ID: 1115347662

View in Genome Browser
Species Human (GRCh38)
Location 14:32360696-32360718
Sequence ACACACTCAATGGCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115347662 Original CRISPR ACACACTCAATGGCCAAAAC TGG (reversed) Intronic
901479410 1:9514480-9514502 ACCCTCTCAGTGGACAAAACTGG - Intergenic
901586200 1:10295178-10295200 ACACACGAAGTGACCAAAACAGG - Intronic
903522112 1:23959085-23959107 ACACCCTCGAGGGCCACAACCGG - Intergenic
905993858 1:42363979-42364001 GAACTCTCAATGGCCAAAGCTGG + Intergenic
906586104 1:46980019-46980041 TCATACTGAATGGGCAAAACTGG + Intergenic
908180813 1:61603580-61603602 ACACATTCAATTGCCACGACTGG + Intergenic
909176138 1:72362418-72362440 AAACACTCATTGACCAAAAATGG + Intergenic
910531499 1:88241462-88241484 TCATACTGAATGGCAAAAACTGG + Intergenic
910829483 1:91445892-91445914 TCATACTGAATGGCAAAAACTGG + Intergenic
914000041 1:143686076-143686098 ACCCAGTAAATGGGCAAAACAGG - Intergenic
915759792 1:158299113-158299135 TCATACTGAATGGGCAAAACTGG - Intergenic
916193634 1:162202988-162203010 ACACACACAATCACCAAAAAAGG - Intronic
916660081 1:166915460-166915482 ACCCAATCAATCTCCAAAACAGG + Exonic
918774902 1:188614931-188614953 AAAAACTCAATGGGAAAAACAGG + Intergenic
918956405 1:191214110-191214132 TCATACTGAATGGGCAAAACTGG - Intergenic
919651924 1:200158576-200158598 ACATACTCAAAGGCTAAAACAGG + Intronic
921218298 1:212955181-212955203 CTACATTCAATGGCCAAAAATGG - Intronic
921439171 1:215163518-215163540 TCACACTGAATGGGCAAAAGCGG - Intronic
922298229 1:224271076-224271098 ACAATCTAAATGTCCAAAACAGG + Intronic
922411804 1:225383680-225383702 ACACTTTCCATGTCCAAAACAGG - Intronic
923356543 1:233161490-233161512 ACACACTCATTGGCACATACTGG + Intronic
924808413 1:247379875-247379897 ACACACCATATGGCCAAAGCAGG - Intergenic
1064862154 10:19838619-19838641 TCACACTCAATTTCCAAAACAGG - Intronic
1065080182 10:22121526-22121548 TCATACTGAATGGGCAAAACTGG - Intergenic
1065340090 10:24696434-24696456 TCCCACTCATTGGCGAAAACGGG - Intronic
1065676115 10:28176394-28176416 GCACTCCCAATGGCCAAAGCTGG + Intronic
1065949004 10:30634510-30634532 AAATTCCCAATGGCCAAAACTGG + Intergenic
1066757480 10:38725312-38725334 TCATACTGAATGGGCAAAACTGG + Intergenic
1066819761 10:39470724-39470746 TCACACTGAATGGTCAAAACTGG + Intergenic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1068598186 10:58926745-58926767 AAGCTCTCAATGGCCCAAACTGG + Intergenic
1069337018 10:67364364-67364386 TCATACTGAATGGCAAAAACTGG + Intronic
1071367847 10:84918426-84918448 TCATACTAAATGGGCAAAACTGG + Intergenic
1071859805 10:89660826-89660848 ACACTCCCAATGGCCAAAATTGG + Intergenic
1071927010 10:90421658-90421680 ACACACTCTATGGAGAAAAATGG - Intergenic
1072883546 10:99252209-99252231 TCATACTGAATGGGCAAAACTGG + Intergenic
1074818078 10:117158664-117158686 AAAAAATCAATGGCCAAGACTGG - Intergenic
1075260112 10:120955980-120956002 AGACTCTCAATGGCCAATAAAGG + Intergenic
1076226635 10:128781838-128781860 TCACACTCATTGGCCAAAAGAGG - Intergenic
1076286502 10:129302682-129302704 AAACTCTCAATGGCCAAACTTGG + Intergenic
1076340051 10:129739195-129739217 TCATACTGAATGGGCAAAACTGG + Intronic
1076545147 10:131240201-131240223 ACACATTTAATGCCCAGAACTGG - Intronic
1076878480 10:133228722-133228744 AGACTTTCAATGGCCAAAGCAGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078036530 11:7811246-7811268 TCATACTGAATGGCAAAAACTGG - Intergenic
1078560758 11:12369981-12370003 TCATACTCGATGGCAAAAACTGG + Intergenic
1079068318 11:17318682-17318704 AAACTCTCACTGGCCAAATCTGG + Intronic
1079621816 11:22564943-22564965 ACACACTGAATGGGCAAAAGCGG - Intergenic
1080118305 11:28645311-28645333 TCATACTGAATGGGCAAAACTGG + Intergenic
1080294668 11:30713051-30713073 ACACACTCAAGGGCCAGACGAGG + Intergenic
1081037424 11:38166098-38166120 TCATACTGAATGGCAAAAACTGG - Intergenic
1081325780 11:41742798-41742820 TCATACTGAATGGCAAAAACTGG + Intergenic
1082554894 11:54552685-54552707 TCATACTGAATGGGCAAAACTGG + Intergenic
1085424878 11:76395433-76395455 AAACACCCAATGGCCAAAGCTGG - Intronic
1085804446 11:79621989-79622011 ACACACTCAAATGTCAAAAGGGG + Intergenic
1085884794 11:80509133-80509155 TCATACTGAATGGGCAAAACTGG + Intergenic
1086030212 11:82345659-82345681 TCACACTGAATGGGCAAAACTGG + Intergenic
1091870314 12:3884409-3884431 ACACTGTCAGTGGCTAAAACAGG + Intergenic
1092679012 12:10956463-10956485 TCATACTAAATGGGCAAAACTGG + Intronic
1093054355 12:14540056-14540078 ACACACACACTGGTCAAAATAGG + Intronic
1093181768 12:15975020-15975042 ACACTCCCAATGGCCAAATCTGG - Intronic
1095127471 12:38498776-38498798 ACAAGCTTAATGTCCAAAACAGG + Intergenic
1096924787 12:55131994-55132016 ACACACTCAATTTCAAAAATGGG - Intergenic
1097546021 12:61002458-61002480 TCACACTGAATGGGCAAAAACGG - Intergenic
1097945061 12:65358473-65358495 AAGCTCTCAATGGCCAAACCTGG - Intronic
1099531652 12:83789437-83789459 TCATACTGAATGGCAAAAACTGG - Intergenic
1099809280 12:87560211-87560233 TCATACTGAATGGGCAAAACTGG + Intergenic
1103221013 12:119245567-119245589 ATATACTTAATGGCTAAAACTGG - Intergenic
1104310611 12:127651250-127651272 AGACACTCCATGGGCACAACAGG + Intergenic
1104737698 12:131148027-131148049 AAGCTCTCAATGGCCAAAGCTGG - Intergenic
1104944594 12:132409976-132409998 TCACACGGATTGGCCAAAACAGG + Intergenic
1105914211 13:24897210-24897232 ACACACTCTGTGGCCCAGACTGG - Intronic
1106403780 13:29455547-29455569 ACACACTCAATGCCCATTAAAGG + Intronic
1107472455 13:40703376-40703398 AAGCTCTCAATGGCCAAACCTGG + Intergenic
1108168639 13:47718695-47718717 ACACACTAAATGGCCCATTCAGG + Intergenic
1108218064 13:48204901-48204923 TCATACTGAATGGGCAAAACTGG + Intergenic
1108765121 13:53619292-53619314 TCATACTGAATGGCAAAAACTGG - Intergenic
1110641105 13:77825195-77825217 AGACTCTCATTGGCCAAAAATGG + Intergenic
1110698069 13:78515307-78515329 TCATACTGAATGGGCAAAACTGG - Intergenic
1110833972 13:80063428-80063450 ACTCACTTCATAGCCAAAACAGG - Intergenic
1110932620 13:81241299-81241321 ACACACACAGTGGCCATAATGGG - Intergenic
1112785278 13:102944604-102944626 ACCCACTCAAAGGGCAAATCTGG + Intergenic
1114516726 14:23304962-23304984 TCTCACTCCATGGCCTAAACTGG - Intronic
1115046670 14:29003307-29003329 TCATACTGAATGGCAAAAACTGG + Intergenic
1115347662 14:32360696-32360718 ACACACTCAATGGCCAAAACTGG - Intronic
1116236155 14:42281829-42281851 TCATACTGAATGGGCAAAACTGG - Intergenic
1116320657 14:43458105-43458127 TCATACTGAATGGACAAAACTGG + Intergenic
1116550475 14:46231211-46231233 TCATACTGAATGGGCAAAACTGG + Intergenic
1119880037 14:78092549-78092571 ACACACTCAATGGGCAAGATGGG - Intergenic
1120961096 14:90125682-90125704 GCACTCTCAGTGGCCAAAGCTGG + Intronic
1122999458 14:105284703-105284725 CCACACTCAATGGTGAAGACTGG + Intronic
1202846291 14_GL000009v2_random:179933-179955 TCATACTGAATGGCAAAAACTGG - Intergenic
1202915754 14_GL000194v1_random:170538-170560 TCATACTGAATGGCAAAAACTGG - Intergenic
1123428869 15:20197007-20197029 TCATACTGAATGGGCAAAACTGG - Intergenic
1123452114 15:20374557-20374579 TCATACTGAATGGGCAAAACTGG - Intergenic
1124583220 15:30980799-30980821 TAACTCTCAATGGCCAAAGCTGG + Intronic
1127189699 15:56516464-56516486 AGACAATAAATAGCCAAAACTGG + Intergenic
1127491407 15:59467807-59467829 TCATACTGAATGGGCAAAACTGG - Intronic
1128782557 15:70371809-70371831 TCATACTGAATGGGCAAAACTGG + Intergenic
1129800861 15:78413174-78413196 ACACACTGATTCGCCAAAAATGG - Intergenic
1130180231 15:81619664-81619686 AAGCTCTTAATGGCCAAAACTGG - Intergenic
1135044575 16:19144681-19144703 ACACTCCCACTGGCCGAAACAGG - Intronic
1136863342 16:33716627-33716649 AGATACTCTATGGCTAAAACTGG - Intergenic
1138735421 16:59245301-59245323 ACATGCTCAATGGCCAAAAAGGG - Intergenic
1140989157 16:80191556-80191578 ACACACCAAATGGCCAGCACAGG - Intergenic
1141074486 16:80991064-80991086 AGACTCTCAGTGGCCAAAGCTGG + Intronic
1141328623 16:83086765-83086787 AAACAAGCAATGGCAAAAACTGG + Intronic
1203124833 16_KI270728v1_random:1564779-1564801 AGATACTCTATGGCTAAAACTGG - Intergenic
1143033099 17:3978662-3978684 ACACACTCCAGGGCCTCAACTGG + Intergenic
1143436031 17:6926255-6926277 TCTCACTCTATGGCCCAAACTGG - Exonic
1145326421 17:21832939-21832961 AGATACTCTATGGCCAGAACTGG + Intergenic
1150165581 17:62938738-62938760 TCATTCACAATGGCCAAAACTGG - Intergenic
1157781336 18:50442189-50442211 ACACAGTCAATGGCGCATACTGG - Intergenic
1159143816 18:64428291-64428313 TCATACTGAATGGGCAAAACTGG + Intergenic
1159528244 18:69621680-69621702 AGACACTCAATGGAGTAAACTGG + Intronic
1162943928 19:14031249-14031271 ACACACTCCACTGCCACAACTGG + Intergenic
1164982131 19:32622011-32622033 CCACACTCGATGTCCAGAACTGG + Intronic
1168349220 19:55666513-55666535 CCAGACTCAATGCCCACAACAGG - Intronic
1168443126 19:56389014-56389036 TCACACTCATTGGCTACAACTGG + Intronic
928350682 2:30550965-30550987 AAACTCCCAATGGCCAAAGCTGG - Intronic
929417465 2:41757990-41758012 AAACTCCCAATGGCCAAAGCGGG + Intergenic
930856082 2:56020101-56020123 ACCCACTAAATAGCCAAAGCAGG - Intergenic
933594237 2:84266388-84266410 TCATACTGAATGGGCAAAACTGG + Intergenic
934152864 2:89165381-89165403 TCATACTGAATGGGCAAAACTGG - Intergenic
934668363 2:96190251-96190273 AGACTCCCAATGACCAAAACTGG + Intronic
936236930 2:110750366-110750388 AAACTCCCAATGGCCAAAGCTGG - Intronic
943136153 2:183915243-183915265 TCATACTGAATGGCAAAAACTGG - Intergenic
943681632 2:190774347-190774369 TCATACTGAATGGCAAAAACTGG - Intergenic
944375103 2:199032474-199032496 TCATACTGAATGGCAAAAACTGG + Intergenic
944922600 2:204430994-204431016 TCATACTGAATGGGCAAAACTGG - Intergenic
945185322 2:207134057-207134079 TTACACTCACTGGCCAAGACGGG + Intronic
946123762 2:217540646-217540668 AAGCTCTCAATGGCCAAAACTGG + Intronic
946675899 2:222158847-222158869 ACAAAGTCAATGGCAAAACCTGG - Intergenic
947032315 2:225810844-225810866 ATAAAATCAATGGCAAAAACTGG - Intergenic
948430877 2:237918091-237918113 ACACCCTCAGTGCCCAACACTGG + Intergenic
1170537153 20:17351741-17351763 TCATACTGAATGGGCAAAACTGG + Intronic
1171772479 20:29334495-29334517 TCATACTGAATGGACAAAACTGG + Intergenic
1172859007 20:38033053-38033075 ACAGACTAAAAGGTCAAAACAGG + Intronic
1173234861 20:41235663-41235685 TCATACTGAATGGCAAAAACTGG + Intronic
1173477285 20:43369618-43369640 TCATACTGAATGGGCAAAACTGG + Intergenic
1174559762 20:51422413-51422435 ACACTCTGGATGGGCAAAACAGG + Intronic
1174582329 20:51580690-51580712 GCACACTCAATGGCCCAGCCTGG - Intergenic
1176635106 21:9185185-9185207 TCATACTGAATGGCAAAAACTGG - Intergenic
1177524328 21:22272464-22272486 TCATACTAAATGGGCAAAACTGG - Intergenic
1177529777 21:22344081-22344103 TCACTCTCAATGGACAAAATGGG + Intergenic
1178063215 21:28874721-28874743 AGACACTGAATGGGCAAAAAGGG - Exonic
1182925732 22:34122705-34122727 ACAAAGTCAATGCCCAAAATTGG - Intergenic
1183136743 22:35896261-35896283 AAAGACTCCATGGCCAAAAATGG - Intronic
949872898 3:8604359-8604381 ACACACACAGTGGCCCCAACCGG + Intergenic
951286257 3:20817502-20817524 TCATACTGAATGGACAAAACTGG - Intergenic
951338412 3:21454631-21454653 TCATACTGAATGGGCAAAACTGG + Intronic
953110518 3:39933178-39933200 ACATACTCATGGGCCAAATCTGG + Intronic
955327788 3:58022703-58022725 ACACACTCACTGGCCAATCTGGG - Intronic
955667526 3:61366324-61366346 TCATACTGAATGGGCAAAACTGG + Intergenic
956019525 3:64919181-64919203 ACAAACTCAATGGACAGGACAGG - Intergenic
957700361 3:83702336-83702358 TCATACTGAATGGGCAAAACTGG - Intergenic
957733382 3:84174309-84174331 AAAAACAAAATGGCCAAAACTGG + Intergenic
958654282 3:96981149-96981171 TCATACTGAATGGGCAAAACTGG - Intronic
961982883 3:131100057-131100079 TCATACTGAATGGCAAAAACTGG - Intronic
962699577 3:137983867-137983889 TCATACTGAATGGGCAAAACTGG + Intergenic
962837164 3:139199591-139199613 ACACTTTCAATTGTCAAAACTGG + Intronic
962966118 3:140356117-140356139 TCACAGTCAATGGGAAAAACAGG - Intronic
963109422 3:141674218-141674240 TCATACTGAATGGGCAAAACTGG + Intergenic
963387588 3:144616707-144616729 TCATACTGAATGGGCAAAACTGG - Intergenic
963567023 3:146942772-146942794 TCATACTGAATGGCAAAAACTGG - Intergenic
963761224 3:149288791-149288813 CCACACCCAATGGCCACAAGGGG + Intergenic
968729764 4:2264152-2264174 ACTCACCCAGTGGCCAAAGCAGG - Intergenic
968935788 4:3609681-3609703 AGTCAATCAATGGCCCAAACTGG - Intergenic
969173896 4:5384856-5384878 ACTCACTCCATGGCCACACCTGG - Intronic
969976111 4:11103515-11103537 TCATACTGAATGGGCAAAACTGG + Intergenic
970636576 4:18017098-18017120 AGACACCCATTGGCCAAACCTGG + Intronic
971463258 4:26925570-26925592 TCATACTGAATGGGCAAAACTGG + Intronic
973237288 4:47919131-47919153 TCATACTGAATGGCAAAAACTGG - Intronic
974288147 4:59896005-59896027 TCATACTGAATGGGCAAAACTGG + Intergenic
975977855 4:80119607-80119629 TCATACTGAATGGCAAAAACTGG + Intronic
976263455 4:83168090-83168112 TCATACTGAATGGGCAAAACTGG + Intergenic
976394483 4:84541278-84541300 TCATACTGAATGGGCAAAACTGG + Intergenic
976592897 4:86867024-86867046 TCATACTGAATGGGCAAAACTGG + Intergenic
977433791 4:96967406-96967428 TCATACTCAATGGGCAAAAACGG + Intergenic
978051243 4:104202919-104202941 TCATACTGAATGGCAAAAACTGG + Intergenic
978546255 4:109875382-109875404 ACCCACTGAGTGGCCAAACCTGG + Intergenic
979520546 4:121661484-121661506 TCATACTGAATGGGCAAAACTGG + Intergenic
981984357 4:150835900-150835922 TCATACTGAATGGGCAAAACTGG - Intronic
982247831 4:153371834-153371856 ATACAGTCAAAAGCCAAAACAGG - Intronic
982604616 4:157498669-157498691 GAGCACCCAATGGCCAAAACTGG - Intergenic
983304512 4:165968646-165968668 CCACATTCAATGGCCTAAAAGGG + Intronic
984063811 4:175023629-175023651 TCATACTGAATGGACAAAACTGG + Intergenic
986350615 5:6875879-6875901 ACACTCTCAGTGGCTAGAACTGG - Intergenic
986490502 5:8284712-8284734 TCATACTCAATGGGCAAAAATGG + Intergenic
987192503 5:15492751-15492773 ACAAATTCAATGGCCACATCTGG - Intergenic
988382139 5:30511419-30511441 ACTCACTCAATGGGGAAAAACGG + Intergenic
991404796 5:66291314-66291336 ACCCACTCAAGGGCCCATACAGG - Intergenic
992302445 5:75397264-75397286 ACATAATCAAAGGCTAAAACAGG + Intronic
994527009 5:100918116-100918138 TCATACTGAATGGGCAAAACTGG - Intergenic
996181793 5:120428499-120428521 TCATACACAATGGGCAAAACTGG - Intergenic
996311716 5:122113418-122113440 CCACACCCAATGGCTAAAGCTGG - Intergenic
996386123 5:122912568-122912590 TCATACTGAATGGGCAAAACTGG - Intronic
996526672 5:124487575-124487597 TCATACTGAATGGGCAAAACTGG - Intergenic
996798103 5:127373132-127373154 AAAGACACAATGGCCAAAGCTGG - Intronic
1000437081 5:161225390-161225412 GCATACTGAATGGCTAAAACTGG - Intergenic
1000521866 5:162305202-162305224 TCACACTAAATGGGCAAAACTGG + Intergenic
1000714501 5:164623775-164623797 AGACACTCAAGGGCAAAAGCAGG + Intergenic
1002379227 5:178813632-178813654 AGACACTGAATGGACAAAACTGG + Intergenic
1003966873 6:11260604-11260626 ATTCACTCAATGCCCAGAACTGG - Intronic
1004408736 6:15360510-15360532 TCACACTCAGTTGCCCAAACTGG + Intronic
1008396303 6:51011727-51011749 AAGCTCCCAATGGCCAAAACTGG - Intergenic
1008562675 6:52737549-52737571 ACACACCCAATGGGAAAAAATGG - Intergenic
1008575133 6:52853122-52853144 TCATACTGAATGGGCAAAACTGG - Intronic
1008661154 6:53669514-53669536 AATCACTCAATAGCCATAACTGG + Intergenic
1010543515 6:77122393-77122415 AAGCTCTCAATGGCCAAAGCTGG + Intergenic
1011037737 6:82996273-82996295 AGACTCCCAATGGCCAAAGCTGG + Intronic
1013124091 6:107166264-107166286 TCATACTGAATGGGCAAAACTGG - Intronic
1013258604 6:108414813-108414835 TCATACTGAATGGGCAAAACTGG + Intronic
1013437879 6:110131016-110131038 ACACAACAAATGGCCAAAAATGG - Intronic
1018335922 6:162789196-162789218 CCTCACTCAATGATCAAAACAGG - Intronic
1020756023 7:12203844-12203866 GAACTCCCAATGGCCAAAACTGG - Intergenic
1021667171 7:22995547-22995569 GAACACCCAATGGCCAAAGCTGG + Intronic
1022246988 7:28570283-28570305 AAGCTCTCAAAGGCCAAAACTGG - Intronic
1023992473 7:45136884-45136906 GCACTCCCAATGGCCAAAGCTGG - Intergenic
1024380354 7:48688970-48688992 TCATACTGAATGGGCAAAACTGG + Intergenic
1028369935 7:90079990-90080012 ACACATTAAATGACCAATACCGG + Intergenic
1029727215 7:102415010-102415032 ACACTGTCAATGGTAAAAACTGG - Intronic
1032471403 7:132181802-132181824 ACACCCACTATGGGCAAAACCGG - Intronic
1034144490 7:148856710-148856732 AAACTCTCAGTGGCCAAAGCTGG + Intronic
1036189054 8:6653340-6653362 ACATACTGAATGGCAAAAACTGG + Intergenic
1037126801 8:15361648-15361670 ACACACTCTATGGCTCAAAAGGG + Intergenic
1038550968 8:28468383-28468405 TCACACTGAATGGCAAAAAGAGG + Intronic
1038846350 8:31233362-31233384 TCATACTGAATGGCAAAAACTGG - Intergenic
1039718835 8:40140319-40140341 TCATACTGAATGGGCAAAACTGG - Intergenic
1040395609 8:46997398-46997420 ATGCACTCTAGGGCCAAAACTGG + Intergenic
1040612794 8:49002209-49002231 TCATACTGAATGGGCAAAACTGG + Intergenic
1040766810 8:50921014-50921036 TCATACTGAATGGGCAAAACTGG + Intergenic
1041647615 8:60269733-60269755 ATACACTCAGTGGCCAGCACAGG - Intronic
1042666375 8:71210947-71210969 ACAAACTCAAGGGCCACAAGTGG - Intronic
1043025294 8:75059832-75059854 TCATACTGAATGGCCAAAACTGG + Intergenic
1046733710 8:117753143-117753165 ACACTACCAATAGCCAAAACTGG + Intergenic
1047583778 8:126246221-126246243 GCGCTCTCAATGGCCAAAGCTGG - Intergenic
1048268358 8:133007344-133007366 ACACACTCAATGGAAACAAAAGG - Intronic
1049612371 8:143561557-143561579 ACACACACAAGGGGCAACACAGG + Intronic
1053441650 9:38121184-38121206 ACACACTGAGTCGCCAACACTGG - Intergenic
1054740347 9:68800201-68800223 CCTCACTCACTGGCCCAAACCGG - Intronic
1056898515 9:90575501-90575523 AAACTCCCAGTGGCCAAAACTGG + Intergenic
1058080337 9:100694621-100694643 TCATACTGAATGGGCAAAACTGG + Intergenic
1058179151 9:101776057-101776079 AAACATTAACTGGCCAAAACTGG - Intergenic
1058962947 9:110008828-110008850 CCACACCCATTGGCCAGAACTGG - Intronic
1058962959 9:110008916-110008938 CCACATCCAATGGCCAGAACTGG + Intronic
1188579183 X:31689011-31689033 TCATACTGAATGGGCAAAACTGG + Intronic
1191086598 X:56574474-56574496 AAACACTCAATGGCCACAGATGG - Intergenic
1191096412 X:56677723-56677745 TCACACTGAATGGCAAAAACTGG + Intergenic
1191124132 X:56936261-56936283 TCATACTGAATGGGCAAAACTGG - Intergenic
1191165245 X:57383218-57383240 TCATACTGAATGGCAAAAACTGG + Intronic
1193028387 X:76871016-76871038 TCATACTGAATGGGCAAAACTGG + Intergenic
1193035044 X:76940540-76940562 TCATACTGAATGGGCAAAACTGG + Intergenic
1193362665 X:80594442-80594464 TCATACTGAATGGGCAAAACTGG + Intergenic
1193516670 X:82474190-82474212 TCACACTGAATGGGCAAAACTGG - Intergenic
1193781892 X:85713059-85713081 TCATACTGAATGGGCAAAACCGG + Intergenic
1194478123 X:94385646-94385668 TCACACTAAATGGCCAAAGATGG + Intergenic
1195098378 X:101528375-101528397 TCATACTGAATGGCAAAAACTGG + Intronic
1196511423 X:116516707-116516729 TCATACTGAATGGGCAAAACTGG - Intergenic
1196589057 X:117464290-117464312 TCATACTGAATGGGCAAAACTGG - Intergenic
1197023878 X:121723472-121723494 ACAAAATCAATGTACAAAACTGG + Intergenic
1197575217 X:128202967-128202989 TCATACTGAATGGGCAAAACTGG + Intergenic
1197910230 X:131474907-131474929 AAGCACTCAATGACCAAAAATGG + Intergenic
1199498719 X:148485204-148485226 GCACTCCCAATGGCCAAAAATGG + Intergenic
1200471454 Y:3591156-3591178 TCACACTGAATGGGGAAAACTGG - Intergenic
1201771836 Y:17623205-17623227 ACACAGTCCATGGCACAAACAGG + Intergenic
1201829719 Y:18282781-18282803 ACACAGTCCATGGCACAAACAGG - Intergenic
1201915410 Y:19176540-19176562 ACATACGGAATGGGCAAAACTGG + Intergenic
1201952660 Y:19582577-19582599 ACATACTGAATGGGCAAAACTGG - Intergenic
1202017829 Y:20430627-20430649 TCATACTGAATGGGCAAAACTGG - Intergenic