ID: 1115359907

View in Genome Browser
Species Human (GRCh38)
Location 14:32488853-32488875
Sequence CAGTCCCAACGAAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 5, 3: 116, 4: 520}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115359897_1115359907 19 Left 1115359897 14:32488811-32488833 CCTGCTTCTGCTCCCCTTGGTGG 0: 1
1: 0
2: 1
3: 25
4: 277
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359894_1115359907 23 Left 1115359894 14:32488807-32488829 CCACCCTGCTTCTGCTCCCCTTG 0: 1
1: 1
2: 23
3: 315
4: 1236
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359902_1115359907 5 Left 1115359902 14:32488825-32488847 CCTTGGTGGGCTACACCCACTGT 0: 1
1: 5
2: 57
3: 748
4: 1229
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359893_1115359907 24 Left 1115359893 14:32488806-32488828 CCCACCCTGCTTCTGCTCCCCTT 0: 2
1: 16
2: 264
3: 690
4: 1589
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359900_1115359907 7 Left 1115359900 14:32488823-32488845 CCCCTTGGTGGGCTACACCCACT 0: 1
1: 0
2: 9
3: 28
4: 175
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359901_1115359907 6 Left 1115359901 14:32488824-32488846 CCCTTGGTGGGCTACACCCACTG 0: 1
1: 4
2: 60
3: 756
4: 1255
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359892_1115359907 25 Left 1115359892 14:32488805-32488827 CCCCACCCTGCTTCTGCTCCCCT 0: 2
1: 16
2: 252
3: 689
4: 2117
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359903_1115359907 -10 Left 1115359903 14:32488840-32488862 CCCACTGTCTAACCAGTCCCAAC 0: 4
1: 333
2: 926
3: 1002
4: 741
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520
1115359896_1115359907 20 Left 1115359896 14:32488810-32488832 CCCTGCTTCTGCTCCCCTTGGTG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG 0: 1
1: 0
2: 5
3: 116
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115359907 Original CRISPR CAGTCCCAACGAAATGAGGT AGG Intronic
900187097 1:1337666-1337688 CAATCCCACCCAGATGAGGTGGG + Intronic
903567002 1:24275094-24275116 CAGTACCAATGAGATGAGCTGGG + Intergenic
906557758 1:46728139-46728161 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
906740042 1:48173558-48173580 CAGTCTCAATGACATGAGCTGGG + Intergenic
908611498 1:65865723-65865745 CAGTCCCAATGAGATGAACTGGG + Intronic
908724164 1:67157138-67157160 CAGTCCCAATGAGATGAACTGGG + Intronic
909672313 1:78203203-78203225 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
910177103 1:84442868-84442890 CAGTCCCAATGAGATGAGCCAGG - Intergenic
910318823 1:85921058-85921080 CAGTCCCAATGAGATGAGCCAGG - Intronic
912076819 1:105885048-105885070 CAGTCCCAAAGAGATGATTTGGG + Intergenic
912235242 1:107844118-107844140 CAGCCCCAATGAAATGAGCTGGG - Intronic
912894958 1:113576500-113576522 CAGTCCCAACGAGATTATCTGGG + Intronic
912966143 1:114239361-114239383 CAGTCCTAATGAGATGAGCTGGG - Intergenic
913036388 1:114969987-114970009 CAGTCCCAATGAGATGAACTGGG + Intronic
913108752 1:115639815-115639837 CAGTCCCAATGAGATAAGCTGGG + Intergenic
913435980 1:118848085-118848107 CAGTAACAACCCAATGAGGTAGG - Intergenic
914761845 1:150605369-150605391 CAATCCCAAAGAGAAGAGGTGGG - Intronic
915440155 1:155940917-155940939 CAGTGCCAACTAAAACAGGTTGG - Intergenic
915654582 1:157348614-157348636 CAGTCCCAATGAAATGAGCCGGG + Intergenic
915677418 1:157544566-157544588 CAGTCCCAGAGCAATGAGGCTGG + Intronic
915711312 1:157901978-157902000 CAGTCCCAATGAAATGAACCAGG - Intergenic
917009859 1:170458418-170458440 CAGTCCCAATGAGATAAGCTGGG + Intergenic
917023465 1:170614870-170614892 CAGTCCCAATGAGATGAACTGGG + Intergenic
917257596 1:173132263-173132285 CAGTCCCAATGAGATGAGCTGGG + Intergenic
917357668 1:174143670-174143692 CAGTCCCAATGAGATGAGCTGGG - Intergenic
918163267 1:181920533-181920555 CAGTCCCAATGAGATAAGCTGGG - Intergenic
918353771 1:183684931-183684953 CAGTCCCAGTGAGATGAGCTAGG + Intronic
918501587 1:185201593-185201615 CAGTCCCAATGAGATGAGTCGGG + Intronic
918786203 1:188768285-188768307 CAGTCCCAATGAGATGAACTGGG - Intergenic
919404777 1:197165894-197165916 CAGTCCCAGTGAGATGAGCTGGG - Intronic
921155298 1:212433811-212433833 CAGTCCCAACCAACCCAGGTGGG - Intronic
921401483 1:214727980-214728002 CAGTCCCAATGAGATGAACTGGG + Intergenic
921962141 1:221047232-221047254 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
921976244 1:221206681-221206703 CAGTCCCAATGAGATGAACTGGG - Intergenic
924823199 1:247513854-247513876 CAGTCCCAGTGAGATGAGCTGGG + Intronic
924829101 1:247573531-247573553 CAGTCCCAATGAGATGAACTGGG + Intronic
924878135 1:248128404-248128426 CAGTCCCAATGAGATGAACTGGG - Intergenic
924954605 1:248914494-248914516 CAGTCTCCAGGAAGTGAGGTTGG + Intronic
1063523759 10:6764283-6764305 CACTCCAAAGGAAATGAGGAAGG - Intergenic
1065076093 10:22080639-22080661 CAGTCCCAATGAGATGAACTGGG + Intergenic
1065427320 10:25619281-25619303 CAGTCCCAATGAGATGAACTGGG - Intergenic
1065621516 10:27587119-27587141 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1065651647 10:27899108-27899130 AAGTCCCAATGAGATGAGATGGG - Intronic
1067209788 10:44250246-44250268 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1068410502 10:56647268-56647290 CAGTCCCAGTGAAATGAACTGGG + Intergenic
1068470056 10:57448829-57448851 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1068622916 10:59207226-59207248 CAGTCCCAATGAGATGAGCTGGG - Intronic
1068951479 10:62782103-62782125 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1069264383 10:66439035-66439057 CAGTCCCAATGAGATGAGTCAGG + Intronic
1069300283 10:66899475-66899497 CAGTCCCAATGAGATGAACTAGG - Intronic
1069349064 10:67503310-67503332 CAGTCCCAATGAGATGAGCCAGG + Intronic
1070234552 10:74609580-74609602 CAGTCCCAATGAGATGAGCCAGG + Intronic
1070632376 10:78096176-78096198 CAGTCCCAATGAGATGAGCAAGG - Intergenic
1071272323 10:84019719-84019741 CAGTCCCAATGAGATGAGGTGGG - Intergenic
1071341421 10:84652214-84652236 CAGTCCCAGTGAGATGAGATGGG + Intergenic
1071401872 10:85280724-85280746 CAGTCCCAATGAGATGAGGTGGG + Intergenic
1072024903 10:91445683-91445705 CAGTCCCAGTGAGATGAGCTGGG - Intronic
1072837989 10:98737399-98737421 CAGTCCCAATGAGATGAAGTGGG - Intronic
1073940610 10:108693835-108693857 CAGTCCCAGTGAAATGAACTAGG - Intergenic
1076389696 10:130090212-130090234 TAGTCCCAATGAGATGAGCTAGG - Intergenic
1077428406 11:2499064-2499086 CAGTCCCAATGAGATGAACTTGG + Intronic
1078392999 11:10952602-10952624 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1078482574 11:11691642-11691664 CAGTCCCAATGAAATGAACCAGG - Intergenic
1078809521 11:14743903-14743925 CAGTCCCATTGAGATGAGCTGGG + Intronic
1079279783 11:19076812-19076834 CAGTGCCAACGCCTTGAGGTAGG - Intergenic
1079311751 11:19372683-19372705 CAGTCACATAGAAATAAGGTAGG - Intronic
1079517779 11:21289310-21289332 CAGTCCCAATGAGATGAGCCAGG - Intronic
1079799869 11:24854972-24854994 CAGTCCCAGTGAGATGAGCTGGG + Intronic
1080033708 11:27688752-27688774 CAGTCCCAATGAGATGAGCCCGG + Intronic
1080709971 11:34737623-34737645 CAGTCCCAATGAGATGAACTGGG - Intergenic
1080977069 11:37356370-37356392 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1082670613 11:56032923-56032945 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1082729867 11:56782593-56782615 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1082867172 11:57910760-57910782 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1082872234 11:57953876-57953898 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1082903685 11:58283630-58283652 CAATCCCAACGAGATGAACTGGG + Intergenic
1083018286 11:59479077-59479099 GAGTGCCAAGGAAATGCGGTAGG - Intergenic
1083385619 11:62307003-62307025 CAATCCCAATGAGATGAGCTGGG + Intergenic
1083499085 11:63087234-63087256 CAGTCCCAATGAGATGAACTGGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086139549 11:83480117-83480139 GAGTCACAACCAACTGAGGTTGG + Intronic
1086300415 11:85421287-85421309 CAGTCCCAATGAGATGAGCTGGG + Intronic
1086505200 11:87497478-87497500 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1086532454 11:87801525-87801547 CATTCCCAATGAGATGAGCTGGG + Intergenic
1086735747 11:90302967-90302989 CAGTCCCAATGCAATGAACTGGG + Intergenic
1087667696 11:101070122-101070144 CAGTCCCAATGAGATGAGGTGGG - Intronic
1088212022 11:107466797-107466819 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1088702451 11:112425870-112425892 CAGTCCCAATGAGATGAACTAGG - Intergenic
1089285568 11:117405494-117405516 CAGCCCCAATGAGATGAGCTGGG + Intronic
1090715869 11:129430185-129430207 AATTCCCAAAGAAATGAAGTTGG - Intronic
1091090128 11:132763156-132763178 CAGTCCCAATGAGATGAACTGGG + Intronic
1091643529 12:2255511-2255533 CAGTGCCAATCAAAGGAGGTCGG + Intronic
1091712067 12:2749235-2749257 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1091712325 12:2750680-2750702 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1092703161 12:11256143-11256165 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1093402210 12:18760751-18760773 CAGTCCCAATGAGATGAACTGGG - Intergenic
1093610431 12:21149501-21149523 CAGTCTCAAAGAGATGAGCTGGG - Intronic
1093694663 12:22146282-22146304 CAGTCCCAATGAGATGAGCTGGG - Intronic
1094311773 12:29092472-29092494 CAGTCCCAATGAGATGAACTAGG - Intergenic
1094755308 12:33462552-33462574 CAGTCCCAATGAGATGAACTGGG - Intergenic
1094757765 12:33492365-33492387 CAGTCCCAATTAGATGAGCTAGG - Intergenic
1095406252 12:41870320-41870342 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1097412040 12:59267719-59267741 CAGTCCCAATGAGATGAACTGGG - Intergenic
1097635290 12:62114333-62114355 CAGTCCCAATGAGATGAGCTGGG + Intronic
1097752894 12:63377881-63377903 CAGTCCCAATGAGATGAACTGGG - Intergenic
1098561468 12:71877842-71877864 GAGTTCAAATGAAATGAGGTGGG - Intronic
1099022621 12:77424893-77424915 CAGTGCCAATGAGATGAGCTGGG + Intergenic
1099053556 12:77809513-77809535 CAGTCCCAATGAGATGAGTCAGG + Intergenic
1099107795 12:78518722-78518744 CCGTCCCAATGAGATGAGGAGGG - Intergenic
1099183854 12:79497203-79497225 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1099216597 12:79861435-79861457 CAGTCCCAATGAGATGAAGCAGG - Intronic
1099486343 12:83233156-83233178 CAGTCCCAATGAGATGAGTTGGG + Intergenic
1099897462 12:88667253-88667275 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1101069960 12:101063227-101063249 CAGTCCCAATGAGATGAGCTGGG + Intronic
1101472778 12:105013863-105013885 CAGTCCCAATGAGGTGAGCTGGG + Intronic
1102966325 12:117130507-117130529 CAGACCCAAGCAAATGGGGTTGG + Intergenic
1103169249 12:118799494-118799516 CAGTCCCAATGACATGAGCTGGG + Intergenic
1103255744 12:119540023-119540045 CAGTCCCAATGAGATGAGCCAGG + Intronic
1104115700 12:125746889-125746911 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1105552576 13:21411203-21411225 CAGTCCCAATGAGATGAAGAGGG + Intronic
1105737474 13:23285951-23285973 CAGTCCCAATGAGATGAGCCAGG + Intronic
1105769313 13:23593900-23593922 CAGTCCCAATGAGATGAGCTGGG - Intronic
1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG + Intergenic
1106650776 13:31688028-31688050 CAGTCCCAATGAGATGAACTGGG - Intergenic
1106874316 13:34055127-34055149 CAGTCCCAATGAGATGAACTGGG + Intergenic
1107473549 13:40713195-40713217 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1108048897 13:46409433-46409455 CAGTCCCAATGAGATGAGCTGGG + Intronic
1108234952 13:48394050-48394072 CAGTCCCAATGAGATGAGCCAGG - Intronic
1108236736 13:48416230-48416252 CAGTCTCAATGAGATGAGCTGGG - Intronic
1108262891 13:48675990-48676012 CAGTCCCAATGAGATGAGCTGGG + Intronic
1109187798 13:59291491-59291513 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1109541429 13:63782779-63782801 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1111634983 13:90892494-90892516 CAGTCCCAGTGAGATGAGCTAGG - Intergenic
1113131649 13:107043275-107043297 CAGTCCCTATGAGATGAGCTGGG + Intergenic
1114133655 14:19821271-19821293 CAGTCCCAATGAGATGAGCTGGG + Intronic
1114335929 14:21690062-21690084 CAGTCCCAAGGAGATGAGCTGGG - Intergenic
1114817565 14:25978949-25978971 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1114870204 14:26646135-26646157 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1115043010 14:28955076-28955098 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1115045542 14:28988632-28988654 CAATGCTAACTAAATGAGGTAGG + Intergenic
1115124096 14:29972131-29972153 CAGTCCCAATGAGATGAACTGGG - Intronic
1115277167 14:31621631-31621653 CAGTCCCAATGAAATGAACTGGG + Intronic
1115359907 14:32488853-32488875 CAGTCCCAACGAAATGAGGTAGG + Intronic
1115511174 14:34139439-34139461 CAGTCCCAATGAGATGAGCCAGG - Intronic
1115537959 14:34391306-34391328 CAGTCCCAATGAGATGAGCCAGG - Intronic
1115843608 14:37501721-37501743 CAGTCCCAACGAGATGAACCAGG - Intronic
1116511975 14:45757098-45757120 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1116572535 14:46535442-46535464 CAGTCCCAATGAGGTGAGCTGGG + Intergenic
1116771573 14:49132132-49132154 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1117120965 14:52568102-52568124 CAGTCCCAATGAGATGAGCCAGG - Intronic
1117655383 14:57951101-57951123 CAGTCCCAATGAGATGAGCCAGG - Intronic
1117710611 14:58525358-58525380 CAGTCCCAATGAGATGAGCCAGG - Intronic
1117797170 14:59406266-59406288 CAGTCCCAATGAGATGAGGCAGG + Intergenic
1117859279 14:60073284-60073306 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1118516187 14:66530801-66530823 CAGTCCCAATGAGATGAGCCAGG + Intronic
1120065708 14:80038900-80038922 CAGTCCCAATGAAATGAACCAGG - Intergenic
1120565417 14:86048649-86048671 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1120624975 14:86813815-86813837 CAGTCCCAATGACATGAGCTGGG + Intergenic
1123576728 15:21676839-21676861 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1123613350 15:22119307-22119329 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1124058952 15:26269758-26269780 CAGACCCAAGGAAATGAATTTGG + Intergenic
1124474770 15:30023227-30023249 CAGTCTCAATGAGATGAAGTGGG + Intergenic
1125227072 15:37407950-37407972 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1125784199 15:42301159-42301181 CAGTCCCAATGAGATGAGTCAGG - Intronic
1125984666 15:44038652-44038674 CAGTCCCAATGAGATGAACTGGG - Intronic
1126050738 15:44682890-44682912 CAGTCCCAGTGAGATGAGCTGGG - Intronic
1126520973 15:49593204-49593226 CAGTCCCAATGAGATGAAGCAGG + Intronic
1127029925 15:54850831-54850853 CCGTCCCAATGAGATGAGGTGGG - Intergenic
1127317975 15:57815439-57815461 CAGTCCCAATGAGATGAAATGGG + Intergenic
1128857608 15:71032320-71032342 CAGTCCCAATGAGATGAACTGGG + Intronic
1130152123 15:81319193-81319215 CAAACCCAACCAGATGAGGTAGG + Intronic
1132063968 15:98715248-98715270 CACGCCCCAAGAAATGAGGTGGG - Intronic
1132096313 15:98987783-98987805 CAGTCCCAATGAGATGAACTGGG - Intronic
1202985596 15_KI270727v1_random:411084-411106 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1132783390 16:1641319-1641341 CAGTCCCAACAAAAGGTGCTTGG + Intronic
1136403579 16:30030964-30030986 CAGCCCCAAAGGAAGGAGGTGGG + Exonic
1136639145 16:31547132-31547154 CAGCCCCAGCGAATTCAGGTGGG + Intergenic
1137296219 16:47096835-47096857 CAGTCCCAGTGAAATGAGCTGGG - Intronic
1137970084 16:52975913-52975935 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1138886819 16:61090566-61090588 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1141246198 16:82309758-82309780 CAGTCCCAATGAGATGAACTGGG + Intergenic
1141393014 16:83680442-83680464 CAGTCCCAGCAAACTGAGTTAGG + Intronic
1143427234 17:6849544-6849566 CAGTCCCAATGAGATGAACTGGG + Intergenic
1148403352 17:47386981-47387003 CAGTCCCAATGAGATGAGCAGGG + Intronic
1148980953 17:51574504-51574526 CAGTCCCAATGAGATGAACTGGG - Intergenic
1149281370 17:55108750-55108772 CAGTCCCAATGAGATAAGCTGGG + Intronic
1150910885 17:69386371-69386393 CAGTAAAAACGAAATGAGGGAGG + Intergenic
1152234989 17:79134035-79134057 CAGTGCCCAGGACATGAGGTGGG + Intronic
1153059469 18:980436-980458 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1153702514 18:7711130-7711152 CAGTCCCAATGAGATGAGCCGGG - Intronic
1153717945 18:7869538-7869560 CAGTCCCAATGTGATGAGCTGGG + Intronic
1153798365 18:8646527-8646549 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1154288828 18:13086526-13086548 CAGTCCCAGTGAGATGAGCTGGG + Intronic
1155384836 18:25266548-25266570 CAGTCCCAATGAGATGAACTGGG - Intronic
1155395217 18:25379876-25379898 CAGTCCCAATGTGATGAGCTGGG - Intergenic
1155560591 18:27072209-27072231 CAGACACAAGGAAATGAGGCTGG - Intronic
1156553060 18:38038809-38038831 CATTCCCAAGGAAATGATGCTGG - Intergenic
1156979380 18:43266117-43266139 CAGTCCCAATGCAATGAACTGGG + Intergenic
1157067389 18:44367293-44367315 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1157071648 18:44416018-44416040 CAGTCCCAATGACATGAGCTGGG - Intergenic
1157086305 18:44583616-44583638 CAGTCACAGAGAAATGAAGTGGG - Intergenic
1157178963 18:45478326-45478348 CAGTCCCAATGAGATGAGCTGGG + Intronic
1157780603 18:50435352-50435374 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1158933302 18:62341984-62342006 CAGTCCCCAAGAACTGAGTTGGG - Intronic
1159581228 18:70236518-70236540 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1160466746 18:79083751-79083773 CAGTCCCAGTGAGATGAGCTGGG + Intronic
1161741781 19:6025294-6025316 CAGTCCCCATGACAGGAGGTTGG - Intronic
1164152439 19:22566495-22566517 CAGTCCCAATGAGATGAACTGGG + Intergenic
1165254678 19:34568558-34568580 CAGTCCCAATGAAATGAGCCAGG + Intergenic
1166263097 19:41656837-41656859 CAGTCCCAATGAGATGAGCTGGG - Intronic
1168457596 19:56526164-56526186 CAGTCCCAATGAGATGAGCCAGG - Exonic
925358519 2:3261084-3261106 CAGCCCCAAGTAAATGTGGTCGG + Intronic
925627957 2:5860911-5860933 CAGTCCCAATGAGATGAACTGGG + Intergenic
927182704 2:20458403-20458425 CAGTCCCAATGAGAGGAGCTGGG - Intergenic
928750553 2:34466315-34466337 CAGTCCCAATGAGATGAGCCAGG - Intergenic
929064842 2:37963042-37963064 CAGTCCCAATGAGATGAACTGGG + Intronic
929772430 2:44903548-44903570 CAGTCCCAGCCAAATAAGGAAGG - Intergenic
929837923 2:45425614-45425636 CAGTCCCAATGAGATGAGCCAGG - Intronic
929914298 2:46121371-46121393 CAGTCCCCATGATCTGAGGTGGG + Intronic
930206965 2:48597362-48597384 CAGTCCCAGTGAAGTTAGGTGGG + Exonic
930877653 2:56237331-56237353 CTTTCCCAACCAAATGAGCTGGG - Intronic
930951237 2:57146344-57146366 CAGTCCCAATGAGATGAACTTGG - Intergenic
931566337 2:63619820-63619842 CAGTCCCAATGAGATGAGCTGGG - Intronic
931814745 2:65889783-65889805 CAGTCCCAATGAGATGAGCCAGG - Intergenic
931886792 2:66626319-66626341 CAGTCCCAATGAGATGAACTGGG + Intergenic
933355546 2:81205881-81205903 CAGTCCCAAAGAGATGATCTGGG - Intergenic
933413302 2:81951547-81951569 CAGCCCCAATGAGATGAGCTGGG + Intergenic
933607425 2:84398241-84398263 CAGTCCCAATGAGATGAACTGGG - Intergenic
933819313 2:86095214-86095236 CAGTCCCGAAGACATTAGGTGGG - Intronic
935852168 2:107235128-107235150 CAGTCCCAATGAGATGAACTGGG - Intergenic
935961396 2:108429243-108429265 CAGTCCCAATGAGATGAGCTGGG - Intergenic
936775397 2:115966036-115966058 CAGTCCCAATGAAATGAACCAGG + Intergenic
937188348 2:120068078-120068100 CAGCCCCAATGAGATGAGCTGGG - Intronic
937807198 2:126160586-126160608 CAGTCCCAATGAGATGAGCCGGG - Intergenic
937893204 2:126956385-126956407 CAGTCCCAATGAGATGAGCTGGG - Intergenic
938369609 2:130761025-130761047 CAGTCCCAATGGACTGAGGATGG - Intronic
939652710 2:144785074-144785096 CAGTCCCAATAAGATGAGCTGGG - Intergenic
940370462 2:152895676-152895698 CAGTCCCAATGAGATGAGCTGGG - Intergenic
940757848 2:157704276-157704298 CAGTCCCAATGAGATGAGCTTGG - Intergenic
940821313 2:158359480-158359502 CAGTCCCAATGAGATGAGCCAGG - Intronic
940995791 2:160148573-160148595 CAGTCCCAATGAGATGAAGCAGG - Intronic
940998925 2:160180787-160180809 CAGTCCCAGTGAGATGAGCTGGG - Intronic
941119504 2:161513010-161513032 CAGTCCCAATGACATGAGCTGGG - Intronic
941239482 2:163017956-163017978 CAGTCCCAGTGAAATGAACTGGG + Intergenic
941276494 2:163497483-163497505 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
941518811 2:166511890-166511912 CAGTCCCAATGAGATGAATTGGG + Intergenic
941565446 2:167099849-167099871 CAGTCCCAATGAAATGAACCAGG + Intronic
942199812 2:173559711-173559733 CAGTCCCAATGAGATGAGCCAGG - Intergenic
942732504 2:179075699-179075721 CAGTCCCAGGGAGATGAGCTAGG - Intergenic
943105604 2:183543338-183543360 CAGTCCCAATGAGACGAGCTGGG - Intergenic
943129871 2:183841638-183841660 CAGTCCCAATGAGATGAGCCTGG - Intergenic
943233562 2:185289943-185289965 CAGTCCCAGTGAGATGAGCTAGG - Intergenic
943240477 2:185377361-185377383 CAGTCCCAAGGAGATGAACTGGG + Intergenic
943409699 2:187532378-187532400 CAGTCCCAATGAGATGAGCTGGG - Intronic
943599223 2:189893561-189893583 CAGTCCCAGTGAAATGAGCCGGG + Intronic
944267808 2:197748046-197748068 CAGTCCCAGTGAGATGAGCTGGG - Intronic
944347280 2:198684553-198684575 CAGTCCCAATGAGATGAACTGGG - Intergenic
944635310 2:201670857-201670879 CAGTCCCAGTGAGATGAGCTGGG - Intronic
945329818 2:208525867-208525889 CAGTCCCAATGAGATGAGCCAGG + Intronic
945533816 2:210987329-210987351 CAGTCCCAATGAGATGAACTGGG + Intergenic
947085956 2:226453724-226453746 CAGTCCCAACGAGATGAGCCGGG - Intergenic
947492031 2:230603443-230603465 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1169397141 20:5242058-5242080 CAGTCCCAATGAGATGAGTTGGG + Intergenic
1169984198 20:11423461-11423483 CAGTCCCAATGAAGTGAACTGGG + Intergenic
1170266486 20:14471265-14471287 CAGTCCCAATGAGATGAGCCAGG + Intronic
1170370341 20:15640972-15640994 CTGGCCCAAGGAAATGAGGAAGG - Intronic
1170599189 20:17828161-17828183 GGGACCCAACAAAATGAGGTGGG - Intergenic
1171441299 20:25165734-25165756 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1171513495 20:25707052-25707074 CAGTCCCAATGAGATGAACTGGG + Intergenic
1173318738 20:41968523-41968545 CAGTCCCAATGAGATGAACTGGG + Intergenic
1177050202 21:16224429-16224451 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1177425800 21:20921878-20921900 CAGTCCCAAAGAGATGAGCCGGG - Intergenic
1179311004 21:40196262-40196284 CAGTCCCAGCGGCAGGAGGTTGG - Intronic
1183021586 22:35031288-35031310 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1183182812 22:36272222-36272244 CAGTCCCAATGAGATGAACTGGG + Intergenic
949423608 3:3891949-3891971 CAGTCCCAATGAGATGAGCTGGG + Intronic
949580692 3:5384581-5384603 CAGTCCCAATGAGATGAGCTAGG + Intergenic
949683505 3:6541822-6541844 CAGTCCCAATGAGATGAACTGGG + Intergenic
949954954 3:9259948-9259970 CAGGCCCAATGAGATGAGGTGGG - Intronic
950991935 3:17449035-17449057 CAGTCCCAATGAGATGAGAAGGG - Intronic
951347334 3:21561488-21561510 CAGTCCCAATGAGATGAACTGGG + Intronic
951434323 3:22643782-22643804 CAGTCCCAATGAGATGAACTGGG + Intergenic
951741588 3:25931279-25931301 CAGTCCCAATGAGATGAACTGGG - Intergenic
951759592 3:26130498-26130520 CAGTCCCAATGAGATGAACTAGG + Intergenic
952085056 3:29810950-29810972 CATTACCAAAGAAATGAGTTTGG - Intronic
952608158 3:35174149-35174171 CAGTCCCAGTGAAATGAACTGGG + Intergenic
954508289 3:51097954-51097976 CAGCCCCAATGAGATGAGCTGGG + Intronic
954524849 3:51261214-51261236 CAGTCCCAATGAGATGAGCCGGG - Intronic
954530969 3:51320118-51320140 CAGTCCCAATGAGATGAGCTGGG - Intronic
955175201 3:56606623-56606645 CAGTCCCAATGAGATGAACTAGG + Intronic
955439661 3:58942372-58942394 CAGTCCCAGTGAAATGAGCCGGG - Intronic
956207814 3:66772164-66772186 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
957009443 3:74986667-74986689 CAGTCCCAATGAGATGAACTGGG + Intergenic
957474752 3:80709226-80709248 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
957695639 3:83635597-83635619 CAGTCCCAATGAAGTGAGCAGGG - Intergenic
958094758 3:88929612-88929634 CAGTCTCAATGAGATGAAGTGGG - Intergenic
959025560 3:101236499-101236521 CAGTCCCAATGAGATGAGCCAGG - Intronic
959842772 3:110998398-110998420 CAGTCCCAATGAGATGAGCCGGG - Intergenic
960177185 3:114531787-114531809 CAGTCCCAATGAGATGAGCCAGG - Intronic
960226999 3:115179955-115179977 CAGTCCCAGTGAGATGAGCTTGG + Intergenic
960827795 3:121811084-121811106 CAGTCCCAATGAGATGAACTGGG - Intronic
960836109 3:121908401-121908423 CAGTCCCAATGAAATGAGCCAGG + Intronic
960903765 3:122577649-122577671 CAGTCCCAGCGAGCTGAGGATGG + Exonic
961998334 3:131269571-131269593 CAGTCCCAATGAGATGAGCTTGG + Intronic
962512246 3:136114064-136114086 CAGTCCCAATGAGATGAACTGGG - Intronic
962640226 3:137377633-137377655 CAGTCCCAATGAGATGAAATAGG + Intergenic
962642448 3:137401162-137401184 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
962653681 3:137520862-137520884 CAGTACCAACGAAATGATGAGGG + Intergenic
962766921 3:138574066-138574088 CAGTCCCAACGAGATGAACCAGG - Intronic
963081507 3:141399274-141399296 AAGTCCCACCTAAATGGGGTTGG - Intronic
964371459 3:156004428-156004450 CAGTCCCAATGAGATGAGCTGGG + Intergenic
964649200 3:158991913-158991935 CAGTCCCAAAGAGATGAACTGGG + Intronic
965511013 3:169568018-169568040 GAGTCCCAATGAGATGAGCTGGG - Intronic
965880352 3:173381949-173381971 CAGTCCCAATGAGATGAGCTGGG - Intergenic
966250986 3:177865523-177865545 CAGTCCCAATGAGATGAGCCGGG - Intergenic
966309310 3:178576144-178576166 CAGTCCCAATGAGATGAGCCGGG - Intronic
966533393 3:181004850-181004872 CAGTCCCAATGAGATGAGTTGGG + Intergenic
966653555 3:182327546-182327568 CAGTCTCAGCCAAATGAGGCTGG + Intergenic
967419663 3:189259340-189259362 CAGTCCCAATGAGATGAACTGGG + Intronic
967768602 3:193309708-193309730 CTGTCACAAGGAACTGAGGTTGG + Intronic
970685154 4:18559212-18559234 CAGTCCCAATGAGATGAGCCAGG - Intergenic
971004448 4:22357598-22357620 CAGTCCCAATGAGATGAGCCCGG - Intronic
971749110 4:30623826-30623848 CAGTCCCAATGAAATGAGCAGGG - Intergenic
972219219 4:36935420-36935442 CAGTCCCAGTAAGATGAGGTGGG - Intergenic
972755466 4:42041857-42041879 CAGTCCCAATGAGATGAGCCAGG - Intronic
973237701 4:47923059-47923081 CAGTCCCAACGAGATGAACCAGG + Intronic
973660810 4:53104985-53105007 CACTCCCAATGACATGAGGCAGG - Intronic
973799062 4:54458873-54458895 CAGTCCCAATGAGATGAGCCAGG - Intergenic
973837402 4:54824494-54824516 CAGTTCCAATGAGATGAGCTTGG - Intergenic
974326394 4:60419720-60419742 CAGTCCCAATGAGATGAGCCAGG + Intergenic
974813868 4:66981542-66981564 CAGTCCCAATGAGATGAACTTGG - Intergenic
974851872 4:67413080-67413102 TAGTCCCAATGAGATGAGCTGGG + Intergenic
975096554 4:70464048-70464070 CAGTCCCAATGAGATGAGCCAGG - Intronic
975140622 4:70914847-70914869 CAGCCCCAAGGAGAGGAGGTGGG - Intronic
975149516 4:71005307-71005329 CAGTCCCAATGAGATGAATTGGG + Intronic
975213057 4:71723015-71723037 CAGTCCCAATGAGATGAACTGGG + Intergenic
975245766 4:72119577-72119599 CAGTCCCAATGAGATGAACTGGG - Intronic
975350514 4:73340387-73340409 TAGTCCCAATGAGATGAGCTGGG + Intergenic
975466429 4:74714299-74714321 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
975638688 4:76477774-76477796 CAGTCCCAATGAGATGAGCTGGG - Intronic
976006702 4:80439346-80439368 CAGTCCCAATGAGATGAGCTTGG - Intronic
976024030 4:80665070-80665092 CAGTCTCAATGAGATGAGCTGGG + Intronic
976065460 4:81183290-81183312 CAGTCCCAGTGAGATGAGCTGGG - Intronic
976370716 4:84285732-84285754 CAGTCCCAATGAGATGAGCCAGG - Intergenic
976394813 4:84544751-84544773 CAGTCCCAAAGAGATGAGCCAGG - Intergenic
976810027 4:89090372-89090394 CAGTCCCAATGAGATGAGCTGGG + Intronic
976861403 4:89671224-89671246 CAGTCCCAATGAGATGAACTGGG - Intergenic
977185732 4:93933102-93933124 CAGTCCCAATGAGATGAGCTGGG + Intergenic
977500179 4:97828186-97828208 CAGTCCCAATGAGATGAACTGGG - Intronic
977994364 4:103484533-103484555 CAGTCCCAATGAGATGAGCTGGG - Intergenic
978090202 4:104706655-104706677 CAGTCCCAATGAGATGAGCCAGG - Intergenic
978179623 4:105776679-105776701 CAGTCCCAATGAGATGAGCCAGG + Intronic
978313195 4:107409088-107409110 CAGTCCCAATGAGATGAGCCTGG - Intergenic
978517846 4:109587478-109587500 CAGTCCCAATGAGATGAGCCAGG + Intronic
978906722 4:114013513-114013535 CAGTCCCAATGAGATGAACTGGG + Intergenic
979417363 4:120460436-120460458 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
980100418 4:128536223-128536245 CAGTCCCAATGAGATGAACTGGG + Intergenic
980157729 4:129126862-129126884 CAGTCCCAATGAGATGAGCCGGG + Intergenic
980583732 4:134786948-134786970 CAGTCCCAATGAGATGAGCTGGG + Intergenic
980855143 4:138431238-138431260 CAGTCCCAATGAGATGAACTGGG - Intergenic
981443383 4:144808678-144808700 CAGTCCCAGTGAGATGAGCTAGG - Intergenic
981789724 4:148522247-148522269 CAGTCCCAATGAGATGAGCCAGG + Intergenic
981796345 4:148599317-148599339 CAGTCCCAATGAGATGAACTGGG + Intergenic
981939831 4:150271005-150271027 CAGTCCCAACGAGATGAACCAGG - Intronic
982299047 4:153860074-153860096 CAGTCCCAATGAGATGAGCCAGG + Intergenic
982825645 4:160001451-160001473 CAGTCCCAATGAGATGAGCTGGG - Intergenic
982853054 4:160342819-160342841 CAGTCCCAATGAGATGAGCCAGG + Intergenic
982915486 4:161203746-161203768 CAGTCCCAATGAGATGAACTGGG - Intergenic
983388103 4:167092091-167092113 CAGTCCCAGTGAGATGAGCTGGG - Intronic
983543195 4:168935074-168935096 CAGTCCCAATGAGATGAGCTGGG - Intronic
983596401 4:169472477-169472499 CAGTCCCAATGAGATGAACTGGG + Intronic
984354103 4:178636779-178636801 CAGTCCCAATGAGATGAGCCGGG - Intergenic
984618541 4:181926810-181926832 CAGTCCCAATGAGATGAGCTGGG - Intergenic
984902850 4:184600491-184600513 CAGTCCCAATGAGATGAGCCGGG - Intergenic
985940560 5:3132463-3132485 CAGTCCCAAAGTAGAGAGGTCGG + Intergenic
987019117 5:13851873-13851895 CAGTCCCAATGAGATGAGCCAGG - Intronic
987656443 5:20814430-20814452 CAGACCCAATGAGATGAGCTGGG - Intergenic
987720662 5:21628280-21628302 GAGTCCCAATGAGATGAGCTGGG + Intergenic
988719114 5:33858808-33858830 CAGTCCCAATGAGATGAGCTGGG - Intronic
988767114 5:34389515-34389537 CAGACCCAATGAGATGAGCTGGG + Intergenic
989345341 5:40423231-40423253 CAGTCCCAATGAGATGAACTAGG + Intergenic
989675346 5:43966274-43966296 CAGTCCCAATGAGATGAACTGGG + Intergenic
990164426 5:52978276-52978298 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
990183862 5:53191677-53191699 CAGTCCCAATGAGATGAGCTGGG + Intergenic
990673981 5:58162661-58162683 CAGTCCCAATGAGATGAGCTGGG + Intergenic
990745952 5:58959427-58959449 CAGTCCCAATGAGATAAGCTGGG + Intergenic
990837715 5:60041600-60041622 CAGTCCCAATGAGATGAGCTGGG - Intronic
990897687 5:60716276-60716298 CAGTCCCAATGAGATGAACTGGG + Intergenic
991243507 5:64485013-64485035 CAGTCCCAATGAGATGAACTAGG + Intergenic
992292520 5:75293591-75293613 CAGTCCCATTGAGATGAGCTGGG + Intergenic
993150136 5:84151413-84151435 CAGTCCAAATGAAAAGAGGCAGG + Intronic
993381956 5:87218210-87218232 CAGTCCCAATGAGATGAGCTGGG + Intergenic
993402590 5:87472428-87472450 CAGTCCCAATGAGATGAAATGGG - Intergenic
993757722 5:91751544-91751566 CAGTCCCAACAAGATGAACTGGG + Intergenic
993961057 5:94296745-94296767 CAGTCCCAGTGAGATGAGCTGGG + Intronic
994438162 5:99764114-99764136 CAGTCCCAATGAGATGAACTGGG + Intergenic
994622564 5:102179850-102179872 CAGTCCCAATGAGATGAACTGGG + Intergenic
995301822 5:110594104-110594126 CAGTCCCAATGAGATGAACTGGG - Intronic
995474945 5:112538749-112538771 CAGTCCCAGTGAGATGAGCTTGG - Intergenic
995612266 5:113923402-113923424 CAGTCCCAATGAGATGAGCTGGG - Intergenic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
995790749 5:115883546-115883568 CAGTCCCAATGAGATGAGCCAGG + Intronic
996910975 5:128656315-128656337 CAGTCCCAATGAGATGAGCAGGG + Intronic
997068639 5:130593078-130593100 CAGTCCCAATGAGATGAGCCAGG - Intergenic
997252189 5:132397925-132397947 TAGTCCCAACGAGATGAGCCGGG - Intergenic
998691916 5:144596337-144596359 CAGTCTCAATGAGATGAGCTGGG + Intergenic
999468568 5:151830946-151830968 CAGTCCCAGTGAGATGAGCTGGG - Intronic
999488806 5:152027349-152027371 CAGTCCCAATGAGATGAGCCAGG + Intergenic
999602499 5:153282652-153282674 CAGTCCCAATGAGATGAACTGGG - Intergenic
1000145224 5:158447226-158447248 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1001362766 5:171103945-171103967 CAGTCCCAATGAGATGAGCCAGG + Intronic
1002092078 5:176811587-176811609 CCCTCCCAAGGGAATGAGGTGGG - Intronic
1002605962 5:180382881-180382903 CAGTCACACCGAAATGAGGCTGG + Intergenic
1002677069 5:180926123-180926145 CAGTCCCAATGAGATGAGCCAGG - Intronic
1002944702 6:1750381-1750403 CAGTCCCAATGAGATGAGCCAGG - Intronic
1003416977 6:5918199-5918221 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1005274087 6:24198301-24198323 CAGTCCCAATGAGATGAGCCGGG - Intronic
1005378188 6:25207046-25207068 CAGTCCCAGTGAAATGAACTGGG - Intergenic
1006199865 6:32279009-32279031 CAGTCCCAATGAGATGAACTGGG - Intergenic
1007858037 6:44878723-44878745 CAGTCCCAATGAGATAAGCTGGG - Intronic
1008575571 6:52856900-52856922 CAGTCCCAATGAGATGAACTGGG + Intronic
1008785016 6:55158105-55158127 CAGTCCCAATGAGAGGAGCTGGG - Intronic
1008896932 6:56566540-56566562 CAGTCCCAATGAGATGAGCTGGG + Intronic
1009264022 6:61531591-61531613 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1009455170 6:63848483-63848505 CAGTCCCAATGAGATGAACTGGG - Intronic
1009492621 6:64311673-64311695 CAGTCCCAATGAGATGAACTAGG - Intronic
1009718345 6:67428723-67428745 CAGTCCCAATGAAATGAAACGGG + Intergenic
1009740337 6:67734894-67734916 CAGTCCCAATGAGATGAACTGGG + Intergenic
1009880419 6:69560263-69560285 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1010447092 6:75960212-75960234 CAGTCCCAGTGAGATGAGTTGGG + Intronic
1010681911 6:78807984-78808006 CAGTCCCAATGAGATGAACTGGG + Intergenic
1010936490 6:81869394-81869416 CAGTCCCAATGAGAAGAGCTGGG - Intergenic
1011077564 6:83453674-83453696 CAGTTCCAACGACATGAGCTAGG - Intergenic
1011174007 6:84540604-84540626 CAGTCCTAATGAAATGAGCCAGG - Intergenic
1011301534 6:85879248-85879270 CAGTCCCAATAAGATGAGCTGGG + Intergenic
1011578097 6:88827188-88827210 CAATCCCAACGAGATGAGCCAGG - Intronic
1011766174 6:90622912-90622934 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1011776883 6:90740087-90740109 CAGTCCTAATGAGATGAGCTGGG + Intergenic
1012083169 6:94785782-94785804 CAGTCCCAATGAGATGAGCAGGG + Intergenic
1012644488 6:101661816-101661838 TAGTCCCAATGAGATGAGCTGGG + Intronic
1012701056 6:102458401-102458423 CAGTCCCAATGAGATGAACTGGG - Intergenic
1012870792 6:104670880-104670902 CAGTCCCAATGTGATGAGCTGGG - Intergenic
1013390145 6:109678755-109678777 CAGTCCCAGTGAGATGAGCTGGG - Intronic
1013452892 6:110302961-110302983 CAGTCCCAATGAGATGAGCCGGG - Intronic
1013682495 6:112541048-112541070 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1014058578 6:117044435-117044457 CAGTCCCAATGAGATAAGCTGGG + Intergenic
1014523990 6:122479090-122479112 CAGTCCCGATGAGATGAGCTGGG + Intronic
1014666014 6:124238634-124238656 CAGTCCCAATGAGATGAGGTGGG - Intronic
1014836647 6:126167456-126167478 CAGTCCCAATGAGACGAAGTGGG + Intergenic
1014872717 6:126615424-126615446 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1015108818 6:129568776-129568798 CAGTCCCAATGAGATGAGTAGGG - Intergenic
1015163104 6:130174503-130174525 CAGTCCCAATGAGATGAAGTGGG + Intronic
1015471774 6:133614409-133614431 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1015623494 6:135156674-135156696 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1016717459 6:147251086-147251108 CAATCCCAATGAGATGAGCTGGG - Intronic
1017197516 6:151717199-151717221 CAGTCCCAATGAGATGAGCTGGG + Intronic
1017322531 6:153110735-153110757 CAGTCGCAATGAGATGAGCTGGG - Intronic
1017571316 6:155748382-155748404 CAGTCCCAGTGAAATGAGCCAGG - Intergenic
1018114733 6:160572217-160572239 CAGTCCCAATGAGATGAGCCGGG + Intronic
1020391513 7:7662657-7662679 CAGTCCCAATGAGATGAGCCGGG + Intronic
1020693915 7:11391938-11391960 GAGTCCCAATGAAATGAATTGGG + Intronic
1020693950 7:11392193-11392215 CAGTCCCAATGAGATGAGCCAGG - Intronic
1020753508 7:12171199-12171221 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1021071596 7:16248687-16248709 CAGTCCCAATGAGATGAACTAGG - Intronic
1021322220 7:19226698-19226720 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1021347761 7:19548587-19548609 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1021379947 7:19954720-19954742 CAGTCCCAATGAAATGAATCAGG + Intergenic
1021483843 7:21146337-21146359 CAGTCCCAGCGAGATGAACTGGG - Intergenic
1021793684 7:24231341-24231363 CAGTTCCAATGAATTGAGATAGG - Intergenic
1022058941 7:26770797-26770819 CAGTCCCAATGAGATAAGCTGGG + Intronic
1023272490 7:38479608-38479630 CAGTGCAAAGGAAAGGAGGTGGG + Intronic
1023909998 7:44547080-44547102 CAGTCCCAATGAGATGAACTGGG - Intergenic
1024950598 7:54856368-54856390 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1025714305 7:63941061-63941083 CAGTCCCAATGAGATGAACTGGG - Intergenic
1027582772 7:80019924-80019946 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1027843261 7:83341414-83341436 CAGTCCTAATGAGATGAGCTGGG - Intergenic
1027864666 7:83630128-83630150 CAGTCCCAATGAGATGAGCCAGG + Intronic
1028000725 7:85494677-85494699 CAGACCCAGCCACATGAGGTGGG - Intergenic
1028326919 7:89539668-89539690 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1028476427 7:91258219-91258241 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1028523545 7:91758839-91758861 CAGTCCCAATGAGATGAACTGGG - Intronic
1028648111 7:93120667-93120689 CAGTCCCAATGAGATGAGCCCGG - Intergenic
1030703181 7:112662904-112662926 CAGTCCCAATGAGATGAACTGGG + Intergenic
1030705722 7:112690505-112690527 CAGTCCCAATGAGATGACCTGGG + Intergenic
1030801250 7:113856067-113856089 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1030958766 7:115888966-115888988 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1031613863 7:123857524-123857546 CAGTCCCAATGAGATGAGCCAGG + Intronic
1031903073 7:127430628-127430650 CAGTCCCAATGAGATGAGCTGGG + Intronic
1031904997 7:127451063-127451085 CAGTCCCAATGAAATGATCCAGG - Intergenic
1032292895 7:130605684-130605706 CAGTCTCAAGGAAATGAATTTGG + Intronic
1032367618 7:131315218-131315240 CAGTCCCAATGGAATGAACTGGG - Intronic
1032893212 7:136222268-136222290 CAGTCCCAATGCAATGAACTGGG - Intergenic
1034394146 7:150807651-150807673 CAGTCCCAATGACATGAGGCAGG - Intergenic
1034933437 7:155182488-155182510 CAGTTCCAACTCAATGGGGTGGG - Intergenic
1035596687 8:863860-863882 CAACCCCAAGGAAATGAGGTTGG + Intergenic
1037626068 8:20607979-20608001 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1039282882 8:36006212-36006234 CAGTCCCAGCGAGATGAGCTGGG - Intergenic
1041287210 8:56273339-56273361 CAGTCCCAATGAGATGAAGAGGG - Intergenic
1041459835 8:58098870-58098892 CAGTCCTAATGAGATGAGCTAGG + Intronic
1041584053 8:59495434-59495456 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1041838424 8:62242578-62242600 CAGTCCCAATGAGATGAGTCGGG + Intergenic
1042110829 8:65379734-65379756 CAGCCCCAATGAGATGAGCTGGG - Intergenic
1042833369 8:73055607-73055629 CAGTCCCAATGAAATGAACCAGG - Intergenic
1042853578 8:73240972-73240994 CAGTCCCAATGAAATGAACCAGG + Intergenic
1043532328 8:81165448-81165470 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1044312465 8:90709382-90709404 CAGTCCCAGCGAGATGAACTGGG + Intronic
1044441012 8:92223377-92223399 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1044960917 8:97529957-97529979 CAGTCCCATTGAGATGAGCTGGG - Intergenic
1045151885 8:99416760-99416782 CAGTCCCAGTGAGATGAGCTGGG + Intronic
1045212011 8:100108472-100108494 CAGTCCCAATGAGATGAACTGGG - Intronic
1045390489 8:101710073-101710095 CAGTCCCAATGAGATGAACTGGG - Intronic
1045618813 8:103951409-103951431 CAGTCCCAATGAGATGAACTGGG - Intronic
1045883293 8:107065524-107065546 CAGTCCCAATGAGATGAACTGGG + Intergenic
1046068093 8:109219349-109219371 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1046106406 8:109672329-109672351 CAGCCCCAATGAGATGAGCTGGG - Intronic
1046295768 8:112217925-112217947 CAGTCCCAATGACATGAACTGGG - Intergenic
1046296933 8:112232019-112232041 CAAGCCCAACTAAATGAGATAGG - Intronic
1047133591 8:122051169-122051191 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1049872465 8:144991140-144991162 CAGTCCCAATGAGATGAACTGGG + Intergenic
1050201428 9:3149326-3149348 CAGTCCCAATGAGATGAGACAGG + Intergenic
1050300599 9:4253949-4253971 CAGTCCCAATGACATGAGCCAGG + Intronic
1050700249 9:8330218-8330240 CAGTCCCAATGAGATGAAATGGG + Intronic
1050943258 9:11486196-11486218 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1051199345 9:14599245-14599267 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1051230367 9:14949523-14949545 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1051452066 9:17207682-17207704 CAGTCCCAATGAGATGAACTGGG + Intronic
1051982838 9:23045533-23045555 CAGTCCCAATGAGATGAACTGGG - Intergenic
1052052809 9:23866940-23866962 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1052061633 9:23966993-23967015 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1052063719 9:23991795-23991817 CAGTCCCAATGAGATGAACTAGG - Intergenic
1052336490 9:27324951-27324973 CAGTCCCAGTGAAATGAGCTGGG + Intergenic
1053786177 9:41654446-41654468 CAGTGCCAGCGAAGAGAGGTGGG + Intergenic
1054158872 9:61659752-61659774 CAGTGCCAGCGAAGAGAGGTGGG - Exonic
1054449751 9:65397439-65397461 CAGTGCCAGCGAAGAGAGGTGGG + Intergenic
1054478646 9:65590757-65590779 CAGTGCCAGCGAAGAGAGGTGGG - Intergenic
1055125814 9:72717102-72717124 CAGTCCCAATGAAATGAACTGGG + Intronic
1055210227 9:73782840-73782862 CAGTCCCAATGAGATGAACTGGG - Intergenic
1055494479 9:76841106-76841128 CAGTCCCAATGAGATGAGCCAGG - Intronic
1056302722 9:85258492-85258514 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1058034678 9:100237697-100237719 CAGTCCCAATGAGATGAACTGGG + Intronic
1058182428 9:101815318-101815340 CAGTCCCAATGAGATGAACTAGG - Intergenic
1058393085 9:104519961-104519983 CAGTCCCAATGAGATGAACTGGG - Intergenic
1058819199 9:108713578-108713600 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1061213895 9:129209159-129209181 CAGTGCCCAGGAAATGAGGGTGG - Intergenic
1062297518 9:135840667-135840689 CAGCCCCAATGAAATGAGCTGGG - Intronic
1186181412 X:6976543-6976565 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1186318225 X:8394365-8394387 CTGTCCCTAAGAAATGAGGCAGG + Intergenic
1186370106 X:8937734-8937756 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1186599899 X:11025138-11025160 CATTCCCAATGAGATGAGCTGGG + Intergenic
1186773404 X:12839703-12839725 CAGTCCCAAAGAGATGAGCTGGG + Intergenic
1186986433 X:15019441-15019463 CAGTACCAACCACATGAGGTGGG + Intergenic
1187605088 X:20874362-20874384 CAGTCCCAATGAGATGAACTGGG - Intergenic
1187729171 X:22235174-22235196 CAGTCCCAATGAGATGAACTGGG + Intronic
1187784220 X:22866477-22866499 AAGTCCCAATGAGATGAGCTGGG - Intergenic
1187840505 X:23482224-23482246 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1188119552 X:26287298-26287320 CAGTCCCAATGAAATGAACCAGG + Intergenic
1188893392 X:35636705-35636727 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1188922020 X:35987950-35987972 CAGTCCCAATGAGATGAACTGGG + Intronic
1189039859 X:37530801-37530823 CAGTCCCAATGAAATGAACCAGG + Intronic
1189243255 X:39541957-39541979 CAGTCCCAGTGAGATGAGCTGGG - Intergenic
1189590557 X:42506824-42506846 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1189937084 X:46080617-46080639 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1190959864 X:55235168-55235190 CAGTCCCAATGAGATGAGCTGGG + Intronic
1191072107 X:56411367-56411389 CAGTCCCAATGAAATGAGCTGGG + Intergenic
1191094440 X:56659474-56659496 CAGTCCCAATGAGATGAACTGGG + Intergenic
1191114046 X:56833018-56833040 CAGTCCCAATGAAATGAATCAGG + Intergenic
1191153165 X:57242557-57242579 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1191174255 X:57482582-57482604 CAGTCCCTACGAGATGAACTGGG + Intronic
1191650874 X:63536807-63536829 CAGTCCCAATGAGATGAACTGGG - Intergenic
1191686644 X:63899235-63899257 CAGTCCCAATGAGATGAACTGGG - Intergenic
1191705029 X:64085498-64085520 CAGTCCCAAAGAGATGAACTGGG - Intergenic
1191909036 X:66127558-66127580 CAGTCCCAATGAGATGAACTGGG + Intergenic
1191928782 X:66344992-66345014 CAGTCCCAATGAGATGAACTGGG + Intergenic
1191947658 X:66553588-66553610 CAGTCCCAATGAGATGATCTGGG - Intergenic
1192018369 X:67357542-67357564 CAGTCCCAATGAGATGAACTAGG - Intergenic
1192023950 X:67427711-67427733 CAGTCCCAATGAGATGAATTGGG + Intergenic
1192129077 X:68530808-68530830 CAGTCCCAATGAGATGAACTGGG + Intronic
1192524456 X:71829763-71829785 CAGTCCCAATGAGATGAGTCGGG - Intergenic
1192662045 X:73052160-73052182 CAGTCCCAATGATATGAGCCAGG - Intergenic
1192740935 X:73892329-73892351 CAGTCCCAACGAGATGAGCCAGG - Intergenic
1192958267 X:76096187-76096209 CAGTCCCAAAGAGATGAGCTGGG + Intergenic
1192966643 X:76183613-76183635 CAGTCCCAATGAGATGAGCTGGG + Intergenic
1192971215 X:76233449-76233471 CAGTCCCAGTGAAATGAACTGGG - Intergenic
1192993935 X:76492454-76492476 CAGTCCCAATGAGATGAATTGGG - Intergenic
1193019992 X:76781129-76781151 CAGTCTCAATGAAATGAAGTAGG + Intergenic
1193113858 X:77756678-77756700 CAGTCCCAATGAGATGAACTGGG + Intronic
1193190463 X:78564088-78564110 CAGTCCCAATGAGATGAACTGGG + Intergenic
1193284712 X:79697628-79697650 CAGTCCCAATGAAATGAGCCAGG + Intergenic
1193334554 X:80273526-80273548 CAGTCCCACTGAGATGAGCTGGG - Intergenic
1193382264 X:80828519-80828541 CAGTCCCAATGAGATGAAATGGG + Intergenic
1193398481 X:81013983-81014005 CAGTCCCAATGAGATGAACTGGG - Intergenic
1193404386 X:81083734-81083756 CAGTCCCAATTAGATGAAGTGGG - Intergenic
1193510023 X:82388396-82388418 CAGTCCCAATGAGATGAGTCAGG - Intergenic
1193514300 X:82445396-82445418 CAGTCCCAATGAGATGAACTGGG - Intergenic
1193517389 X:82484757-82484779 CTGACCTAAAGAAATGAGGTAGG - Intergenic
1193562570 X:83037589-83037611 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1193616091 X:83689234-83689256 CAATCCCAATGAAATGAGCCAGG + Intergenic
1193700032 X:84748923-84748945 CAGCCCCAATGAGATGAGCTGGG + Intergenic
1193774116 X:85622248-85622270 CAGTCCCAATGAGATGAAGTGGG - Intergenic
1193878645 X:86895652-86895674 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1193897169 X:87128414-87128436 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1194021167 X:88694296-88694318 CAGTCCCAATGAGATGAGCCAGG - Intergenic
1194208595 X:91040517-91040539 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1194261633 X:91702861-91702883 CAGTCCCAATGAGATGAGACAGG - Intergenic
1194576441 X:95619275-95619297 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1194783218 X:98049698-98049720 CAGTCCCAATGAGATGAAGCAGG + Intergenic
1194798491 X:98241185-98241207 CAGTCCCAATGAGATGAGCCCGG + Intergenic
1194837568 X:98699456-98699478 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1194959158 X:100215127-100215149 CAGTCTCAATGAGATGAGCTGGG + Intergenic
1194963910 X:100266626-100266648 CAGTCCCAATGACATGAGTTGGG - Intergenic
1195434782 X:104829472-104829494 CAGTCCCAATGAAATGAACTGGG + Intronic
1195808315 X:108800925-108800947 CAGTCCCAATGAGATGAACTTGG - Intergenic
1195810721 X:108825551-108825573 CAGTCCCAATGAAATGAACTGGG + Intergenic
1195842658 X:109191806-109191828 CAGTCCCAATGAGATGAACTGGG - Intergenic
1196133303 X:112180978-112181000 CAGTCCCAATGAGATGAGCCGGG - Intergenic
1196367900 X:114943512-114943534 CAGTCCCAATGAGATGAGCCAGG + Intergenic
1196960306 X:120993395-120993417 CAGTCCCAATGAGATGAGCCGGG + Intergenic
1197403659 X:126025384-126025406 CAGTCCCAGTGAAATGAGCTGGG - Intergenic
1198002368 X:132452011-132452033 CAGTCCCAGTGAGATGAGCTGGG + Intronic
1198295491 X:135282830-135282852 CAGTCCCAATGAGATGAGCTGGG + Intronic
1198555718 X:137791831-137791853 CAGTCCCAATGAGATGAGCTGGG - Intergenic
1198645588 X:138802435-138802457 CAGTCCCAATGAGATGAACTGGG + Intronic
1198678653 X:139157905-139157927 CAGTCCCATTGAGATGAGCTGGG - Intronic
1198680642 X:139178054-139178076 CAGGCCCAATGAGATGAGCTGGG + Intronic
1198753451 X:139958737-139958759 CAGTCCCAATGAGATGAACTGGG - Intronic
1198829250 X:140731199-140731221 CAGACTCAAAGAAATGAAGTTGG - Intergenic
1199469907 X:148182390-148182412 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1199477460 X:148260757-148260779 CAGTCCCAGTGAGATGAGCTGGG + Intergenic
1199524986 X:148782027-148782049 CAGTCCCAATGAGATGAACTGGG + Intronic
1199999043 X:153047404-153047426 CAGTCCCAGTGACATGAGGGTGG - Intergenic
1200333127 X:155319356-155319378 CAGTCCCAATGAGATGAGCTGGG - Intronic
1200388593 X:155918650-155918672 CAGTCCCAATGAGATGAGCCGGG + Intronic
1200580281 Y:4941654-4941676 CAGTCCCAATGAGACGAGATAGG - Intergenic
1201371566 Y:13269889-13269911 CAGTCCCAGTGAGATGAGGAGGG + Intronic
1201690078 Y:16753365-16753387 CAGTCCCAATGAGACGAGCTGGG + Intergenic
1201853992 Y:18520816-18520838 CAGTCCCAACGAGATGAACTGGG - Intergenic
1201879329 Y:18799568-18799590 CAGTCCCAACGAGATGAACTGGG + Intronic
1202040171 Y:20674617-20674639 CAGTCCCAATGAGATGAACTGGG - Intergenic
1202342328 Y:23882615-23882637 CAGTCCCAATGAGATGAACTGGG + Intergenic
1202528441 Y:25787470-25787492 CAGTCCCAATGAGATGAACTGGG - Intergenic