ID: 1115349979

View in Genome Browser
Species Human (GRCh38)
Location 14:32383635-32383657
Sequence CAATAAGCCCAGGCCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115349979 Original CRISPR CAATAAGCCCAGGCCTGCTC TGG Intronic
900130884 1:1086685-1086707 CAATGGACCCAGGCCAGCTCAGG + Intronic
902682946 1:18056592-18056614 CAGTAAGGCCAGCCCTGCCCTGG - Intergenic
904436330 1:30500102-30500124 ACATTAGCCCAGGCCTGCACAGG + Intergenic
908901904 1:68965094-68965116 CAATTAGCCCTGCCCTACTCAGG - Intergenic
913166316 1:116190066-116190088 CCATGTGCCCAGGACTGCTCTGG - Intergenic
914675392 1:149904099-149904121 CAAGAAGCAGAGGCCTCCTCTGG - Exonic
916452376 1:164933444-164933466 CTATAAGCTCAAGCCTCCTCGGG - Intergenic
916628591 1:166587370-166587392 AAATAAGCCCACTCCAGCTCAGG - Intergenic
919518039 1:198551100-198551122 AGATGAGCCCAGCCCTGCTCTGG - Intergenic
1063382516 10:5594784-5594806 CCCTGAGCCCAGCCCTGCTCAGG - Intergenic
1072748339 10:97957950-97957972 CAATACCCCCAGGGCTGCACAGG + Intronic
1074441871 10:113484760-113484782 CAAAGAGCCCATGCCTGCTCAGG + Intergenic
1076403038 10:130195635-130195657 CCATCAGGCCAGGCCTTCTCAGG + Intergenic
1082996956 11:59262453-59262475 CAAGAAGACCACACCTGCTCGGG - Intergenic
1084949004 11:72654478-72654500 CAAGGTGACCAGGCCTGCTCAGG + Intronic
1087827528 11:102782858-102782880 GAATTAGCCCAGGCCTACACAGG - Intergenic
1089997032 11:122918280-122918302 CAAAAATCCCAGGCCTCCTGAGG + Intronic
1092560056 12:9603255-9603277 CAATAAGCCCAAGACAGCACTGG + Intronic
1096608779 12:52787538-52787560 CAGGAAGGCCAGGCCTGCTCTGG + Intergenic
1098584031 12:72135120-72135142 CAATAAGCCCAGGGCTTGTGGGG + Intronic
1102815394 12:115861100-115861122 CTAAGAGCCCAGGCCTGCTGTGG + Intergenic
1103209650 12:119157005-119157027 CCATATGCCCAGGCCTGAGCTGG - Exonic
1104230737 12:126881446-126881468 CAATCAGCCCAGGCATGTTGTGG - Intergenic
1104279244 12:127359068-127359090 CAATGAGCCCTGGTCTCCTCAGG + Intergenic
1104386791 12:128357768-128357790 CCAGAAGCCCAGGACTGCACTGG - Intronic
1105896076 13:24718389-24718411 AATTAAGCCCAGGCCTGCCTGGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107418547 13:40223723-40223745 AAATAAGCCCAGGCCTAATGGGG + Intergenic
1111981592 13:95021858-95021880 CATTCAGCCCAGCCCTGCTGAGG - Intronic
1113531579 13:111031524-111031546 CTGTAGGCCCAGGCCAGCTCTGG + Intergenic
1113894495 13:113755085-113755107 CGCCAAGCCCAGCCCTGCTCTGG + Intergenic
1115112642 14:29842011-29842033 CAATTAGCCTAGGCCTACACAGG + Intronic
1115349979 14:32383635-32383657 CAATAAGCCCAGGCCTGCTCTGG + Intronic
1116789124 14:49320731-49320753 AAATAGCTCCAGGCCTGCTCTGG - Intergenic
1118895184 14:69939936-69939958 CATGAAGCCCATCCCTGCTCTGG - Intronic
1121274805 14:92660232-92660254 GAATAAGCCCACGCAAGCTCAGG - Intronic
1122055245 14:99093695-99093717 CAATTGGCCCAGGCCTGCCACGG + Intergenic
1122292537 14:100687400-100687422 CAGGAATCCCAGGCCTGGTCTGG - Intergenic
1124356213 15:28996701-28996723 TCAGAAGCTCAGGCCTGCTCTGG - Intronic
1127010154 15:54616522-54616544 CTATTAGCCCAGGCCTACACAGG - Intronic
1127966203 15:63924649-63924671 GAATAAGCCCAGGCCCTCTGGGG + Intronic
1129982937 15:79890857-79890879 CAAAAGCCCCAGGCCTGCCCAGG - Intronic
1132783707 16:1642620-1642642 CAATGTGCCCAGTGCTGCTCAGG - Intronic
1137338655 16:47575784-47575806 CTAAAAGCCCAGGCCTGATGTGG + Intronic
1137444444 16:48523255-48523277 CCAGGAGCCAAGGCCTGCTCTGG - Intergenic
1139513561 16:67440703-67440725 CTGTGAGCCCAGGCCTGCCCTGG + Intronic
1140104636 16:71948371-71948393 CAAAAATCCCAGGCCAGCTGTGG - Intronic
1141261789 16:82461139-82461161 CAATAAGCCTACTCCTGGTCAGG + Intergenic
1142311638 16:89317567-89317589 CAAAAAGCACAGGCCTGGTGGGG - Intronic
1147777587 17:42913734-42913756 CAACAAGACTAGGCCAGCTCTGG + Intergenic
1149541154 17:57469133-57469155 CAACAAGGCCAGGGCTGTTCTGG - Intronic
1149593577 17:57849861-57849883 CAATACGCCTCGCCCTGCTCAGG + Intronic
1151887932 17:76934070-76934092 CAATGTGCCCAGCCCTGTTCTGG + Intronic
1152885003 17:82844557-82844579 CAAGAAGCCCAGCCCTCCCCTGG - Intronic
1155123070 18:22842484-22842506 CAATCAGCCCTGGCCTGCAGAGG - Intronic
1158829593 18:61263150-61263172 CAAGATGCCAAGGCTTGCTCTGG - Intergenic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1164462309 19:28459303-28459325 CAAAGGTCCCAGGCCTGCTCTGG + Intergenic
1165578093 19:36838671-36838693 CAGTAAGCCCAGGCCATCTTAGG + Intronic
1166684773 19:44789860-44789882 AAATAAGCCCAGGCCAGCAATGG + Intronic
1167117224 19:47495379-47495401 CAGCCAGCCCAGGCCAGCTCAGG + Intronic
1167347427 19:48955210-48955232 CGACAAGCCCGGGCCTGCCCGGG - Intronic
925364482 2:3302660-3302682 CCAGAAGCCCAGGCCCGCTGCGG + Intronic
927083779 2:19654847-19654869 CCACAAGCCCAGGCATGCCCAGG + Intergenic
927911072 2:26900031-26900053 CAATAACCGCAGGCCTGGCCTGG - Intronic
928316424 2:30250146-30250168 CAATCAGCCCAAACCCGCTCAGG - Intronic
928649822 2:33392307-33392329 CTATAATCCCAGGGCTACTCAGG - Intronic
930536435 2:52650889-52650911 CCAGAAGGCCAGGCATGCTCTGG - Intergenic
934056838 2:88258359-88258381 CAACAAGCCCTGGGCTGCCCTGG - Intergenic
938763744 2:134446769-134446791 CCAGGAGCCCAGACCTGCTCAGG - Intronic
940066057 2:149631252-149631274 CAATGAGCCCAGGCCTACACAGG + Intergenic
940083279 2:149828970-149828992 CGATTAGCTCAGGCCTGCTCAGG - Intergenic
948116164 2:235495210-235495232 CAAGACGCCCAGGCCTGGCCTGG - Intronic
948482077 2:238256569-238256591 AAAGAACCCCAGGCCTGCCCAGG + Intronic
1169846569 20:9999696-9999718 CATGCAGCCCAGGCCTTCTCAGG - Intronic
1173706047 20:45111035-45111057 CAATAAGGCCATGCCTGGTCTGG + Intronic
1174052724 20:47778533-47778555 CAAGAAGCCCTGGCCTGGGCTGG + Intronic
1179534847 21:42044968-42044990 CACTAAGCCCAACCCTCCTCTGG + Intergenic
1181572855 22:23777130-23777152 CAATAAGCCCAGGCCGGGCGCGG + Intronic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1182054168 22:27336798-27336820 GAATATGCCCAGGCCTGCAGAGG + Intergenic
1183058693 22:35322325-35322347 CAGTAAACCCAGGCCTCCGCGGG + Intronic
1183304983 22:37077985-37078007 CAAGAGGGCCAGGCTTGCTCAGG - Intronic
1183688491 22:39375382-39375404 AGAGAAGCCCAGACCTGCTCAGG - Intronic
949656702 3:6229014-6229036 CAGTAAGCCCAGGTCTTCTATGG + Intergenic
956758377 3:72413148-72413170 CTCTCAGCCTAGGCCTGCTCAGG - Intronic
957633575 3:82751218-82751240 AAATAAGCCTAGGCCTCCACAGG + Intergenic
959752139 3:109850296-109850318 CACTAAGCCCAGGACTGCCATGG - Intergenic
960030885 3:113053751-113053773 CATAAAGCACAGGGCTGCTCAGG - Intergenic
961329918 3:126132340-126132362 CACGCACCCCAGGCCTGCTCCGG + Intronic
961415140 3:126751605-126751627 CTAAAAACCCAGGTCTGCTCTGG - Intronic
964472618 3:157070795-157070817 AAAGAAGCCCAGGCCTCCTTAGG + Intergenic
964839664 3:160980050-160980072 CAATAAGGCCAGCCCTACCCTGG - Intronic
980599765 4:135006879-135006901 TATTAAGCCCATGCCTGATCTGG + Intergenic
981676374 4:147347810-147347832 CTATTAGCCTAGGCCTGCACAGG - Intergenic
981890251 4:149727877-149727899 CAGCAAGCTCAGACCTGCTCAGG + Intergenic
985564052 5:606473-606495 CAGAAAGCCCAGGACTTCTCAGG - Intergenic
985694320 5:1331369-1331391 CCACACGCCCAGGCCTGCGCTGG + Intronic
991157463 5:63456105-63456127 AAATTAGCCCAGGCCTACACAGG + Intergenic
997805229 5:136910844-136910866 CCACCAGCCCAGGTCTGCTCAGG + Intergenic
997973746 5:138426103-138426125 GATTAAGTCCAGGCATGCTCTGG - Intronic
997999054 5:138609835-138609857 CAAAAAGCCCAGCCCTGGACAGG - Intergenic
998037458 5:138929017-138929039 AAACCAGCCCAGGCCTGCTGTGG + Intronic
1002098953 5:176847978-176848000 CAAGAAGCCCAGCCCTTCCCTGG - Intronic
1002166608 5:177351578-177351600 CGAGAAGCCCAGGCCTTCCCAGG + Exonic
1002339573 5:178506136-178506158 AAAACAGCACAGGCCTGCTCTGG + Intronic
1002417976 5:179130616-179130638 CAATCAGGCCAGGCCTCTTCTGG - Intronic
1006202960 6:32313139-32313161 CAACATGCACAGGCCTGCTATGG - Intronic
1006203617 6:32319619-32319641 CAACATGCACAGGCCTGCTATGG - Intronic
1006642325 6:35495852-35495874 CAACAAGTCCAGGCCTGACCTGG + Intronic
1007473186 6:42103991-42104013 CGATAAGCCCAGGGCTTGTCGGG - Intronic
1012505375 6:99940765-99940787 CCTTAAGCCCAGGCTTGCTTTGG + Intronic
1012533990 6:100273492-100273514 CAATTAGCCTAGGCCTGCACAGG - Intergenic
1017212187 6:151869076-151869098 CAGTAAGCACAGTCCTGTTCAGG + Intronic
1019513875 7:1431343-1431365 GAATCAGCCCAAGCCTGCCCTGG + Intronic
1021605197 7:22402969-22402991 CCTTCACCCCAGGCCTGCTCTGG + Intergenic
1024261355 7:47576401-47576423 CAATAACCCCAGGACCTCTCAGG + Intronic
1030289529 7:107858510-107858532 CACCAAGCTCAGCCCTGCTCTGG + Intergenic
1030573713 7:111259886-111259908 AAATTAGCCTAGGCCTGCACAGG + Intronic
1031972539 7:128074932-128074954 CAGTGATCCCAGGCCTGCTCAGG + Intronic
1032084131 7:128874694-128874716 CCGCAAGCCCAGGCCAGCTCAGG - Intronic
1032513798 7:132492452-132492474 CAAGAAGCCCAGGCAAGATCTGG + Intronic
1033673561 7:143515660-143515682 CAGTAAGCTCAGGTCTACTCTGG - Intergenic
1034412401 7:150948210-150948232 CAAAAAGCCTAGGCTTGCCCTGG + Intronic
1035361381 7:158315996-158316018 CAACAAGGCCAGCCCTGCTGTGG + Intronic
1036083720 8:5589592-5589614 GCATTAGCCCAGGCCTACTCCGG + Intergenic
1039618423 8:38975034-38975056 CCAGAAGCGCAGGCCCGCTCAGG + Exonic
1040295235 8:46145581-46145603 CAGTCAGCCCAGGACAGCTCTGG + Intergenic
1041496511 8:58491523-58491545 CAAAATGCCCAAGCCTGCCCGGG + Exonic
1041653803 8:60328503-60328525 CAAGAAGCACAGGCATGCACAGG + Intergenic
1042808063 8:72793442-72793464 CACTAAGCCCATTCCTGCTTAGG - Intronic
1047404328 8:124572706-124572728 AAAGTAGCCCAGGGCTGCTCTGG - Intronic
1047713437 8:127574461-127574483 CAATAAGCATAGGCTAGCTCTGG - Intergenic
1048251764 8:132871973-132871995 ACATTAGCCTAGGCCTGCTCGGG - Intronic
1048599934 8:135909162-135909184 GAATGAGTCCACGCCTGCTCAGG - Intergenic
1052765075 9:32632857-32632879 TAATAAGCACAGCACTGCTCTGG + Exonic
1054759417 9:68991337-68991359 CAATAAAACCAGGCATGCTTGGG + Intronic
1057128098 9:92634997-92635019 CCAGGTGCCCAGGCCTGCTCTGG - Intronic
1057428982 9:94977319-94977341 CTGAAAGCCCAGGGCTGCTCCGG - Intronic
1057743765 9:97735200-97735222 GAATAAGCACAGGGCAGCTCTGG - Intergenic
1059335833 9:113567838-113567860 CAATAACCCCAGACCTACTCTGG - Intronic
1059735325 9:117094411-117094433 TAAATAGCCCAGGCCTGCTGAGG + Intronic
1060446256 9:123691023-123691045 CAATAAACCCTGGCAGGCTCAGG + Intronic
1190071514 X:47283727-47283749 CAAGAAGCACAGGCCAGGTCAGG + Intergenic
1192469884 X:71388815-71388837 TAATAAGCACAGCACTGCTCTGG - Exonic
1196309735 X:114149631-114149653 CTACAAGACCAGGCCTGATCTGG - Intergenic
1198998806 X:142607632-142607654 CAAGAGGACCAGGACTGCTCAGG - Intergenic
1199678139 X:150205108-150205130 CAAACTGCCCAGGCCTCCTCAGG + Intergenic