ID: 1115349159

View in Genome Browser
Species Human (GRCh38)
Location 14:32374562-32374584
Sequence AGTTGTGAAGGGCCTACTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115349159 Original CRISPR AGTTGTGAAGGGCCTACTTA AGG Intronic
901566251 1:10118258-10118280 ATTTGTAAAGGGCCTTCTTTGGG + Intronic
902353082 1:15873060-15873082 GGTGGTGGAGGGCCTGCTTATGG + Exonic
905093631 1:35450080-35450102 AGCCCTGAAGGGCCTAGTTATGG - Intronic
906119246 1:43377156-43377178 TGTGGTGAAGGGCCTCCTTTAGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
906954013 1:50357755-50357777 AGCTGTGAATGGCGTACTAACGG - Intergenic
907622019 1:55991295-55991317 ATCTGTGAAGTGCCTATTTATGG + Intergenic
908441161 1:64156221-64156243 AGTGGCAAAGGGCCTACTGAAGG + Intronic
908638849 1:66199697-66199719 ATTTGTGAATCTCCTACTTAAGG - Intronic
916660973 1:166921909-166921931 AGTGGTGAAGGTGCTATTTAGGG + Intronic
920433694 1:205935095-205935117 CCTTGTGTAGCGCCTACTTAGGG + Intronic
921037145 1:211391474-211391496 TGTTGTGAAGGGCTTTCCTATGG - Intergenic
921075378 1:211696550-211696572 TGTTGTGAAGTGCCTTCTCAGGG + Intergenic
922611042 1:226928538-226928560 GGATGTGAAGGGCCTCCTCAAGG + Intronic
1066462509 10:35624222-35624244 AGTTGGGTAGGACCCACTTATGG + Intergenic
1067781092 10:49208081-49208103 AGTTGGGAAGGGCTTTCTCAAGG + Intergenic
1073099851 10:101000692-101000714 AGTGGGGAAGGGACTTCTTAGGG - Exonic
1075943840 10:126414910-126414932 ATTTGTGGTGGGCCTAATTATGG + Intergenic
1081102467 11:39022429-39022451 ACTTTTCAAGGGCCAACTTAAGG - Intergenic
1082602288 11:55172984-55173006 CGTGGTGAAGGACCTACTTGAGG + Intergenic
1085541249 11:77272122-77272144 AGTTGTGAAAGACTTAATTATGG - Intronic
1090695816 11:129240438-129240460 ACTTGAGATGGGCCTACTGAAGG - Intronic
1095442386 12:42250603-42250625 GGATGTGAAGGGCCTCTTTAAGG - Intronic
1097410513 12:59246958-59246980 AGATGTGAAGGCCCTCCTCAAGG + Intergenic
1099678256 12:85789843-85789865 GGATGTGAAGGACCTCCTTAAGG + Intergenic
1100222212 12:92517423-92517445 AGAAGTGGAGGGCCTACTTAAGG + Intergenic
1101170532 12:102088228-102088250 ATTTGAGAAGGGCTTAATTAAGG - Intronic
1101997337 12:109534544-109534566 AATTGGGAAGGGCCTAGTTTGGG - Intronic
1104277004 12:127338373-127338395 AGTTGTGCAGGACATACTTAGGG - Intergenic
1108143391 13:47450321-47450343 AGATGTGAAGGACCTCCTCAAGG - Intergenic
1108160795 13:47636740-47636762 AGATGTGAAGGACCTCTTTAAGG + Intergenic
1108991345 13:56661737-56661759 GGATGTGAAGGGCCTCTTTAAGG - Intergenic
1110656180 13:78002757-78002779 GGATGTGAAGGACCTATTTAAGG + Intergenic
1110687462 13:78392005-78392027 AGATGTGAGGGGCCTATGTAAGG - Intergenic
1113033076 13:106016013-106016035 AGATGTGAAGGACCTCTTTAAGG - Intergenic
1115054398 14:29105020-29105042 AGTTGTGAAAGGCATAATTTTGG + Intergenic
1115349159 14:32374562-32374584 AGTTGTGAAGGGCCTACTTAAGG + Intronic
1118931214 14:70242819-70242841 GGATGTGAAGGACCTCCTTAAGG - Intergenic
1202843314 14_GL000009v2_random:144278-144300 AGAGGGGAAGGGCCTACTAAAGG - Intergenic
1202912710 14_GL000194v1_random:134516-134538 AGAGGGGAAGGGCCTACTAAAGG - Intergenic
1123884069 15:24706659-24706681 AGATGTGAAGGGCCTCTTCAAGG - Intergenic
1125070030 15:35543791-35543813 AGTTGTGGAAGACCTACTTATGG - Intronic
1125097803 15:35874602-35874624 AGTTTTGAAGGGCCTCCTGCTGG + Intergenic
1131565423 15:93480997-93481019 AATTGGGAAGGGTATACTTAGGG - Intergenic
1144104150 17:11971157-11971179 AGATGAGAAGGCCCCACTTAGGG - Intergenic
1149037547 17:52152348-52152370 AGTTGGGATGAGCCCACTTAGGG - Intronic
1158210432 18:55043263-55043285 AGATGTGAAGGGCCTCTTCAAGG + Intergenic
1163727973 19:18933145-18933167 TGCTGTGAAGGACCTGCTTAGGG - Intronic
926993209 2:18702652-18702674 AGTTTTTAATGGCCTACTTATGG - Intergenic
927035774 2:19174587-19174609 TTTTGTGAAGGGCCTACTATTGG + Intergenic
929049139 2:37819868-37819890 AGTTCTGTAGGGCCTACTGTGGG - Intergenic
930726695 2:54688567-54688589 AGTTGTTAATGGCCTGCTTGGGG - Intergenic
938834434 2:135085478-135085500 TATTGTGAAGGGCTTAATTAAGG + Intronic
942370716 2:175281288-175281310 ATTTGTTGAGGGCCTACTTTAGG + Intergenic
942859014 2:180587323-180587345 GGATGTGAAGGACCTATTTAAGG - Intergenic
944767443 2:202878802-202878824 GGTTGTGAATGCTCTACTTAAGG + Exonic
944815151 2:203368758-203368780 AGTTGGGAAAGGCCTCCTGAAGG + Intronic
945527007 2:210900586-210900608 AGTTGTTGAGTGCCTAATTAAGG - Intergenic
947101760 2:226628635-226628657 AGTGGTGAAGTTCCTAATTATGG - Intergenic
1169940463 20:10931757-10931779 AGATGTGAAGGACCTATTTAAGG + Intergenic
1170380251 20:15751678-15751700 AGCTTTGAAGGTCCTACATAAGG + Intronic
1170717640 20:18845744-18845766 AGGTGTGGAGGGGATACTTAGGG + Intergenic
1177966810 21:27737762-27737784 AGATATGAAGGGCCAACTAAGGG - Intergenic
1178275855 21:31236306-31236328 AGTTGTGAAGGGCCAACTCTAGG - Intronic
1179016758 21:37600558-37600580 AGGTCTGAAGGGCTTAGTTAGGG + Intergenic
949747802 3:7315183-7315205 AGTTATGAGGGGCCTAACTAAGG - Intronic
949987148 3:9550408-9550430 AGATGGGAAGGGCTTACTTGAGG - Intronic
951438085 3:22688461-22688483 GGATGTGAAGGGCCTCTTTAAGG + Intergenic
952353933 3:32567430-32567452 TGTTGTGAGGGGAGTACTTAGGG + Intronic
952515341 3:34098506-34098528 GGATGTGAAGGACCTCCTTAAGG + Intergenic
954304121 3:49716619-49716641 AGGTGTGAACGGCCTAAATAGGG + Intronic
958849328 3:99304953-99304975 GGTTGTGAAGGGCCTCTTCAAGG + Intergenic
959724225 3:109525783-109525805 AGATGTGAAGGACCTCCTCAAGG + Intergenic
959848146 3:111057327-111057349 AGGTGTCAAGGACCCACTTAAGG - Intergenic
961613089 3:128156104-128156126 AGTGGTGAAGGACATACTTTTGG + Intronic
962661505 3:137605391-137605413 AGTAGTGAAAGGCATTCTTAAGG - Intergenic
962999120 3:140660386-140660408 GGATGTGAAGGACCTATTTAAGG + Intergenic
964044358 3:152304710-152304732 AGTTGTGAAGTTTCTCCTTAGGG - Intronic
965110224 3:164411453-164411475 AGATGTGAAGGGCCTCTTCAAGG - Intergenic
965706917 3:171518290-171518312 GGATGTGAAGGGCCTCTTTAAGG + Intergenic
970619156 4:17799286-17799308 ATATGTGAAGGGCCAACATATGG + Intergenic
971019608 4:22520617-22520639 ATTTGTGATGGGCTTACTGAAGG + Intergenic
971300565 4:25439111-25439133 TTTTGTGAAGAGCCTATTTAAGG + Intergenic
975520288 4:75293353-75293375 AGATGTGAAGGGCCTCTTCAAGG - Intergenic
982732945 4:158975996-158976018 AGCTGTGAAGGACCTCCTCAAGG - Intronic
992187020 5:74254110-74254132 AGGTGCCAAGGGCATACTTAGGG + Intergenic
994158783 5:96532246-96532268 AGATTTAAAGGGCCTACTGAGGG + Intronic
1001839309 5:174860656-174860678 GGTTGTGAAGGGCCTCTTCAAGG - Intergenic
1008286021 6:49651704-49651726 AATTGTGAAGAGCATACTTAAGG - Intergenic
1009566824 6:65320759-65320781 ACTTGTTAAGGGCCACCTTAAGG - Intronic
1011308001 6:85950471-85950493 GGATGTGAAGGGCCTCTTTAAGG + Intergenic
1014430827 6:121368433-121368455 AGTATTGGAGGTCCTACTTAGGG + Intergenic
1019001444 6:168756532-168756554 AGTTGTGAAGGACCTGGGTAAGG + Intergenic
1021447695 7:20750994-20751016 AGTGGTCAAAGTCCTACTTAAGG - Intronic
1026636388 7:72085639-72085661 ATTTGTCAAGGGACTACTTGGGG + Intronic
1027460339 7:78444360-78444382 AATTGTGAGGGACCTACTGATGG - Intronic
1028705617 7:93841546-93841568 AGTTGTGATGGACCTTCTTAAGG + Intronic
1030465261 7:109893650-109893672 AGTTCTAAAGGGTCTACTAAAGG + Intergenic
1030573218 7:111252688-111252710 ACTTGTGAAGAATCTACTTAAGG + Intronic
1030937088 7:115598022-115598044 AGATGTGAAGGGCCTCTTCAAGG + Intergenic
1033220805 7:139525163-139525185 TGTTCTGAAGGGGCTACTGAGGG + Intronic
1034339712 7:150343902-150343924 ATGTGTGAAAGGACTACTTAGGG + Intergenic
1041349913 8:56937970-56937992 AGGTGTCAGGGACCTACTTAAGG - Intergenic
1041753787 8:61290618-61290640 AGTTGTGAATAGACTTCTTAGGG - Intronic
1043343282 8:79268087-79268109 GGATGTGAAGGACCTATTTAAGG + Intergenic
1043734570 8:83727501-83727523 AGTTGTGAAGGACCTCTTCAAGG - Intergenic
1052515795 9:29477885-29477907 AGATGTGAAGATTCTACTTAAGG - Intergenic
1053549381 9:39059822-39059844 AATTATGAAGTCCCTACTTAGGG + Intergenic
1055399533 9:75908399-75908421 AATTGTGATGGGCCTACTGTAGG + Intronic
1055902851 9:81261200-81261222 GGATGTGAAGGACCTCCTTAAGG + Intergenic
1062384772 9:136304835-136304857 ACTTGGGAAGGGTCAACTTAAGG - Intronic
1203754897 Un_GL000218v1:116813-116835 AGAGGGGAAGGGCCTACTAAAGG - Intergenic
1191004047 X:55691325-55691347 GGATGTGAAGGGCCTCCTGAAGG + Intergenic
1191209231 X:57867588-57867610 AGTTGTGAAGGACCTCTTCAAGG + Intergenic
1194680312 X:96843907-96843929 ACTTGTGAAGCCCCTTCTTATGG - Intronic
1194936749 X:99959455-99959477 AGTTCTGCAGGGCCAACTTCAGG + Intergenic
1195973709 X:110501816-110501838 AGTTGTGAAGGGCAGAGGTAGGG + Intergenic
1197008281 X:121530568-121530590 AGTTGGAAATGGCCTACATATGG + Intergenic
1198623810 X:138545250-138545272 GGTTAGGAAGGGACTACTTAAGG - Intergenic
1199524522 X:148777549-148777571 GGATGTGAAGGACCTACTCAAGG - Intronic
1200719079 Y:6583389-6583411 GGATGTGAAGGGCCTATTCAAGG - Intergenic
1201168523 Y:11234421-11234443 AGAGGGGAAGGGCCTACTAAAGG - Intergenic