGG + Intergenic
972451217 4:39200566-39200588 ATGTGGCAAGGAAGTGAGGAAGG - Intronic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
972871516 4:43305454-43305476 AGGTGGGGTGGAAGTGGGGGTGG + Intergenic
973101018 4:46271111-46271133 GTGCAGGGTGGAAGTTAAGAAGG + Intronic
973161985 4:47030954-47030976 AAGTGGGGTGGAAGAAAAGTTGG + Intronic
973212237 4:47629178-47629200 ATGTTGGGGAGAAGTGGAGAAGG - Intronic
973268010 4:48230729-48230751 GAGTGTGGTGGAAGTAAAGATGG - Intronic
973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG + Exonic
974421105 4:61675930-61675952 GAGGGGGGAGGAAGTGAAGATGG - Intronic
976002487 4:80388142-80388164 CTGTGGGGTGGAGGTGGTGAGGG + Intronic
976623776 4:87156370-87156392 AGGTGGGGTGGAAGAGTGGAGGG + Intergenic
978296779 4:107214622-107214644 AAGTGTGATGGATGTGAAGAGGG - Intronic
979189143 4:117834927-117834949 TGTTGGGGTGGAAGTGAAGATGG + Intergenic
979403917 4:120285436-120285458 ATTTGGGATGGAAATAAAGATGG + Intergenic
979530636 4:121765603-121765625 ATGAAAGGTGGCAGTGAAGATGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
980134416 4:128846177-128846199 ATGGGGGGTGGCAGTGCTGAGGG - Intronic
981643796 4:146974978-146975000 ATGTGGTGGGGAAGGGAGGAGGG - Intergenic
981746417 4:148056537-148056559 GTGGGGGCGGGAAGTGAAGAGGG - Intronic
982994353 4:162322255-162322277 CTGCGAGGTGGAAGGGAAGATGG - Intergenic
983139892 4:164136856-164136878 ATGTAGTATGGAAGAGAAGAGGG + Intronic
984832293 4:183986942-183986964 ATGTGGGGTGCCAGCAAAGATGG - Intronic
984906338 4:184630286-184630308 ATGTGGAGTGGGAGAAAAGAAGG - Intronic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
985196914 4:187440984-187441006 ATGGGGAGTGGCAGTGGAGATGG + Intergenic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985707010 5:1407291-1407313 ATGCCGGGTGGGTGTGAAGAGGG - Intronic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986884759 5:12219793-12219815 ATGGTGGGGGGAAGTGGAGATGG - Intergenic
988155538 5:27444761-27444783 ATGTTAGGTAGAAGTGATGAAGG - Intergenic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
990227347 5:53669496-53669518 ATGGGAGGTGCAAGTGAAGGAGG - Intronic
990654428 5:57939562-57939584 AAGTGGGGAGGAAGTGAGGAGGG - Intergenic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991407893 5:66319719-66319741 ATGTTGTGTGGAAGTGGAGCCGG + Intergenic
992983998 5:82208564-82208586 TTGTTGGGTGGAAGTGGATATGG + Intronic
994622279 5:102177813-102177835 CTCTGGGGTGCATGTGAAGAAGG + Intergenic
996236276 5:121134560-121134582 ATGTGTGAAGGTAGTGAAGAGGG - Intergenic
997355495 5:133260213-133260235 CTGTGGGGTGGAAATGGTGAAGG - Intronic
997662628 5:135601126-135601148 CTGTGGGGAGGAAGTGACTAGGG + Intergenic
997713704 5:136027335-136027357 ATGTGGGGTTGTAGTCAAGGAGG - Intergenic
998160238 5:139809061-139809083 AGGTGGGGAGGAAGTGGAGAAGG - Intronic
1000530773 5:162417049-162417071 ATGTGTGGTGGAGATGGAGATGG + Intergenic
1001107023 5:168863019-168863041 ATGTGGGCTGGGGGTGCAGACGG + Intronic
1001651324 5:173318194-173318216 CTGTGGGGAGGAGGTGAAGGAGG - Exonic
1002060253 5:176621460-176621482 AAGTGGGATGGAGGTGAAGGGGG + Intronic
1002184701 5:177448732-177448754 AGGGAGGGAGGAAGTGAAGAAGG - Intronic
1002963098 6:1935981-1936003 GTCTGGGCTGGAAGTGAAAATGG + Intronic
1003269415 6:4593997-4594019 AGCTGGGGTGGAAGAGAAGAGGG - Intergenic
1003303714 6:4907965-4907987 AAGTGGGGTGGTAGAGAACACGG - Intronic
1003456977 6:6292355-6292377 GTGAGGGGTGGAAGGGAGGAGGG - Intronic
1003458440 6:6306660-6306682 AGGTGGGGTGGGAGGGTAGAAGG + Intronic
1004176055 6:13341145-13341167 AGGTGGGGTGTGAGAGAAGATGG + Intergenic
1005143630 6:22662822-22662844 ATGTGGAGAGGAAGAGAGGAAGG + Intergenic
1005433160 6:25779815-25779837 ATGTGGGGCAGAAGTCAAGATGG - Exonic
1005801699 6:29432046-29432068 ATGGAGGGTGGAAGAGAAAATGG - Intronic
1006765007 6:36497374-36497396 TGGAGGGGTGGAAGTGGAGAGGG - Intronic
1007584651 6:42981808-42981830 AAGAGGTGAGGAAGTGAAGATGG - Intergenic
1007630775 6:43272106-43272128 ACCTGGGGTGGATGGGAAGAGGG - Intronic
1009860649 6:69326770-69326792 ATGTGTGGAGGAAGAGGAGAAGG + Intronic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1009970057 6:70616178-70616200 TTGTGGGGTGGGAGTGGAGTGGG - Intergenic
1009994846 6:70886606-70886628 AGGTGGGGTGGACGTGGAGAGGG - Intronic
1011697642 6:89926987-89927009 ACCTGGGGAGGAAGAGAAGAGGG + Exonic
1013270973 6:108545160-108545182 ATGTGGCGTGGGAGTGCAGGGGG - Intergenic
1014351443 6:120351406-120351428 ATGTGGGACAGAAGTGAAGGGGG - Intergenic
1016320686 6:142842160-142842182 ATGGTGGGTGGAAGGGAAGGAGG - Intronic
1016608305 6:145960388-145960410 ATGGGGGGTGGAAGGGTAGAGGG + Intronic
1016852774 6:148638329-148638351 CTGGGAGGTGGAGGTGAAGATGG - Intergenic
1017094057 6:150788678-150788700 ATGAGAGGTGGATGTGAAGGTGG - Intronic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018275069 6:162121716-162121738 ATGTGGGGTGGCCATGATGAAGG + Intronic
1018333035 6:162753251-162753273 AGGTGGGGTGGGGGTGGAGAGGG - Intronic
1018626959 6:165789062-165789084 GTGGGGGCTGGAGGTGAAGATGG + Intronic
1019030047 6:169002052-169002074 ATGTCGGGTGAAAATGAAGGAGG + Intergenic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020979509 7:15050546-15050568 ATGTGGGTTGAAAGTAAAGAGGG + Intergenic
1020979666 7:15052382-15052404 ATGTGGGTTGAAAATAAAGAGGG + Intergenic
1021223779 7:18004689-18004711 ATGTAGGGTGGTTGGGAAGACGG + Intergenic
1022013383 7:26328538-26328560 GTGTAGAGTGGAAGGGAAGAGGG + Intronic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022470770 7:30680856-30680878 ATGTGTGGTGGAGGTGGAGCTGG + Intronic
1022550263 7:31231888-31231910 AGGTGGGGAGGACGTGCAGATGG + Intergenic
1022568307 7:31425616-31425638 ATGTTGAGTGAAATTGAAGAAGG - Intergenic
1022910814 7:34898395-34898417 GAGTGGGGTGGAAGTGGGGAGGG + Intergenic
1027889742 7:83956559-83956581 TTGTGGGGTGGAAGTGTAGGAGG + Exonic
1028480746 7:91301855-91301877 ATATGGGGAGGAAAAGAAGAAGG - Intergenic
1029409504 7:100399661-100399683 AGGTGGGGTGGAAGGGAGAAGGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1030154939 7:106445410-106445432 AAGTGGGATGGAAGTGAGGATGG - Intergenic
1030154957 7:106445482-106445504 AAGTGGGATGGAAGTGAGGATGG - Intergenic
1030621400 7:111795002-111795024 TTGAGGGGTGGAAAGGAAGAGGG + Intronic
1032173680 7:129606922-129606944 AGCTGGAATGGAAGTGAAGAAGG - Intergenic
1033218048 7:139508382-139508404 AAGTGGGGTGTCAGTGAAGATGG + Intergenic
1033257576 7:139815567-139815589 GTGTGGGATGGAAGTAAATATGG - Intronic
1034084725 7:148312912-148312934 AAGTGGGGGGGATGTGAAGGAGG + Intronic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034380034 7:150683866-150683888 ATGTTGGGAGGAGGTGAGGAAGG - Intergenic
1034390266 7:150781693-150781715 ATGTGGGTTGTAAGAAAAGAAGG - Intergenic
1034449963 7:151132030-151132052 CTGTGGGATGCAAGTGGAGAGGG + Intronic
1034928847 7:155144359-155144381 ATGTGGGGTGAAGGGGAGGAGGG + Intergenic
1035433823 7:158842656-158842678 CTGATGAGTGGAAGTGAAGAAGG + Intergenic
1035659517 8:1336311-1336333 AGAAAGGGTGGAAGTGAAGAAGG + Intergenic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1035941038 8:3901358-3901380 GTGTTGATTGGAAGTGAAGATGG + Intronic
1037624379 8:20594427-20594449 ATGTGGGGAGGATGTCAAGGTGG + Intergenic
1039403719 8:37294916-37294938 ATGGGCCGTGGAAGTGGAGAAGG - Intergenic
1039886513 8:41657090-41657112 TTGTGGGGTGGAGGTGTTGAGGG - Intronic
1041494385 8:58469602-58469624 AGGTGGGGTGGAAATGGAGAGGG - Intergenic
1042664705 8:71192483-71192505 AGGTGGGGAGGAAGTGAGGGTGG + Intergenic
1043403503 8:79906914-79906936 TTGTGGGGTGGTAGAGATGAGGG + Intergenic
1045459373 8:102412687-102412709 AACTGGGGCAGAAGTGAAGATGG - Exonic
1045573412 8:103393351-103393373 ATGTGGGGTGCATCTCAAGAGGG - Intergenic
1045686159 8:104714294-104714316 ATCTGGGGTGGAAGGGAAACAGG + Intronic
1046805325 8:118473637-118473659 ATGTGGAGTGCAAGTGAGGAGGG - Intronic
1047025179 8:120815894-120815916 GGGTAGGGTGGAAGTGGAGATGG + Intergenic
1047366907 8:124219881-124219903 ATGTGGTTTGGAAGAGAGGAGGG + Intergenic
1047514545 8:125542254-125542276 TTGTGGAGGGCAAGTGAAGAAGG + Intergenic
1047676843 8:127211931-127211953 ATGTGAGGTGGACAGGAAGAGGG - Intergenic
1048375052 8:133815996-133816018 AGGTGTGGTGGAAGGGATGAAGG + Intergenic
1048854448 8:138674344-138674366 GTGTGTGGAGGAGGTGAAGAAGG - Intronic
1049311771 8:141937360-141937382 AGGTGGGAGGGAAGGGAAGAGGG - Intergenic
1049320363 8:141993001-141993023 ATGTGGGGTGGAAGGTATGTGGG - Intergenic
1049533214 8:143166766-143166788 ATCTAGGGAGGAAGTGGAGAGGG + Intergenic
1050664654 9:7921776-7921798 GGGTGGGGTGGGAGTGAGGAGGG + Intergenic
1050668330 9:7967322-7967344 CTGTAGGGTGGAGGTGAAGTGGG - Intergenic
1050710909 9:8462177-8462199 AAGTGAGGAGGAAGGGAAGAAGG - Intronic
1051424209 9:16917371-16917393 ATGTGTCGTGGAAGAGAAAAGGG + Intergenic
1051522045 9:18000339-18000361 ATGTTGGGGGGAAGGAAAGAAGG - Intergenic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051824564 9:21205669-21205691 ATATGGGGAGCAAGTGGAGAGGG - Intergenic
1051825670 9:21215857-21215879 ATGTGGGGAGCAAGCGGAGAGGG - Intronic
1051826500 9:21226732-21226754 ATGTGGGGAGCAAGTGGAGAGGG - Intronic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1052266479 9:26579388-26579410 GTGTGGGGTGGAGGTGAGGAGGG + Intergenic
1053436670 9:38080073-38080095 AAGGGGGGTGGAGGTGAGGATGG + Intergenic
1055398785 9:75900974-75900996 ATGCAGGGTGTAAGTAAAGAGGG + Intronic
1055497105 9:76866825-76866847 AAGTAGGGAGGAAGTTAAGAGGG + Intronic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057602753 9:96472774-96472796 TGGAGGGGAGGAAGTGAAGAAGG - Intronic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1058212254 9:102183790-102183812 ATGTAGAGAGGAAGAGAAGAAGG - Intergenic
1058507256 9:105678669-105678691 ATGAGGAGTGGAAGGGCAGAGGG + Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059142662 9:111868963-111868985 ATGTGGAGGGGAAGAGAAAATGG + Intergenic
1059162578 9:112049209-112049231 ATGTGGGCTGAAAGAGAAAAAGG + Intronic
1059248064 9:112865126-112865148 ATGTGGGGTGTATGTGTAGGGGG - Intronic
1059369286 9:113812627-113812649 ATGTGGTGTGGACTTGAAGAAGG - Intergenic
1059940040 9:119349770-119349792 CTGTGGAGGGGAAGTGCAGAGGG + Intronic
1060626580 9:125118696-125118718 ATGTGGGGTGGGGGTGGTGAGGG - Intronic
1060792410 9:126495396-126495418 TTTTGTGGTGGAAATGAAGACGG - Intronic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1061233130 9:129326596-129326618 TTGTGGGGTGGAAGTGAGAGGGG + Intergenic
1061507793 9:131041430-131041452 ATGTGTGGTGGGTGGGAAGATGG + Intronic
1061626887 9:131845868-131845890 ATGTGGGGTGCAAGAGAGGCTGG + Intergenic
1062125408 9:134858088-134858110 AAGTGGGGTGGCAGTGAGCAGGG - Intergenic
1185689004 X:2137626-2137648 ATGGGGGGAGGTAATGAAGATGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186397144 X:9221598-9221620 ATGAAGGATGGAAGTAAAGATGG - Intergenic
1186432681 X:9518391-9518413 GAGTAGGGTGGAAATGAAGAAGG - Intronic
1186692155 X:11989508-11989530 AAGTGAGGGGGAAGTGAGGATGG + Intergenic
1187277655 X:17830063-17830085 ATGTGCGAGGGAAGTGGAGAGGG - Intronic
1187578706 X:20585792-20585814 ATGTAGGGTTTAAGTGAAGAAGG + Intergenic
1187906821 X:24074631-24074653 ATGTGGGGTGGTAGAGTTGAGGG - Intronic
1187972586 X:24673820-24673842 ATGGGAGGTGGAAGTGAAGTAGG + Intergenic
1188303468 X:28533051-28533073 AAGAAGGGTGGAAGGGAAGAGGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189648015 X:43155352-43155374 CTTTTGGGTGGAATTGAAGAGGG - Intergenic
1190391947 X:49940820-49940842 ATTGGGGGTGGCAGTGAAGAAGG + Intronic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1190652108 X:52577458-52577480 ATGTAGGGTGGAACTGCCGAGGG - Intergenic
1190738277 X:53269982-53270004 GTGTGGAGTGAAAGAGAAGAGGG - Intronic
1192169201 X:68844056-68844078 ATGGGGGGTGGAGGTGGGGAGGG - Intergenic
1192447770 X:71223461-71223483 ATGTTGGATGAAAGCGAAGAAGG + Intronic
1192601608 X:72470253-72470275 CTCTGGGGTGGAAGTTGAGATGG - Intronic
1193659954 X:84245512-84245534 CGGGGGGGTGGAAGTGAAGATGG - Intergenic
1194820678 X:98502881-98502903 CTGTGGGGTGTGAGTGAAAAGGG - Intergenic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195375052 X:104218840-104218862 ATGGCGGGTGGTAGTGGAGATGG + Intergenic
1195455080 X:105059251-105059273 GGGTGGGGTGGAAGTGGAGATGG - Intronic
1195578799 X:106478884-106478906 ATATGGGGTGGAGGGGAAGAAGG + Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195879730 X:109579987-109580009 AGGTGGGGTGGGAGTGAGGGTGG - Intergenic
1196053232 X:111327747-111327769 GAGTGAGGTGGAAGTGGAGAGGG + Intronic
1196898784 X:120362924-120362946 GTGTGGGGTGGCAGTCAGGATGG - Intronic
1197314999 X:124954805-124954827 AGGTGAGGTGGAACTGTAGATGG - Intronic
1197857957 X:130937877-130937899 GTTGGGGGTGGGAGTGAAGAAGG + Intergenic
1198882645 X:141297770-141297792 GATTGGGGTGGAAGTGGAGATGG + Intergenic
1198960994 X:142183009-142183031 ATGTGGGGGAGAAGTGAGGATGG + Intergenic
1199253527 X:145692670-145692692 CTGTGGGGTGAAAAAGAAGAAGG - Intergenic
1199693660 X:150328277-150328299 GGGTGGGGTGGAAGTGGAGGTGG - Intergenic
1199767225 X:150950037-150950059 AAGTGGGGTTGATGTGAGGAGGG + Intergenic
1201119887 Y:10864810-10864832 GTGTGGGGTGGAATGGAATAGGG - Intergenic
1201470529 Y:14329322-14329344 TTGTGGGGAGGAAGTGTACAGGG - Intergenic