ID: 1115359874

View in Genome Browser
Species Human (GRCh38)
Location 14:32488727-32488749
Sequence GAGTGAAGGACCGTGCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115359874_1115359878 -10 Left 1115359874 14:32488727-32488749 CCAGATAGCACGGTCCTTCACTC 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1115359878 14:32488740-32488762 TCCTTCACTCGTGGCCCTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 62
1115359874_1115359880 -7 Left 1115359874 14:32488727-32488749 CCAGATAGCACGGTCCTTCACTC 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1115359880 14:32488743-32488765 TTCACTCGTGGCCCTAGGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 74
1115359874_1115359885 22 Left 1115359874 14:32488727-32488749 CCAGATAGCACGGTCCTTCACTC 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1115359885 14:32488772-32488794 CCTGACCCCTTGTGCTTCCCAGG 0: 384
1: 1323
2: 1305
3: 1243
4: 1152
1115359874_1115359881 -6 Left 1115359874 14:32488727-32488749 CCAGATAGCACGGTCCTTCACTC 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1115359881 14:32488744-32488766 TCACTCGTGGCCCTAGGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1115359874_1115359887 27 Left 1115359874 14:32488727-32488749 CCAGATAGCACGGTCCTTCACTC 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1115359887 14:32488777-32488799 CCCCTTGTGCTTCCCAGGTGAGG 0: 283
1: 1371
2: 1968
3: 2195
4: 1915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115359874 Original CRISPR GAGTGAAGGACCGTGCTATC TGG (reversed) Intronic
909160068 1:72135474-72135496 GACTGAAGGACAGTGATCTCTGG + Intronic
911683647 1:100747956-100747978 TAGTGAAGAACAATGCTATCAGG + Intergenic
912032437 1:105265578-105265600 CTGTGAGGGACAGTGCTATCCGG - Intergenic
913021510 1:114792540-114792562 CCGTGAGGGACTGTGCTATCTGG - Intergenic
913430162 1:118781477-118781499 CCGTGAAGGATGGTGCTATCTGG - Intergenic
915649023 1:157294176-157294198 CCATGAAGGACTGTGCTATCTGG + Intergenic
915663566 1:157424204-157424226 GTGTGAGGGACTGTGCTATCTGG + Intergenic
915876467 1:159616318-159616340 CCGTGAGGGACAGTGCTATCTGG + Intergenic
921296913 1:213712709-213712731 CAGTGAGGGACGGTGGTATCCGG - Intergenic
923917841 1:238529444-238529466 GAGTGAATGACAGTGGGATCTGG + Intergenic
1063598159 10:7456245-7456267 GAGTGAAGGACCATGATTTCAGG - Intergenic
1068575100 10:58676068-58676090 GAGTGAGGGATGGTGCTATCTGG + Intronic
1071341401 10:84652134-84652156 GAATGAGGGACAGTGCTATCCGG - Intergenic
1075461536 10:122619755-122619777 GAGTGAGGGACGGAGGTATCAGG - Intronic
1076994599 11:291954-291976 GAACGAGGGACCGTGCTCTCAGG + Exonic
1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG + Intronic
1081147150 11:39576849-39576871 GAGTTATGGACCATGCTCTCAGG + Intergenic
1089613937 11:119684750-119684772 GTGTGGAGGAGCGTGCAATCAGG + Intronic
1090720348 11:129466992-129467014 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1090811632 11:130249703-130249725 CAGTGAGGGACTGTGCTATCTGG + Intronic
1091213588 11:133885446-133885468 CAGTGAGGGACAGTGGTATCTGG - Intergenic
1091555611 12:1571064-1571086 GGCTGAAGGACCATGCAATCAGG - Intronic
1093835667 12:23825285-23825307 CCGTGAGGGACAGTGCTATCCGG - Intronic
1097488375 12:60234616-60234638 CCGTGAGGGACGGTGCTATCTGG + Intergenic
1097619447 12:61922528-61922550 CAGTGAAGGACTGTGCTGTGAGG + Intronic
1097619450 12:61922543-61922565 CTGTGAGGGACGGTGCTATCCGG + Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1103169216 12:118799363-118799385 CCGTGAGGGACTGTGCTATCCGG - Intergenic
1103311791 12:120015579-120015601 GAGTCAAGGACTGTGCACTCAGG + Intronic
1103718951 12:122963281-122963303 GAGTGAAGGAAAATGCTACCGGG + Intronic
1106874292 13:34054981-34055003 CAGTGAGGGACTGTGCTATGAGG - Intergenic
1109626683 13:64983219-64983241 TGGTGAGGAACCGTGCTATCTGG - Intergenic
1111482851 13:88854622-88854644 GAGTGATGGACCTTGTTATAAGG + Intergenic
1113029447 13:105977196-105977218 GAGTGAATGCCCGTGAGATCTGG + Intergenic
1115124127 14:29972262-29972284 CTGTGAGGGACTGTGCTATCTGG + Intronic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1117599937 14:57364851-57364873 CAGTGAGGGACGGTGCTATCTGG + Intergenic
1120137219 14:80884602-80884624 CTGTGAGGGACTGTGCTATCCGG + Intronic
1120900971 14:89575260-89575282 CCTTGAAGGACCTTGCTATCTGG + Intronic
1124899926 15:33812916-33812938 GAGTGAAGAACCTTTCAATCCGG + Exonic
1125687163 15:41570288-41570310 GATTGAAGGACCGGGCTGCCCGG - Exonic
1125884382 15:43217752-43217774 GTCTAAAGGACCTTGCTATCAGG - Intronic
1132787699 16:1667100-1667122 GAGTGAAGTAAAGTCCTATCAGG - Intronic
1139913608 16:70414416-70414438 GACTGAAGGCCCGTGTTACCTGG - Intronic
1143621267 17:8081325-8081347 GAGTGAAGGTGCGTCCTGTCCGG + Exonic
1145940055 17:28738596-28738618 CACTGGAGGACCGGGCTATCTGG + Intronic
1146825994 17:36023732-36023754 CTGTGAGGGACAGTGCTATCCGG - Intergenic
1148980980 17:51574650-51574672 CCATGAAGGACGGTGCTATCTGG + Intergenic
1149365397 17:55938921-55938943 CCGTGAGGGACTGTGCTATCTGG + Intergenic
1149986442 17:61350998-61351020 GATTGAAGGATGGTGCTGTCTGG + Intronic
1153016408 18:586050-586072 GAATGAGGGACCCTGCTATTGGG + Intergenic
1154101611 18:11479628-11479650 CAGTGAGGGAAGGTGCTATCTGG - Intergenic
1157008680 18:43619946-43619968 GAGGGAAGGACTGTGATATCTGG - Intergenic
1157715070 18:49879287-49879309 GAGAGAAAGACCCTGCTCTCAGG + Intronic
1159254656 18:65930812-65930834 CCATGAAGGACAGTGCTATCTGG + Intergenic
1164704036 19:30305843-30305865 GAGGAAAGGACTGTGCCATCAGG + Intronic
1164966874 19:32492554-32492576 GAGTGAAGGAACATGATTTCAGG + Intergenic
1165269838 19:34696604-34696626 CTGTGAGGGACTGTGCTATCTGG + Intergenic
925811908 2:7709444-7709466 GAGTGGAGGACAGTGCTGTGTGG - Intergenic
926104647 2:10142584-10142606 GATCGCAGGACCGTGCTGTCTGG - Intronic
932332630 2:70906394-70906416 GACTGAAGGAGTGTGCTATAAGG + Intronic
936846426 2:116840519-116840541 CAGTGAAGGACTGTGCTGTTTGG + Intergenic
938374626 2:130797562-130797584 GCGTGGAGGACCCTGCTCTCCGG + Intergenic
939463647 2:142529556-142529578 GAGTGAAGGGCAGTGTTATACGG - Intergenic
940370496 2:152895807-152895829 CAGTGAAGGACTGTGCCATAAGG + Intergenic
943147751 2:184066353-184066375 CCGTGAGGGACTGTGCTATCTGG - Intergenic
945985317 2:216348962-216348984 GACTGAAGGACTGTGATATATGG - Intronic
1168938733 20:1690858-1690880 CTGTGAGGGACAGTGCTATCTGG + Intergenic
1170382486 20:15776367-15776389 GAGTGATGGACTGTGTTTTCTGG + Intronic
1178007052 21:28233977-28233999 CTGTGAGGGACTGTGCTATCTGG + Intergenic
1184457415 22:44619023-44619045 GAGTGAAGGAGCATGGTATGTGG + Intergenic
950578345 3:13846661-13846683 GTGAGAAGGAACTTGCTATCAGG - Intronic
951415188 3:22414751-22414773 CCGTGAGGGACTGTGCTATCTGG - Intergenic
953880806 3:46690435-46690457 GAGTGAGGGACCTTCCAATCAGG + Intronic
954755702 3:52838456-52838478 GAGGGAATGACCGTCCTGTCAGG + Exonic
955766976 3:62355105-62355127 GAGAGAAGGAACGTGCCATCAGG + Intergenic
956220026 3:66892971-66892993 CTGTGAGGGACGGTGCTATCCGG + Intergenic
960827829 3:121811212-121811234 AAGGGAGGGACTGTGCTATCTGG + Intronic
963936986 3:151064330-151064352 GAGTGATGGCCCCTGCTCTCTGG - Intergenic
971246635 4:24935073-24935095 GATTGATGGAGCCTGCTATCTGG - Intronic
972283798 4:37629275-37629297 CAGTGAAGGACTTGGCTATCTGG - Intronic
974881058 4:67757609-67757631 GAATGAAGGGCCGTGTTAACAGG + Intergenic
975177846 4:71308653-71308675 CCGTGAGGGACTGTGCTATCTGG + Intronic
978090231 4:104706789-104706811 GAGTGAGGGACAGTGCTATCTGG + Intergenic
979043620 4:115834202-115834224 CTGTGAGGGACAGTGCTATCTGG + Intergenic
982117719 4:152112123-152112145 GAGTGGAGGAGGGTGCTACCTGG + Intergenic
986265740 5:6188954-6188976 GATTGGAGGACCGTGATATCAGG + Intergenic
991110799 5:62897043-62897065 CCGTGAGGGACTGTGCTATCTGG - Intergenic
992066256 5:73112907-73112929 GAGTGAAGGACAGTTGTAGCAGG + Intergenic
996280796 5:121726924-121726946 CCGGGAAGGACTGTGCTATCGGG - Intergenic
996837306 5:127807703-127807725 GAGTGAAGCACAGAGCTCTCTGG - Intergenic
997778236 5:136630419-136630441 CAATGAAGGACTGTGCCATCAGG + Intergenic
998672868 5:144373294-144373316 AAATGAAGGACCCTGCTATGAGG + Intronic
999180196 5:149664828-149664850 GAGTGAGGGAGCGTGCTCACAGG + Intergenic
1002685720 5:181007967-181007989 CTGTGAGGGACTGTGCTATCTGG + Intergenic
1010668372 6:78656029-78656051 CTGTGAGGGACTGTGCTATCTGG - Intergenic
1012083135 6:94785636-94785658 CCGTGAGGGACAGTGCTATCTGG - Intergenic
1014223607 6:118823303-118823325 CAGTGAGGGACTGTGCTACCTGG - Intronic
1021122147 7:16807958-16807980 GAGTGATGGGCCATGCTATGGGG + Intronic
1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG + Intergenic
1028991195 7:97050854-97050876 CCATGAAGGACGGTGCTATCCGG + Intergenic
1029465082 7:100720474-100720496 GACTGGCGGAGCGTGCTATCTGG - Intergenic
1030482246 7:110119636-110119658 CTGTGAGGGACTGTGCTATCTGG + Intergenic
1039828363 8:41193817-41193839 CAGTCAAGGTCAGTGCTATCTGG - Intergenic
1042622776 8:70724587-70724609 CCGTGAGGGACTGTGCTATCAGG - Intronic
1043703553 8:83321715-83321737 CTGTGATGGACAGTGCTATCGGG + Intergenic
1045555568 8:103211795-103211817 GAGAGAAGGGCAGTGCTCTCAGG - Intronic
1047104379 8:121717327-121717349 GAGTGAAAGAAAGTGGTATCAGG + Intergenic
1051611708 9:18967943-18967965 TCGTGAAGGACAGTGCTATCTGG - Intronic
1052442006 9:28510019-28510041 GAGAGAAGAACCTTGCTCTCCGG + Intronic
1056574484 9:87844304-87844326 GAGAGATGGACCTTGCTATTGGG + Intergenic
1190505820 X:51125173-51125195 CCGTGAAGGATGGTGCTATCTGG + Intergenic
1190938657 X:55019402-55019424 GAGTCAAGGACATTGCTGTCTGG + Intronic
1192228396 X:69245850-69245872 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1193040521 X:76999183-76999205 GTGTGAGGGACTGTGCTGTCTGG - Intergenic
1193562606 X:83037735-83037757 CTGTGAGGGACGGTGCTATCCGG + Intergenic
1195140039 X:101950101-101950123 CCATGAAGGACTGTGCTATCCGG + Intergenic
1197614371 X:128675237-128675259 CAGTGAGGGACAGTGCTATCTGG - Intergenic
1197614378 X:128675267-128675289 CAGTGAAGGACCATGCCATGAGG - Intergenic
1198060626 X:133042405-133042427 GCGGGAGGGACTGTGCTATCTGG - Intronic
1200143242 X:153912592-153912614 GAGTGGAGGACCCTGGGATCAGG + Intronic