ID: 1115347468

View in Genome Browser
Species Human (GRCh38)
Location 14:32358658-32358680
Sequence GGATACGTGCAGGTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115347462_1115347468 19 Left 1115347462 14:32358616-32358638 CCATGATTCCAATAACACTGGGA 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1115347468 14:32358658-32358680 GGATACGTGCAGGTTGTAGATGG 0: 1
1: 0
2: 0
3: 6
4: 74
1115347465_1115347468 11 Left 1115347465 14:32358624-32358646 CCAATAACACTGGGAGGTGGATG 0: 1
1: 0
2: 3
3: 30
4: 382
Right 1115347468 14:32358658-32358680 GGATACGTGCAGGTTGTAGATGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115347468 Original CRISPR GGATACGTGCAGGTTGTAGA TGG Intronic
911742286 1:101400294-101400316 GGAGAAGTGCAGGGTGCAGAGGG + Intergenic
915788127 1:158638388-158638410 GCATATGTTCAGGTTGGAGAAGG + Intronic
920056824 1:203198865-203198887 GGATGCGGGCAGCTTCTAGAAGG + Intergenic
922159520 1:223068327-223068349 AGATCGGGGCAGGTTGTAGATGG + Intergenic
1063065597 10:2605606-2605628 GGAGACGTGCAGATTGAAGAGGG + Intergenic
1066029307 10:31402192-31402214 GGAAAAGTGTAGGTTGGAGATGG + Intronic
1076917385 10:133431101-133431123 GGATATGTGCAGGTGGTGGCTGG + Intergenic
1076937480 10:133575860-133575882 GGATATGTGCAGGTGGTGGCTGG + Intergenic
1080425231 11:32148690-32148712 GGATAAGTGCAGAGTGAAGAGGG + Intergenic
1088547034 11:110969477-110969499 GGAGACTTAGAGGTTGTAGATGG - Intergenic
1091097416 11:132837394-132837416 GGATAAGTGAAGGAAGTAGAAGG - Intronic
1091394039 12:142760-142782 GGATACATCTAGGTTGCAGAAGG + Intronic
1102437661 12:112938118-112938140 AGAAACGTGCAGGTTTTACATGG - Intergenic
1102989853 12:117307223-117307245 GGATACCTGGAGGTGGTAGGGGG + Intronic
1104081962 12:125436911-125436933 GGACACTTGCAGGTGGCAGAAGG - Intronic
1112094771 13:96120214-96120236 GGTTCCCTGCAGGTTGCAGAGGG + Intronic
1115347468 14:32358658-32358680 GGATACGTGCAGGTTGTAGATGG + Intronic
1126098945 15:45108181-45108203 GGATAGGTCCTGGTTGTACAGGG + Exonic
1126104844 15:45140914-45140936 GGATAAGTCCTGGTTGTACAGGG - Exonic
1134648969 16:15893222-15893244 GAACACGTGGAGGTTGTTGAAGG + Intergenic
1151099079 17:71535027-71535049 AGAGACATGCAGGTTGTAAAGGG + Intergenic
1156349831 18:36294753-36294775 GGATGCATGCAGGTTGAGGACGG + Intergenic
1158890738 18:61869658-61869680 GAATAAGTACAGGTTTTAGAAGG + Intronic
1160239603 18:77113558-77113580 GGAGACTTGCAGGATGCAGAAGG + Intronic
925922756 2:8648207-8648229 GGATACGTGCAGGGTAAAGGTGG - Intergenic
930827853 2:55712369-55712391 AGATAAATGCAGGTTGGAGAGGG + Intergenic
934847013 2:97668007-97668029 GGAAACCTGGAGGTTGAAGAGGG - Intergenic
935706121 2:105859317-105859339 GGATATGATCAGGTTGTAAATGG - Intronic
939401000 2:141693880-141693902 GAAGACATTCAGGTTGTAGATGG + Intronic
941725835 2:168859177-168859199 GGATAAGTGTTGATTGTAGAAGG - Intronic
946333604 2:219023725-219023747 AGACACCTGCAGGTGGTAGAGGG - Intronic
946440704 2:219692867-219692889 GGAGAAGTGCAGGTTGTGGAAGG + Intergenic
1174018218 20:47506450-47506472 GGAGACCTGCAGTGTGTAGAAGG + Intronic
1181940417 22:26471467-26471489 GGATACTTGCTGGTTCTAGCTGG - Intronic
1182125893 22:27815678-27815700 GGATGGGTGCAGGTTGGAGAAGG + Intergenic
1184628498 22:45756738-45756760 AGCTAAGTGCAGCTTGTAGAAGG - Intronic
1185298403 22:50065861-50065883 AGATGCGTGCAGGTTGTTCACGG + Intronic
954925442 3:54229878-54229900 GGACACCTGCAGGTTACAGAGGG + Intronic
956110058 3:65861211-65861233 GGAAACGTGGAGGCTGAAGAAGG + Intronic
963126633 3:141822518-141822540 GGATAGGTGCAGGGTGTTGTTGG + Intergenic
964622450 3:158731330-158731352 GAATATCTGGAGGTTGTAGAAGG + Intronic
969108648 4:4827646-4827668 GGAGAGGTGCTGGTTGGAGATGG - Intergenic
971054813 4:22900071-22900093 AGAATCCTGCAGGTTGTAGATGG + Intergenic
973963414 4:56134831-56134853 GGAGATGAGCAGGTTCTAGAGGG + Intergenic
974884696 4:67804180-67804202 GGTAACGAGCAAGTTGTAGAGGG + Intergenic
982128865 4:152208875-152208897 GGATATGGGCAGTTTGTAGAAGG - Intergenic
985862785 5:2487504-2487526 GGATACTTGCAGGTGGCATAGGG + Intergenic
985980320 5:3457121-3457143 GGAGACGTCCAGGTGGCAGAGGG - Intergenic
986118218 5:4801839-4801861 GGCTAGGTGCAGGTTGTTAAGGG - Intergenic
986693850 5:10334718-10334740 GGATGCGGGCAGCTTCTAGAAGG + Intergenic
987804753 5:22749806-22749828 GGACGCATGCAGGTTGTAGGAGG - Intronic
993015272 5:82528335-82528357 GGAGAAGTGCAGATTGAAGAGGG + Intergenic
996572145 5:124943763-124943785 GGATATGTCCAGGTAGTATATGG + Intergenic
996819635 5:127612270-127612292 GGACACGTACAGGTAGCAGAGGG - Intergenic
999470964 5:151855111-151855133 GGAGCCGTGCAGGTAGCAGATGG - Exonic
1002962102 6:1924836-1924858 GCATAAAAGCAGGTTGTAGAGGG + Intronic
1003760805 6:9176815-9176837 GTATACGTGCAAGTTGGTGATGG - Intergenic
1005359294 6:25015748-25015770 GGATACTTACATATTGTAGAGGG + Intronic
1007464988 6:42045595-42045617 GGATTCGTGCAGGTTGAGAAAGG - Intronic
1008177836 6:48289895-48289917 GGATTCGTGCTGGTTTTGGAGGG - Intergenic
1008525181 6:52400465-52400487 GGATTCATGCAGCTTGTTGATGG + Intronic
1010643981 6:78364895-78364917 GGATACTTGAAGGTTGGTGAAGG - Intergenic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1020978024 7:15032027-15032049 AGAGATGTGCAGGTTGTTGATGG + Intergenic
1022020548 7:26396591-26396613 GGTTAGGTGCAGATTGTGGAGGG + Intergenic
1022226244 7:28366878-28366900 GGACAGATGCAAGTTGTAGAGGG + Intronic
1022473988 7:30698547-30698569 GGATGGGTGAAGGTTGTACAGGG - Intronic
1023883277 7:44333783-44333805 GCATCCGTGCAGGTTCAAGAAGG + Intronic
1028896817 7:96050656-96050678 GGATAAATACAGGCTGTAGAGGG - Intronic
1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG + Intronic
1035873543 8:3162153-3162175 GGATACCTGCAGGGTGTACCCGG + Exonic
1036782523 8:11659366-11659388 GGATGAGTGGGGGTTGTAGAGGG - Intergenic
1039033355 8:33332905-33332927 AGATATGTGCAGATTGTGGATGG - Intergenic
1047647796 8:126887003-126887025 GGAATCATGCAGGTTGGAGAAGG - Intergenic
1048781940 8:138011748-138011770 GGATAGGTGGTGGTAGTAGAAGG + Intergenic
1049138373 8:140927555-140927577 TGAGAAATGCAGGTTGTAGAAGG - Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055247874 9:74268653-74268675 GAATACGTGTAGGCTGTAGATGG + Intergenic
1185714637 X:2331223-2331245 GTAAAGGTGCAGGTTGAAGATGG - Intronic
1198769279 X:140111670-140111692 AAATATGTGCAGGTTGTAGATGG + Intergenic
1199533542 X:148876739-148876761 GGATACCTGCAGGTTCTCCAGGG - Intronic