ID: 1115346585

View in Genome Browser
Species Human (GRCh38)
Location 14:32349020-32349042
Sequence CCCTCTAGGACCTTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115346576_1115346585 25 Left 1115346576 14:32348972-32348994 CCCCTCTAACCAGACAGAGTGCT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG 0: 1
1: 0
2: 0
3: 13
4: 96
1115346578_1115346585 23 Left 1115346578 14:32348974-32348996 CCTCTAACCAGACAGAGTGCTTG 0: 1
1: 0
2: 0
3: 2
4: 129
Right 1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG 0: 1
1: 0
2: 0
3: 13
4: 96
1115346577_1115346585 24 Left 1115346577 14:32348973-32348995 CCCTCTAACCAGACAGAGTGCTT 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG 0: 1
1: 0
2: 0
3: 13
4: 96
1115346580_1115346585 16 Left 1115346580 14:32348981-32349003 CCAGACAGAGTGCTTGAGGTAGA 0: 1
1: 0
2: 1
3: 3
4: 117
Right 1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG 0: 1
1: 0
2: 0
3: 13
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115346585 Original CRISPR CCCTCTAGGACCTTTGTTAC TGG Intronic
901568616 1:10140642-10140664 CCATCTAGAACCTTTGCTCCTGG + Intronic
905035337 1:34914468-34914490 TCCTCTAGGACCCTCGTTAGGGG + Intronic
905682340 1:39883240-39883262 CCCTTTAAGACCTTTGCCACAGG + Intronic
907513643 1:54980218-54980240 CCCTCCAGGACCCTAGTTCCTGG - Intergenic
907964661 1:59317584-59317606 CCCTCTATGCCCTTTGTTCCTGG - Intronic
910545768 1:88415850-88415872 CCCTGTAGGACTTTTCTTGCAGG - Intergenic
910911847 1:92243266-92243288 CCCTTTAGGACCATTCTTAATGG + Intronic
913430881 1:118789305-118789327 CCCTCTAGGAACTCTGTCCCAGG - Intergenic
915844871 1:159252564-159252586 CCCTCTGGGAGCTTTGTCCCAGG - Intergenic
916244579 1:162674793-162674815 CTCTCTAGGACCTCTTTAACTGG + Intronic
1065517301 10:26537128-26537150 CTCTCTAAGACCTTTCTTAGAGG + Intronic
1067722548 10:48740100-48740122 ACCTCTAGGAGCTTTGTTTAAGG - Intronic
1070344716 10:75530672-75530694 CCCACTAGGCCCTTGGTTTCAGG + Intronic
1072240847 10:93494681-93494703 CCCTCCAGGACCTTCTTTTCTGG - Intergenic
1076370917 10:129952985-129953007 CTCTCTTTGACCTTTGTGACAGG + Intronic
1078294780 11:10057039-10057061 CCCTCTGGGAGCTTTGTCCCAGG - Intronic
1079814618 11:25039667-25039689 ACCTCTAGGATCTTAGTTGCAGG - Intronic
1081616231 11:44593017-44593039 TCCTCTAACAGCTTTGTTACAGG - Intronic
1082666129 11:55978341-55978363 CCCTCTAGGAACTTTATCATTGG + Intergenic
1083682240 11:64357031-64357053 CCCTCTAGGCCCTGAGGTACAGG + Exonic
1084450505 11:69233924-69233946 CCCTCTAAGAGGTTTGTTCCTGG + Intergenic
1087889487 11:103520514-103520536 CTCTCTGGGGCCTCTGTTACTGG - Intergenic
1088724563 11:112622700-112622722 CCCTCAGGGACTTTTCTTACTGG - Intergenic
1091854431 12:3727990-3728012 CCCTCAAGGAACTTAGTGACAGG - Intronic
1098128425 12:67323268-67323290 CCCTCTGGGAGCTTTGTTCCAGG - Intergenic
1099719461 12:86342130-86342152 CCCTCTGGGAGCTTTGTTTCAGG - Intronic
1102503814 12:113371494-113371516 CCCTCTGGGACCTTAGTGTCTGG + Intronic
1105016468 12:132788819-132788841 CCCTCTGGGACCTATGCTCCAGG + Intronic
1107942339 13:45386002-45386024 CCCTTTAGGAGCTTTGTAGCGGG - Intergenic
1110035082 13:70672902-70672924 CCCTCTGGGAGCTTTGTTCCAGG + Intergenic
1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG + Intronic
1118527484 14:66662021-66662043 CCCTCTAGGAGCTCTGTCCCAGG - Intronic
1120881642 14:89418441-89418463 CCCTCTTGAACCTTTGTTAGGGG - Intronic
1122439643 14:101721536-101721558 CTCTTTAGTACCTTTATTACCGG - Intergenic
1130620104 15:85453492-85453514 CCCTCTGGGAACTTTGTCCCAGG + Intronic
1132802257 16:1760204-1760226 CCCTATAGCACCCTTGTTAGAGG - Intronic
1146836184 17:36112766-36112788 CCCACTGGGACTTTAGTTACAGG - Intergenic
1149750608 17:59141907-59141929 CCTGGTAGGACCTTTGCTACTGG + Intronic
1153771044 18:8416634-8416656 GCTTCCAGGACCTTTGTTAGTGG - Intergenic
1153785323 18:8529061-8529083 TCCTCTGGGAGCTTTGTTGCAGG - Intergenic
1155370716 18:25097517-25097539 CCTTCTAGGAGTTTTGTCACTGG + Intronic
1156396724 18:36705817-36705839 CCCTTTAGGACTTTTCCTACAGG + Intronic
1160181996 18:76644724-76644746 CCCTCTGGGAGCTTTGTCCCAGG + Intergenic
1167569258 19:50276745-50276767 CCCTCTTGGACCTTTATTGGGGG - Exonic
925646722 2:6044091-6044113 CCCTCTAGGAGCTCTGTCCCGGG - Intergenic
930456575 2:51614175-51614197 CCCACCAGGACTTTAGTTACAGG + Intergenic
932893257 2:75613868-75613890 CCCTCAAGGACCTTATTTATAGG - Intergenic
937287792 2:120763994-120764016 CCCTCTAAGAACTTTCCTACCGG + Intronic
944023676 2:195137733-195137755 TCCTCTAGTGCCTTTGTTGCTGG - Intergenic
944720091 2:202415157-202415179 CCATCTAGGACTTTTATAACTGG + Intronic
1169049247 20:2562179-2562201 CCCTCTAGGCCCTGTGGTGCTGG - Intronic
1169192163 20:3665176-3665198 CACTCTACGACATCTGTTACCGG + Intergenic
1170315685 20:15039035-15039057 CCTATTAGGTCCTTTGTTACAGG - Intronic
1173031425 20:39364769-39364791 CACTCCATGACCTTTGTCACTGG - Intergenic
1183024674 22:35055790-35055812 CCCTCTAGAACATTTTTTCCAGG - Intergenic
1183397103 22:37577945-37577967 CCCTGTAGCACCTTGGTTTCAGG + Intronic
1183709570 22:39494986-39495008 CCCTCTATGACATTTCTTCCTGG + Intergenic
1184115028 22:42417338-42417360 CCCTCTAGGCCCCTTGGTGCTGG - Intronic
1184788104 22:46681567-46681589 CCCTCTAGGACTTTTGTTCTGGG + Intergenic
951384228 3:22025348-22025370 CCCTCTAGGACTTTAGTTATAGG - Intronic
951889463 3:27554907-27554929 CCATCTGGGTCCTTTGTTCCTGG - Intergenic
954332694 3:49899315-49899337 CCCTCTGGGGCCTTTGTCAGTGG + Intronic
958542077 3:95490919-95490941 CCCTCTAGGATCTTGTTCACAGG + Intergenic
960342876 3:116496988-116497010 CCTTCTGGGAGCTTTGTTCCAGG - Intronic
960841512 3:121963600-121963622 CCCTCTGGGAGCTTTGTCCCAGG - Intergenic
973550979 4:52036018-52036040 CCCTCAAGGAGCTTAATTACAGG + Intronic
977729277 4:100331761-100331783 CCCTCTGGGAGCTTTGTCCCAGG - Intergenic
978208187 4:106104767-106104789 CCCTCTGGGAGCTTTGTCCCAGG - Intronic
978683832 4:111415370-111415392 CCCTCTGGGAGCTCTGTTCCAGG + Intergenic
983628414 4:169826195-169826217 CCCTCTAGGAGCTCTGTCCCAGG + Intergenic
984333533 4:178358068-178358090 CCCTCTAACACCTTTTTTTCTGG + Intergenic
990988502 5:61662375-61662397 CCCTCTGGGACCTTGGTTCCAGG - Intronic
991475735 5:67017330-67017352 CCCTTTAGGAACTTTGTTAAGGG + Intronic
995661176 5:114484928-114484950 CCCTCGAGGCCTTATGTTACAGG - Intronic
995826249 5:116302960-116302982 GCCTCTTGGACATCTGTTACTGG - Intronic
997522003 5:134528911-134528933 ACCTCTTGGACCACTGTTACTGG - Intronic
1000031658 5:157406953-157406975 CCCCCTGGGAGCTTTGTTTCAGG - Intronic
1001441591 5:171747967-171747989 CTCTCTGGGGCCTTTTTTACAGG + Intergenic
1006024810 6:31139961-31139983 CCCTCAAGGACCTTTCTGCCTGG + Exonic
1007738340 6:43995647-43995669 CCCTCTAGGCCCTCTGTCCCAGG - Intergenic
1009354325 6:62722793-62722815 ACCTCTAGGAACTTTTTTCCTGG + Intergenic
1010746247 6:79565279-79565301 CCCTCAATGACCTTTATTCCTGG + Intergenic
1012820495 6:104080515-104080537 CCCACCAGGACTTTAGTTACAGG - Intergenic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1017245090 6:152216059-152216081 CCATCTAGGAAATTGGTTACAGG + Intronic
1018284312 6:162220616-162220638 CCCTCTTTTACCTTGGTTACTGG - Intronic
1020702290 7:11498749-11498771 CCCTCTAGGAGCTTTGTCCCAGG - Intronic
1023909394 7:44542531-44542553 CTCTCTAGGTCCTCTGTTCCCGG + Intergenic
1029111077 7:98213299-98213321 CCCTCTCCAACCTTTGTTATAGG + Intergenic
1038195372 8:25362138-25362160 CCGTTTAGGACCTTTCTTCCAGG + Intronic
1041561718 8:59226047-59226069 CCCTCTGGGAGCTTTGTCCCAGG - Intergenic
1043163036 8:76870156-76870178 CCCTCTTGGAACTTTGCTAGAGG + Intergenic
1045594340 8:103635585-103635607 CCCTCTGGGAGCTTTGTCACAGG + Intronic
1046332014 8:112729836-112729858 CCCTCTAGGGGCTTTGTAAAGGG - Intronic
1049349838 8:142158673-142158695 CCCTCTAGGGCCTGTGGAACCGG - Intergenic
1051726005 9:20088829-20088851 CCCTCTGGGAGCTCTGTTCCAGG - Intergenic
1053427832 9:38022626-38022648 CCCGCTAGGGCCTGTGTTATGGG - Intronic
1193425620 X:81337853-81337875 CCCTCAAGGAGCTCTGTTCCAGG + Intergenic
1194201456 X:90957792-90957814 CCCTCTGGGAACTTTGTCCCAGG - Intergenic
1194247886 X:91537731-91537753 CCCTCTAGGACCTCTGTCCCAGG - Intergenic
1194854724 X:98915094-98915116 CCCTCTGGGAGCTTTGTCCCAGG + Intergenic
1196582281 X:117392309-117392331 CCCTTTGGGACCTCTGTTCCAGG - Intergenic
1196932583 X:120696170-120696192 CCCTCTGGGAACTTTGTCCCAGG - Intergenic
1199307056 X:146279352-146279374 CCCTCTGGGAGCTCTGTTCCAGG + Intergenic
1200547296 Y:4533247-4533269 CCCTCTGGGAACTTTGTCCCAGG - Intergenic
1200566903 Y:4779260-4779282 CCCTCTAGGACCTCTGTCCCAGG - Intergenic
1202275977 Y:23119772-23119794 CCCCCTAGCAGCTTGGTTACAGG - Intergenic
1202290051 Y:23300919-23300941 CCCCCTAGCAGCTTGGTTACAGG + Intergenic
1202428970 Y:24753491-24753513 CCCCCTAGCAGCTTGGTTACAGG - Intergenic
1202441821 Y:24916598-24916620 CCCCCTAGCAGCTTGGTTACAGG + Intergenic