ID: 1115361552

View in Genome Browser
Species Human (GRCh38)
Location 14:32509054-32509076
Sequence GAGGCCAAGGCAGGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 2, 1: 6, 2: 14, 3: 68, 4: 544}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115361552_1115361556 -2 Left 1115361552 14:32509054-32509076 CCTTGTGATCCTGCCTTGGCCTC 0: 2
1: 6
2: 14
3: 68
4: 544
Right 1115361556 14:32509075-32509097 TCCCAAAGTGCTGAGATTACAGG 0: 16720
1: 305812
2: 257224
3: 144363
4: 132215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115361552 Original CRISPR GAGGCCAAGGCAGGATCACA AGG (reversed) Intronic
900306773 1:2013901-2013923 GAGGCCGAGGCAGGAGAACTGGG - Intergenic
900380247 1:2380399-2380421 GGGGCCAAGGCAGAAGCACTTGG + Intronic
901295352 1:8156928-8156950 AAGACCAAGGCAGGATTAGAGGG + Intergenic
901315616 1:8305749-8305771 GAGGCCAAGGCAGGAGAGAACGG + Intergenic
901913694 1:12481198-12481220 GAGGCCCAGGCAGGGGCCCAGGG + Intronic
902236241 1:15059362-15059384 GAGACCAAGGCAGGGGGACATGG + Intronic
902523975 1:17042120-17042142 GAGGCCAAAGCAGGCCGACATGG - Intronic
903664152 1:24996393-24996415 GAGGCCCAGGAAGGACCACTAGG - Intergenic
904160728 1:28520355-28520377 GAGGTCAGGGCAGGAGCACCAGG + Intronic
904493407 1:30873894-30873916 GCGGCCAGGGCAGGTCCACAGGG + Intronic
904503229 1:30929725-30929747 GTGGCAAGGGCAGGATGACATGG + Intergenic
904565811 1:31427732-31427754 GAGGCCTAGCCAAGGTCACATGG + Intronic
904622577 1:31784090-31784112 GAGCCCAAGGTAGGATGAGAAGG + Intergenic
904799950 1:33085600-33085622 GAGTCCTGGGCAGGATGACAGGG + Intronic
905631806 1:39522954-39522976 GAGGCTCAGGGAGGAGCACATGG + Intronic
906211106 1:44012734-44012756 GAGGACAAGGCAGGAAAGCAGGG + Intronic
906396964 1:45474713-45474735 GAGGCCAAGGCAGGTGGCCAAGG - Intronic
906501273 1:46343038-46343060 TTGGCCGAGACAGGATCACAAGG - Intronic
906536750 1:46554955-46554977 GGGGCCAAGGCCTGATCACTAGG + Intergenic
906561918 1:46764541-46764563 GAGGCCCAGGGAGGAGCAAAGGG - Intronic
906613191 1:47217646-47217668 TAGGCCAAGCCAGAGTCACATGG + Exonic
906695671 1:47821712-47821734 CAGGCCTTTGCAGGATCACAGGG - Intronic
907169833 1:52452445-52452467 AAGACCAAGGCATGATTACAGGG + Intronic
907351094 1:53831438-53831460 GAGGCCGAGGGCAGATCACAAGG + Intronic
908602774 1:65759114-65759136 AAGACCAAGGCAGGATTACAGGG + Intergenic
910514797 1:88048041-88048063 GAGGCTGAGGCAGGAGAACAGGG - Intergenic
911429202 1:97761966-97761988 GAGCACAAGGAAGGAACACAAGG + Intronic
912014310 1:105013604-105013626 GTGGCCAAGGCTGGAACAAATGG + Intergenic
915721986 1:157992714-157992736 GAAGCCAAGGCAGGGCCTCAAGG + Intergenic
916182575 1:162099422-162099444 GAGGCTGAGGGTGGATCACAAGG - Intronic
917505965 1:175627205-175627227 GAGGACAAAGCAGAATCTCATGG + Intronic
917922315 1:179760697-179760719 GTGGCAAAGGCAGGAGCAGAGGG + Intronic
918298775 1:183183424-183183446 GAGGCTTAGGCAGGTTCCCAGGG - Intergenic
918650992 1:186962920-186962942 GATTCCAAGCCAGGTTCACAAGG - Intronic
919174170 1:193998898-193998920 GAGGCCGAGGAGGGATCACGAGG - Intergenic
919726180 1:200885891-200885913 TAGGCCCAGGCCTGATCACAGGG + Intergenic
920119495 1:203645285-203645307 AGGGCCCAGGCAGGATGACAGGG - Intronic
920235188 1:204498285-204498307 GAGGGGAATGCAGGATCAAAGGG + Intergenic
921671959 1:217935220-217935242 GAGGCAAAGGCAGACACACAGGG - Intergenic
921956546 1:220990852-220990874 GAGGTAAGTGCAGGATCACAAGG - Intergenic
922754244 1:228085999-228086021 AGGGCCAAGGCAGGATTAGAGGG + Intronic
923242586 1:232099891-232099913 AAGGGCAAAGCAAGATCACAAGG + Intergenic
1063250381 10:4267306-4267328 GAGGCCCAGGGAGGAGCACCAGG + Intergenic
1064071129 10:12229039-12229061 GAGGCGGAGGCAAGATCACTTGG - Intronic
1064903082 10:20315363-20315385 GAGACCAAGGCAGGATCAGAGGG - Intergenic
1064952156 10:20865028-20865050 AAGTCCAAGTAAGGATCACATGG + Intronic
1065016234 10:21465167-21465189 GAGGCTAAGGCAGGAGGCCAAGG + Intergenic
1065936238 10:30522916-30522938 GAGGTCAGGGCGAGATCACAAGG - Intergenic
1066238203 10:33507516-33507538 GAGGCCATGGCGGGACCTCAGGG - Intergenic
1066327434 10:34377369-34377391 GAGGCCAAGGCAGGAGTTCAAGG + Intronic
1066597736 10:37070361-37070383 GAGGCCAAGGCTGGATCACGAGG + Intergenic
1066620132 10:37340171-37340193 GAGGCTGAGGCAGGAGAACAGGG - Intronic
1067137549 10:43624681-43624703 AAGACCAAGGGAGGATTACAGGG - Intergenic
1067139901 10:43648457-43648479 GAGGCCGCGGCAGGCTCACCCGG - Intronic
1069487381 10:68832568-68832590 GAGGCTAAGGCAGGAGAACCCGG + Intronic
1070679469 10:78438477-78438499 AAGGACAATGCAGGATCAGAGGG + Intergenic
1071370001 10:84941473-84941495 GAGGCAAAGGCAAGATCAAAAGG + Intergenic
1071664900 10:87544512-87544534 AAGGCAAAGGCATGATTACAGGG - Intronic
1071817569 10:89248715-89248737 GAGGCCGAGGCGTGATCACGAGG - Intronic
1073003255 10:100301201-100301223 AAGGTCAAGGCGAGATCACAAGG + Intronic
1073233448 10:101992727-101992749 GAGGCCAAGGCGGGATCACAAGG - Intronic
1073486503 10:103822440-103822462 GGGGCCATGGCAGGATGCCAGGG - Intronic
1073492590 10:103863807-103863829 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1074242248 10:111650833-111650855 GGGGCCAGGGCAGGATGATACGG + Intergenic
1074510139 10:114104174-114104196 GAGGCTGAGGGTGGATCACAAGG + Intergenic
1074770402 10:116729980-116730002 GAGGCCAAAGCAGGCCAACATGG + Intronic
1074782369 10:116811258-116811280 GTGGCCAATGCAGAATCAGAGGG + Intergenic
1074826393 10:117218010-117218032 GGTGACAAGGCAGGACCACAGGG - Intergenic
1074932670 10:118145152-118145174 GAGGTCATGGCAGGTTCACTTGG - Intergenic
1075015787 10:118909182-118909204 GAGGCCAAGGAAGGGACAGAAGG + Intergenic
1075509629 10:123060757-123060779 GAGGCTAAGGCAGGAGAACCTGG + Intergenic
1076140371 10:128073579-128073601 GAGACCAAGCCAGGACCACTAGG + Intronic
1076478466 10:130768500-130768522 AAGGTCAGGGCAAGATCACAAGG + Intergenic
1076614783 10:131748166-131748188 GTGCCCCAGGCAGGCTCACAGGG - Intergenic
1076875469 10:133213571-133213593 GTGTCCAAGGCAGGGTCCCAGGG - Intronic
1077284131 11:1758394-1758416 GAGGCCCAGGCAGGGTGACAAGG + Intronic
1077843177 11:5996931-5996953 GAGAGCAAGGCAGGATGAGATGG + Intergenic
1077913647 11:6596397-6596419 GAGGCCTGGGCAAGATCACACGG + Exonic
1078233803 11:9465922-9465944 GAGGAGAAGGGAGGATCACTTGG - Intronic
1079040054 11:17051433-17051455 CAGGCCAAGGCAGGAGAACCAGG + Intergenic
1079666886 11:23117053-23117075 AAGGGCAAAGCAAGATCACAAGG + Intergenic
1080041733 11:27766502-27766524 GAGGCCATGGCATAAACACAAGG - Intergenic
1080723511 11:34872269-34872291 AAGACCAAGGCAGGATTAGAGGG + Intronic
1080778914 11:35412828-35412850 GAGCCCAGGGCATGACCACATGG - Intronic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081472935 11:43393648-43393670 AAAGCCAAGGCATGATCAGAGGG - Intronic
1081644781 11:44782307-44782329 GAGGTCAAGGGAGGATCATGAGG + Intronic
1082627630 11:55503358-55503380 CAGGCCAAGGCAGGACCTCCGGG + Intergenic
1082986237 11:59172874-59172896 GTGGCCAAGGTGGGTTCACAGGG - Intronic
1083170689 11:60922511-60922533 GAAGCCAAGGCAGCAGCAGAGGG - Exonic
1083340365 11:61955255-61955277 CAGGCCAGGGGAGGATCACGAGG + Intronic
1083924442 11:65797535-65797557 GAGGCCAAGACTGGATCCCCGGG - Intergenic
1084255906 11:67942586-67942608 GAGTCCATGGCAGCCTCACATGG - Intergenic
1084961240 11:72717890-72717912 GAGGCCATGCCAGGGTCCCAGGG + Intronic
1085260498 11:75201928-75201950 GGGACCAAGGCAGGATTAGAGGG - Intronic
1085468598 11:76741492-76741514 GAGGGCCAGGCAGGGGCACAGGG - Intergenic
1085892072 11:80592029-80592051 GAGGCTGAGGCTGGATCACGAGG - Intergenic
1086579534 11:88383017-88383039 GAGGCTAAGGCAGGAGAACCAGG - Intergenic
1086961391 11:92982632-92982654 GAGGCCAAGGCAGGAGGATGAGG - Exonic
1087208376 11:95420356-95420378 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1087841888 11:102928883-102928905 CAGGAAAAGGCAGGATGACAAGG + Intergenic
1088068663 11:105754099-105754121 AAGACGAAGGCAGGATCAGAGGG - Intronic
1088505279 11:110521572-110521594 GAAGCCAAGGCAGGATCATGTGG + Intergenic
1088868169 11:113869055-113869077 GAGGCTGAGGCAGGATGACTTGG + Intronic
1089054552 11:115575034-115575056 GAGGTCAAGGAAGGACCAGAGGG + Intergenic
1089111645 11:116062240-116062262 GTGGGCAATGCAGGAGCACATGG + Intergenic
1089385311 11:118063616-118063638 AAGCCCAAGGCAGGATTAGAAGG + Intergenic
1091289566 11:134430202-134430224 GGGACCAAGGCTGGATGACAAGG - Intergenic
1091315953 11:134614193-134614215 GAGGCCTAGGAAGCATCACGTGG + Intergenic
1091524519 12:1284873-1284895 GAGGCCAAGGCAGGAGGAAGGGG - Intronic
1091977475 12:4837031-4837053 AAGACCAAGGCAGGATTATAGGG + Intronic
1092080349 12:5710922-5710944 GAGGCCGAGGCGGGATCACGAGG + Intronic
1092426143 12:8377326-8377348 GAGTCCATGGCAGCCTCACATGG - Intergenic
1092498493 12:9022602-9022624 AAGACCAAGGCATGATCAGAGGG + Intergenic
1093254567 12:16850787-16850809 AAGACCAAGGCAGGATTAGAAGG - Intergenic
1093455935 12:19364895-19364917 GAGGCCAAGGCAGGATCATGAGG - Intronic
1094371257 12:29740114-29740136 GAGGCTGGGGCAGGATCACTTGG - Intronic
1095052719 12:37568567-37568589 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1095245108 12:39910750-39910772 TAGGCAAAGGGAGGATAACATGG + Intronic
1095983829 12:47986987-47987009 GAGGCCAGGGCAGGAGAGCATGG + Intronic
1096583874 12:52606811-52606833 GAGGCCCAGGGAGGAACTCAGGG - Intergenic
1096584465 12:52610860-52610882 GAGGCCCAGGGAGGAACTCAGGG - Intronic
1096666484 12:53169818-53169840 GAGTCCCAGGCAGCACCACAGGG - Intronic
1097044035 12:56173861-56173883 GAGGCAGAGACAGGGTCACACGG + Intronic
1097082549 12:56443536-56443558 AAGGGCAGAGCAGGATCACAAGG - Intronic
1097698421 12:62796898-62796920 AAGACCAAGGCAGGATTAGAGGG - Intronic
1097929153 12:65165360-65165382 GAGGCCGAGGAGGGATCACTTGG - Intergenic
1098008329 12:66022376-66022398 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1100490653 12:95074647-95074669 GAGGCCAAGGAAAGATCACTTGG + Intergenic
1100714781 12:97294262-97294284 GAGGCACAAGCAGGGTCACAGGG - Intergenic
1100748129 12:97667892-97667914 GGGGCCAAGGCAGGTTAACAAGG + Intergenic
1101512464 12:105405586-105405608 GAGGCTAAGGCAGGAGGATAAGG - Intergenic
1102562504 12:113772327-113772349 GAGGCCATGGCAGGATTGCTTGG - Intergenic
1103042509 12:117707518-117707540 GAGGCCAAGGCAGTAGCTCAGGG - Intronic
1103176600 12:118869411-118869433 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1103350303 12:120278907-120278929 CAGGCCAAGGCAGGAGAACCAGG + Intergenic
1103729033 12:123013809-123013831 GAGGCCAAAGCAGGCGCACCTGG + Exonic
1103966333 12:124642222-124642244 GAGGCCAAGGCAGGAGAGCGTGG + Intergenic
1105229065 13:18472726-18472748 GAGGCCAAGGCAGGCGATCACGG + Intergenic
1105278146 13:18948163-18948185 GAGGCCAGGGCTGGATCCCATGG - Intergenic
1105422324 13:20264078-20264100 GAGACCAAGACAGGAAGACACGG - Intergenic
1105464056 13:20620764-20620786 GAGGCCGAGCCAGGCTAACATGG - Intronic
1105513418 13:21070604-21070626 GAGGCCGAGGCGGGATCACAAGG - Intergenic
1105804111 13:23939728-23939750 AAGGGCAGAGCAGGATCACAAGG + Intergenic
1107436466 13:40384764-40384786 GAGGCCAAGGCAGGATCACGAGG - Intergenic
1109161071 13:58975211-58975233 GAGGCCAAGGACAGATCACAAGG - Intergenic
1109230194 13:59747577-59747599 GTGGCCAAGGCAGGACCTGATGG - Intronic
1109521202 13:63512303-63512325 GAGGGCAAGCCAGGCTCAGAGGG - Intergenic
1110536633 13:76658212-76658234 GAGGCCAAGGCAGGAGGATCAGG + Intergenic
1110859203 13:80328891-80328913 GAGGCCAAGGTGGGATCACAAGG - Intergenic
1110953689 13:81525312-81525334 AAGGGCAAAGCAAGATCACAAGG - Intergenic
1111336736 13:86835839-86835861 GGGGCCAAGGCAGAATGATATGG - Intergenic
1113237668 13:108298737-108298759 GAGGCCAAGGCAGGATCACAAGG + Intronic
1113318422 13:109208347-109208369 AAGGACAAGGCAGGATCAGCAGG + Intergenic
1114013347 14:18399612-18399634 GAGGCCAAGGCAGGCGATCACGG + Intergenic
1114561368 14:23593788-23593810 GAGGCTGAGGGTGGATCACAAGG - Intergenic
1114684721 14:24517819-24517841 GAGGGACAGGCAGCATCACAAGG - Intergenic
1115361552 14:32509054-32509076 GAGGCCAAGGCAGGATCACAAGG - Intronic
1116157885 14:41231568-41231590 GAGGCCAAGGCAGGAGGATTAGG - Intergenic
1117460113 14:55936808-55936830 AAGACCAAGGCAGGATTAGAAGG - Intergenic
1117638934 14:57776430-57776452 GAGGCCACGGGCGGATCACGAGG + Intronic
1118216327 14:63811921-63811943 AAGGGCAAAGCAAGATCACAAGG + Intergenic
1118325075 14:64775000-64775022 GAGGCCAGGGGAGGGGCACAAGG - Intronic
1119814821 14:77556218-77556240 GAGGCTAAGGCAGGAGAACCGGG + Intronic
1119873527 14:78036963-78036985 GAGGCCAAGGCAGGATCACGAGG - Intergenic
1120295410 14:82634014-82634036 AAGGTCAGGGCAAGATCACAAGG - Intergenic
1121087826 14:91160039-91160061 CAGGCCAAGGGAGGGGCACAGGG + Intronic
1121458696 14:94056331-94056353 AAGGCCAAGGCAGGATTAGAAGG + Intronic
1121595810 14:95161411-95161433 AAGACCAAGGCAGGATCAGAGGG + Intergenic
1121624502 14:95374404-95374426 TAGACCAAGGCAGGATTAGAGGG - Intergenic
1122671355 14:103375110-103375132 GAGGCTGAGGCAGAATCACTTGG - Intergenic
1123451385 15:20363802-20363824 ATGGCCAAAGCAGAATCACATGG - Intergenic
1124019174 15:25903851-25903873 GAGCCAAAGGCAGGAGCCCATGG - Intergenic
1124183815 15:27503100-27503122 AAGACCAAGGCAGGATTAGAAGG - Intronic
1124591923 15:31061282-31061304 GAAGCCACGGCAGAATGACAAGG - Intronic
1125909881 15:43426773-43426795 GAGGCCGAGGCCTGAGCACAAGG + Intronic
1126009890 15:44292588-44292610 GAGCCCAAGGCAAGATCACTTGG - Intronic
1126665157 15:51069179-51069201 CAGCCAAAGGCAGGATCTCAGGG - Intronic
1127199014 15:56623269-56623291 GAGGCCGAGGTGGGATCACGAGG + Intergenic
1127237973 15:57076418-57076440 GAGACTGAGGCGGGATCACAAGG + Intronic
1127261746 15:57331601-57331623 GAGGCCCAGGGAGGAGGACAGGG + Intergenic
1127277130 15:57457040-57457062 ATGGCCAAGGAAGCATCACACGG - Intronic
1127869193 15:63056427-63056449 GAGGCCAAGGCAGGTGGATAAGG + Intronic
1127897450 15:63314607-63314629 AAGCCCATGGCAGGATTACAGGG - Intergenic
1128139472 15:65288134-65288156 GAGGCCAAGGAGGTATCAGAGGG - Intronic
1128417733 15:67462192-67462214 GAGGCCGAGAGTGGATCACAAGG + Intronic
1129108523 15:73324348-73324370 GAAGCCTTGGCAGGCTCACAAGG + Intronic
1129320252 15:74770823-74770845 GAGGCCAATCCAGGATCCCCAGG + Intergenic
1130666104 15:85871467-85871489 GAGGCCGAGGTGGGATCACCTGG - Intergenic
1130868221 15:87950045-87950067 GAGGCCAAGGCAGCATTCCTGGG - Intronic
1131092140 15:89631308-89631330 GAGGCCAAAGCAGGGGCAGAAGG + Intronic
1131312826 15:91306324-91306346 GAGGCAAAGCCAAGAGCACATGG - Intergenic
1132366610 15:101262276-101262298 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1132654276 16:1035371-1035393 TAGGCCAAGACAGGGTCAGAGGG - Intergenic
1133047263 16:3095592-3095614 GAGGCCGAGGGTGGATCACCAGG + Intronic
1133264936 16:4577425-4577447 GAGGCCAAGGCAGGCAGATACGG + Intronic
1133414333 16:5594553-5594575 GAAGCAAAGGCAGGAAGACAGGG + Intergenic
1133497311 16:6331211-6331233 GAGGCCAAGGCAGGTGGACGTGG + Intronic
1134414117 16:14029079-14029101 GAGGCCAAGGCAGGAGGATCAGG + Intergenic
1134772783 16:16824604-16824626 GAGGCCAAGGCAGGAGGATCAGG - Intergenic
1137452399 16:48589291-48589313 GAGACCAAAGTAGGATGACAGGG + Intronic
1137684917 16:50380066-50380088 GAGGCCAAGGTAGGAGGACCAGG + Intergenic
1139273027 16:65701007-65701029 AAGGCCAAGGCATGATTAGAGGG + Intergenic
1139844801 16:69912805-69912827 GAGGCCAAGGCAGGAGGATCTGG + Intronic
1140437936 16:74963786-74963808 GAGGCCAAGGCAGAGGCAGATGG + Intronic
1140822512 16:78676318-78676340 GAGGGCAATGCAGGAACAAAAGG - Intronic
1140915318 16:79488218-79488240 GAGGAAAAGGCAGGTTCACAAGG - Intergenic
1141183778 16:81772713-81772735 GAGGCTGAGGCAGGATAACCAGG + Intronic
1141747937 16:85938559-85938581 GGGGCCAGGGCAGGAACAGAAGG - Intergenic
1141846315 16:86611310-86611332 GAGGCTATGGCAGGAGCAGAGGG - Intergenic
1141935663 16:87236367-87236389 GAGCCAGAGGCAGGACCACAGGG - Intronic
1203141913 16_KI270728v1_random:1772281-1772303 GAGGCCAAGCCAGGCTCCCTGGG - Intergenic
1143124408 17:4632343-4632365 GAGGCCAAGAGAGGAGAACAAGG + Intronic
1143556365 17:7663854-7663876 GAGGCCAAGGCAGGCACATCAGG - Intronic
1143686399 17:8520260-8520282 GAGGCCGAGGCGGGATCACGAGG + Intronic
1143886291 17:10067475-10067497 GAGGCTGAGGCAAGATCACAAGG - Intronic
1144353839 17:14425632-14425654 GAGGCCGAGGCAGGATCATGAGG + Intergenic
1145373238 17:22324506-22324528 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1145839791 17:27984836-27984858 GAGGACAAGACAGGGACACAGGG - Intergenic
1145934720 17:28708240-28708262 GAGGCCGAGGGCGGATCACAAGG - Intronic
1146021774 17:29285356-29285378 GAGGCCGTGGGTGGATCACAAGG + Intronic
1146061134 17:29607957-29607979 GAGGGCGAGGCAAGGTCACAGGG - Intronic
1146333530 17:31950087-31950109 GAGGCTGAGGCAGGAGAACACGG - Intronic
1146657012 17:34640490-34640512 GAGCCCAAAGCAGAACCACAGGG + Intergenic
1146948624 17:36890824-36890846 AAGTCCAAGACAGGATGACAGGG + Intergenic
1147537487 17:41330106-41330128 GAGGCCAAGGCAGGAGGTTAAGG + Intergenic
1147730219 17:42595338-42595360 GAGGCCAAGGTAGGATCACGAGG - Intronic
1148050349 17:44767119-44767141 GATGCCAAGGGTGGATCACAAGG + Intronic
1148095257 17:45048403-45048425 GAGGCCGAGGGCGGATCACGAGG + Intronic
1148465700 17:47863938-47863960 GAGGCCGAGGCAGGCTAACATGG - Intergenic
1148515057 17:48209118-48209140 GTGGACAAGGCAGGAACAGAAGG + Intronic
1149446852 17:56720049-56720071 GAGGCTAAGGCAGGAGAACGGGG - Intergenic
1149540089 17:57462185-57462207 TAGGCCCAGGCATGAGCACAGGG - Intronic
1151080715 17:71325393-71325415 AAGACCAAGGCAGGATCAGAGGG - Intergenic
1151321528 17:73355438-73355460 GAGGCTAAGGCAGGAGAACCCGG - Intronic
1151426108 17:74032137-74032159 GAGAGCAAGGCAGGAACAGAGGG + Intergenic
1151452585 17:74207618-74207640 GAGGCTGAGGCAGGAGAACATGG - Intronic
1151532013 17:74712650-74712672 GTTGCCAAGGCAGGAATACAGGG - Intronic
1152040056 17:77897259-77897281 GAGGCCGAGGTAGGGTCTCATGG - Intergenic
1152081453 17:78190062-78190084 GAGGCGGAGGCGGGATCACGAGG - Intronic
1152286106 17:79414118-79414140 GAGGCTCAGGCAGGTTCTCAAGG + Intronic
1152730661 17:81968045-81968067 GAGGCCACGTGGGGATCACAGGG - Intergenic
1152871986 17:82759558-82759580 GAGGCCAAGGCAGGATTGCTTGG - Intronic
1152973975 18:195495-195517 GAGGGCAAGGTATGATCACTAGG + Intronic
1153008662 18:518435-518457 AAGACCAAGACAGGATTACAGGG + Intergenic
1154210587 18:12376182-12376204 GAGGCCAAGCCAGGTTCCCGTGG + Intronic
1154524388 18:15267393-15267415 GAGGCCAAGGCAGGCGATCACGG - Intergenic
1154950126 18:21201887-21201909 GAGGCCAAGGCGGGATCACAAGG - Intergenic
1155841134 18:30643886-30643908 AAGACCAAGGCGGGATTACAGGG - Intergenic
1156439644 18:37171445-37171467 GAGGCCAAGGCAGGAGGATCAGG - Intronic
1157739930 18:50083387-50083409 GAGACCAAGGCATGATTAGAGGG - Intronic
1158706544 18:59797455-59797477 GAGGCCAGTGTAGGATCAAATGG + Intergenic
1159739785 18:72153130-72153152 GAGGCCAAGGTGAGTTCACAGGG - Intergenic
1159938765 18:74389520-74389542 GAGGCCAGGGGAGGAGCACTGGG + Intergenic
1160174707 18:76583385-76583407 GATGCCAAGGCACCATCCCAGGG - Intergenic
1161290435 19:3491074-3491096 GAAGCCAAGGGAGGATCGCGAGG - Exonic
1161334020 19:3701865-3701887 GAGGCTAAGGCAGGAGAATAGGG + Intergenic
1161618571 19:5286296-5286318 GAGGCAGAGGGAGGGTCACATGG + Intronic
1161823587 19:6546545-6546567 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1162817797 19:13207154-13207176 GAGGCCAGGGCTGGGCCACAAGG - Exonic
1163387274 19:17007598-17007620 GAGCCACAGGCAGGATCACGGGG - Intronic
1163704366 19:18803757-18803779 TGGGCCAAGGTGGGATCACATGG + Intergenic
1163984181 19:20929419-20929441 GAGGCTGAGGTGGGATCACAAGG - Intronic
1164764425 19:30753030-30753052 GTGGTCATGGCAGGCTCACATGG + Intergenic
1164899976 19:31910133-31910155 GAGGGCAAGGAAGGTGCACACGG - Intergenic
1164966760 19:32491425-32491447 GAGGCCAAGGCAGGATCGGTTGG + Intergenic
1165434790 19:35789886-35789908 GAGACCACAGCAGGATCCCAAGG - Intergenic
1165570328 19:36770334-36770356 AAGACCAAGGCAGGATTAGAGGG - Intronic
1166197693 19:41217842-41217864 CAGGAGAAGGCAGGATCAGACGG + Intergenic
1166517766 19:43460272-43460294 GAGTCCAAGGCAGGAGGACTGGG + Intergenic
1166607832 19:44161273-44161295 GAGGCCGAGGGCGGATCACAAGG - Intergenic
1166685561 19:44794124-44794146 GAGTCCCAGGCAGGAGAACATGG + Intronic
1166770863 19:45281284-45281306 GAGGCCGAGGGTGGATCACGAGG - Intronic
1166799755 19:45449415-45449437 GAGGCCAAGGCAGGAAGATTGGG + Intronic
1166963119 19:46511595-46511617 CATACCATGGCAGGATCACAGGG + Intronic
1167368102 19:49065120-49065142 GAGTGCAAGGCAGGATCCCCCGG - Intergenic
1167506488 19:49873552-49873574 GAGGCCAGGGCAGGGCCAAAGGG - Intronic
1167597671 19:50435956-50435978 GAGGCCCAGGAAGGAACATAAGG - Intronic
1167737298 19:51303172-51303194 AAGGTCAAGGCAGGATTATAGGG - Intergenic
1167912827 19:52718105-52718127 GAGGCCAGGGCATGATCACAAGG + Intronic
1167969164 19:53175853-53175875 AAGACCAAGGCAAGATTACAGGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925287029 2:2722497-2722519 CATCCCAAGGGAGGATCACACGG + Intergenic
926069852 2:9878324-9878346 GAGGCCAAGGCAGGAGGCCAAGG - Intronic
926489250 2:13503835-13503857 GAGGCTGAGGCAGGATCTGATGG - Intergenic
926555617 2:14354484-14354506 GAGGCCATGGCAGGGTGAGAGGG - Intergenic
926752561 2:16209830-16209852 GTGGCCACAGTAGGATCACAGGG + Intergenic
927224738 2:20752724-20752746 GAGGCCAAATCAGTATCACTGGG + Intronic
927555478 2:24028152-24028174 GAGGCCGAGGCGGGAACACGAGG + Intronic
927783659 2:25957838-25957860 GAGGCCAAGGCAGGAGGAAGAGG + Intronic
927970656 2:27304350-27304372 GAGGCTGAGGCAGGAGGACAAGG + Intronic
928083249 2:28328219-28328241 GAGGACAAGGCAAGACCACGAGG + Intronic
928429251 2:31204463-31204485 AAGACCAAGGCAGGATTAGAAGG + Intronic
929260317 2:39859578-39859600 AAGACCAAGGCAGGATTAGAAGG - Intergenic
930124799 2:47787086-47787108 GAGGCCAAGGCAGGCCAACATGG + Intronic
930130557 2:47845710-47845732 GAGGGCGAGGCAGGGTAACAAGG + Intronic
931229609 2:60363298-60363320 GAGGCCAAGGCAGGAGGATCAGG + Intergenic
931304173 2:61012587-61012609 GAGGCCGAGGGTGGATCACCTGG + Intronic
931441050 2:62290786-62290808 AAGACCAAGGCAGGATTAGAGGG + Intergenic
931858479 2:66329117-66329139 AAGGCTAAGGAAGGATGACATGG + Intergenic
932087796 2:68777010-68777032 GAGGCCAGGGAAGGATCGCAGGG + Intronic
932375613 2:71233057-71233079 AAGGGCAGAGCAGGATCACAAGG + Intergenic
933992563 2:87643970-87643992 GATTCTAAGGCAGGAGCACATGG - Intergenic
934027197 2:88010833-88010855 AAGACCAAGGCAGGATTAGAGGG - Intergenic
934761528 2:96859496-96859518 GAAGCCAAGGCTGGCTCCCAAGG + Intergenic
935690848 2:105731268-105731290 CAGGGCAAGGCAGGAGCACTAGG - Intergenic
935704204 2:105841653-105841675 AAGACCAAGGCAGGATTAGAGGG - Intronic
936301290 2:111306871-111306893 GATTCTAAGGCAGGAGCACATGG + Intergenic
937217765 2:120323556-120323578 GAGGCCCAGGCAGGAGCCCGGGG - Intergenic
938315789 2:130327236-130327258 GAGGTCAAGGCAGGATCACGAGG + Intergenic
938523573 2:132099515-132099537 GAGGCCAAGGCAGGCGATCACGG - Intergenic
939307054 2:140425641-140425663 GATGCTGAGGCAGGATCACCAGG - Intronic
939873181 2:147547776-147547798 GAGGCCAAGGCAAGATGACCAGG - Intergenic
942763461 2:179427379-179427401 GAGGCCAAAGCAGTGTCACTTGG + Intergenic
942936329 2:181561174-181561196 GAGGCCAAGGGTGGATCACGAGG + Intronic
943676855 2:190724075-190724097 GAGGCCAAGGCAGGAGGCTAAGG + Intergenic
943892609 2:193309802-193309824 GAGGCCGAGGCAGGCCAACATGG + Intergenic
944151291 2:196561421-196561443 AAGGTCAGGGCGGGATCACAAGG - Intronic
944307262 2:198192961-198192983 GAGGCCAAGGCAGGACTGCTTGG - Intronic
944341363 2:198604862-198604884 GAGGATAAGGCAGGATAATAGGG + Intergenic
944930493 2:204513890-204513912 GAGGCCAGGGCAAGGTCACATGG - Intergenic
945262212 2:207854012-207854034 GAGGCCTAGGCAGGATCACTTGG - Intronic
945951324 2:216041671-216041693 CAGACCAAGGCATGATTACAGGG + Intronic
947276467 2:228397380-228397402 AAGGTCAGGGCAAGATCACAAGG + Intergenic
947647052 2:231749948-231749970 GAGGCCAGGGCAGAATGATATGG + Intronic
947780964 2:232762804-232762826 GAGGCCAAGGCAGGACAGCCTGG + Intronic
947967233 2:234291524-234291546 AAGACCAAGGCAGGATTAGAGGG - Intergenic
948696791 2:239736858-239736880 GAGGACAAGGCAGGACCCCCAGG + Intergenic
948844389 2:240676261-240676283 GAGGAAAGGGCAGGATGACAGGG - Intergenic
948849469 2:240698618-240698640 GAGGAAAGGGCAGGATGACAGGG + Intergenic
1168968218 20:1912983-1913005 GAGGCCCAGCCAGCATCAGACGG - Intronic
1169103342 20:2972064-2972086 GAGGCTGAGGCAGGATCATGGGG - Intronic
1171478778 20:25436054-25436076 GAGGCCAAGGTGAGATCACAAGG - Intronic
1171488584 20:25500939-25500961 GAGGCGCAGGCTGGAGCACAGGG + Exonic
1171492047 20:25526786-25526808 GAGGCCAGAGCAGGTTAACAGGG + Intronic
1171529555 20:25843821-25843843 AAGACCAAGGCAGGATTAGAGGG - Intronic
1171547271 20:26012059-26012081 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1172442532 20:34976346-34976368 GAGGCCAGACCAGGCTCACACGG - Intronic
1172526940 20:35605578-35605600 GAGGCCGAGGGTAGATCACAAGG + Intergenic
1172662898 20:36579542-36579564 GAGGCCAAGGGAAGATGAGAAGG + Intronic
1172804731 20:37603705-37603727 GAGGCCAAGACAGGATTGCCTGG - Intergenic
1172890293 20:38259695-38259717 GAGCCCCAGGCAGATTCACAGGG - Intronic
1174203358 20:48822414-48822436 GAGGCCAAGTCAGTTTCCCAAGG - Intronic
1174661286 20:52215332-52215354 GAGGACAAGGCAGAAGCAGAGGG + Intergenic
1174687293 20:52468157-52468179 AAGACCAAGGCAGGCTTACAGGG - Intergenic
1174980855 20:55392958-55392980 GAGGCCAGGGAGTGATCACAAGG + Intergenic
1175353789 20:58346036-58346058 GAGGCCAAGGGAGGAACCCAGGG - Intronic
1175485214 20:59340905-59340927 GAGGCAAAAGAATGATCACAGGG - Intergenic
1175524861 20:59626635-59626657 GTGGCCAGGGGAGGATCCCAGGG + Intronic
1175575110 20:60055222-60055244 CTGGCCCAGGCAGCATCACACGG - Intergenic
1176366720 21:6037613-6037635 GGGGCCAGGGCAGGAACTCATGG - Intergenic
1176371697 21:6066192-6066214 GAAGTCAAGGCAGGAGCAGAAGG - Intergenic
1176773056 21:13101080-13101102 GAGGCCAAGGCAGGCGATCACGG + Intergenic
1177723219 21:24934394-24934416 GAGGCTGAGGCAGGATCACCAGG + Intergenic
1178071033 21:28967350-28967372 AAGACCAAGGCAGGATTAAAGGG + Intronic
1178305950 21:31490199-31490221 GACCCCAAGTCATGATCACAGGG - Intronic
1179751822 21:43472347-43472369 GAAGTCAAGGCAGGAGCAGAAGG + Intergenic
1179756798 21:43500931-43500953 GGGGCCAGGGCAGGAACTCATGG + Intergenic
1180160319 21:45996228-45996250 GTTCCCAAGGCAGGATCTCAGGG + Intronic
1180437841 22:15330425-15330447 GAGGCCAAGGCAGGCGATCACGG + Intergenic
1180520696 22:16200797-16200819 GAGGCCAAGGCAGGCAATCACGG + Intergenic
1180871164 22:19148158-19148180 GAGGCCAGGGCTGGACCCCAGGG + Intergenic
1182459815 22:30475647-30475669 GAGGCAGAGGCAGGATCGCTTGG + Intergenic
1182519280 22:30876300-30876322 GAGGCCCAGGAAGGATAACTGGG - Intronic
1183185412 22:36288952-36288974 GAGCCCAAGTCAGGAGCAAAGGG + Intronic
1183230686 22:36580161-36580183 GAGGCCCAGGGAGGTTCACCGGG + Intronic
1183539508 22:38421832-38421854 GAGGCTGAGGGCGGATCACAAGG + Intergenic
1183801865 22:40173327-40173349 GAGGCCGAGGGTGGATCACGAGG - Intronic
1184120801 22:42448915-42448937 GAGGCCAAGGTAGGAGGACTGGG - Intergenic
1184267760 22:43358796-43358818 GAGGCTAAGGCAGGAGAACTGGG + Intergenic
1184802805 22:46772863-46772885 GAGGCCAAGGCAGGAGGATCAGG - Intronic
1185197275 22:49479750-49479772 GAGGACATGGCAGGAGCACTGGG + Intronic
1185390813 22:50560852-50560874 GAGGTCAAGGTAGGATGGCAAGG + Intronic
949360819 3:3230431-3230453 TAGGCAAAGACTGGATCACATGG + Intergenic
949487195 3:4551144-4551166 GAGGCCAAGGCAGGGCTTCAGGG + Intronic
949520793 3:4852206-4852228 GTTGCCTAGGCAGGAGCACAGGG - Intronic
949856220 3:8463816-8463838 GAGGTCAAGGGGGGATCACGAGG - Intergenic
949881886 3:8667737-8667759 GTGGCCGAGGCAGAATCAGAGGG - Intronic
950431247 3:12952466-12952488 GAGGCCATGGCAGTCACACAGGG - Intronic
951632552 3:24737478-24737500 TGAGCCAAGGCAGGAACACAGGG + Intergenic
952370986 3:32722578-32722600 GAGGCCAAGGCAGGAGGACCAGG + Intronic
952431457 3:33228049-33228071 GAAGACAATGCAGGATCACCAGG - Intergenic
952820337 3:37480988-37481010 GCGGCCAAGGTTGGACCACAGGG - Intronic
952885003 3:38006753-38006775 GAGCCCAAGGCAGGATCCACTGG + Intronic
953172343 3:40518626-40518648 GAGGCTGAGGCAGGAGCCCAGGG + Exonic
954129930 3:48555445-48555467 TAAGCAGAGGCAGGATCACAGGG + Intronic
954216586 3:49128220-49128242 GAGGCCAAGGCAGGAATTAATGG - Intronic
954395040 3:50289051-50289073 GAGGCCAAGGAGGGGTCAAAGGG - Intronic
954397497 3:50300687-50300709 GCGGCCATGGCCGGAGCACAGGG + Exonic
955370337 3:58346028-58346050 TAGGCCATGCCAGGAACACAGGG - Intronic
955793812 3:62614367-62614389 GAATCCACTGCAGGATCACAGGG + Intronic
956259556 3:67323850-67323872 CAGGCCAAGGCAGTGTCAGAGGG + Intergenic
956485841 3:69721319-69721341 AAGACCAAGGCAGGATTAGAGGG + Intergenic
956501029 3:69885379-69885401 GAGGTGAAGGCAGTATCATAAGG + Intronic
957070820 3:75566641-75566663 GAGTCCATGGCAGCCTCACATGG - Intergenic
957813129 3:85254473-85254495 ATGACCAAGGCAGGATTACAGGG - Intronic
958611465 3:96431985-96432007 AAGACCAAGGCAGGATTAAAGGG + Intergenic
959224676 3:103564504-103564526 AAGGGCAGAGCAGGATCACAAGG - Intergenic
959601392 3:108190293-108190315 GAGGCCGGGGCAGAATTACATGG + Intronic
960518878 3:118632118-118632140 GAGGCTGAGGATGGATCACAAGG + Intergenic
960666771 3:120117013-120117035 AAGGGCAAAGCAAGATCACAAGG - Intergenic
961302065 3:125928492-125928514 CAGGCCAGGCCAGGATCAGATGG + Intergenic
961795248 3:129404212-129404234 GAGGCCAAGGCAGGGAGAAAGGG + Intronic
962940475 3:140120583-140120605 AAGGCCAAGGCAGGATCAGAGGG - Intronic
963816533 3:149837756-149837778 GGGGCCAGGGCAGAATGACATGG - Intronic
966151354 3:176870400-176870422 GAAGCCATGGCAGGAGAACATGG - Intergenic
966907091 3:184534384-184534406 GAGGCCAAGGCGGGATCACAAGG + Intronic
968666855 4:1827204-1827226 GGAGCCAAGGCAGTATCAGAGGG - Intronic
968995578 4:3943353-3943375 CAGGCCAGGCCAGGATCAGATGG - Intergenic
969739533 4:9014115-9014137 GAGTCCATGGCAGCCTCACATGG + Intergenic
969798711 4:9545649-9545671 GAGTCCATGGCAGCCTCACATGG + Intergenic
969818376 4:9702893-9702915 CAGGCCGGGCCAGGATCACATGG + Intergenic
970587815 4:17531211-17531233 AAGACCAAGGCAGGATTAGAGGG + Intergenic
970980128 4:22086422-22086444 AAGGGCAAAGCAAGATCACAAGG + Intergenic
971603834 4:28631454-28631476 AAGGGCAGAGCAGGATCACAAGG + Intergenic
975307667 4:72867497-72867519 GAGGCCAATAAAAGATCACAAGG + Intergenic
975446139 4:74467835-74467857 AAGACCAAGGCAGGATTAGAAGG + Intergenic
975491116 4:74989703-74989725 AAGACCAAGGCAGGATTAGAGGG - Intronic
976086592 4:81413142-81413164 GATCACAAAGCAGGATCACAGGG + Intergenic
976468669 4:85401590-85401612 GAGGCAACAGCAGGATCAAAAGG - Intergenic
976741799 4:88364286-88364308 AAGGACAAAGCAAGATCACAAGG + Intergenic
977685415 4:99841960-99841982 AAGGCCCAGGAAGGAGCACAGGG - Intronic
978412915 4:108444583-108444605 GAGGCCGAGGCAGGATTGCCTGG + Intergenic
979362630 4:119782930-119782952 GAGGCCAGGGCAGAATGATATGG - Intergenic
980577228 4:134699081-134699103 AAGGTCAGGGCAAGATCACAAGG - Intergenic
980579722 4:134733316-134733338 GAGGCCAGGGCAGAATAATATGG + Intergenic
980866187 4:138555866-138555888 GGAGCTAAGGCAGGATCACATGG + Intergenic
980922762 4:139103349-139103371 AAGACCAAGGCAGGATTATAGGG + Intronic
981424529 4:144587902-144587924 AAGGGCAAAGCAAGATCACAAGG + Intergenic
981479366 4:145221771-145221793 GAGGCCACGGGTGGATCACTTGG + Intergenic
982029895 4:151290180-151290202 GAGGCCAAGGCAGGAGGATCAGG - Intronic
982315411 4:154026014-154026036 GAGGCCAAGGCTGGGCAACATGG - Intergenic
983884936 4:172970168-172970190 AAGGGCAAAGCAAGATCACAAGG + Intronic
983933862 4:173482520-173482542 GAGGCAAAGGCAGAAGCACAGGG + Intergenic
985823981 5:2179488-2179510 AAGCCAAAGCCAGGATCACAGGG + Intergenic
985889827 5:2706531-2706553 GAGGGGAAGACAGGAACACAGGG + Intergenic
986022500 5:3818005-3818027 GAGGCCGAGGCAGGATGATCAGG - Intergenic
986707237 5:10462128-10462150 GAGCCCAAGGCAGGATTAGAGGG - Intronic
987927907 5:24365272-24365294 GAGCCCAAGGGCAGATCACAGGG - Intergenic
988004917 5:25397180-25397202 GAGCCAGAGACAGGATCACATGG + Intergenic
988018536 5:25593298-25593320 GAGGCCAAAGTGGGATCACCAGG - Intergenic
988399866 5:30749409-30749431 GATGCCAAGACAGGATTAGATGG + Intergenic
988489989 5:31698139-31698161 GAGGCTGAGGCAGGATCATGAGG - Intronic
988730949 5:33971977-33971999 GAGGCCAAGGCAGGTGGACCTGG - Intronic
989259230 5:39400467-39400489 GAGGCCGAGGCAGGACCTGAGGG - Intronic
991250804 5:64559040-64559062 AAGGTCAGGGCAAGATCACAAGG - Intronic
994515289 5:100764156-100764178 GAGGCTAAGGCATATTCACATGG - Intergenic
995523895 5:113035512-113035534 GAGGTCCAGGCAAGACCACAGGG - Intronic
995851849 5:116554647-116554669 TAGGCCAAGGAAGGATCATTTGG - Intronic
995985894 5:118173154-118173176 GAGGCCAAGGCAGGATCACGAGG - Intergenic
996098433 5:119423090-119423112 GAGGCCGAGGTGGGATCACGAGG - Intergenic
996507931 5:124288622-124288644 AAGGCCAAGGTAGTATCAAAAGG - Intergenic
997128739 5:131255525-131255547 GAGGCCCAGGCCAGATCACGAGG + Intronic
998641896 5:144020861-144020883 GAGGCCATGGCAGAAGAACATGG + Intergenic
999097203 5:148990469-148990491 GAAGCCAAGTCAGGAGCAAAAGG + Intronic
999631378 5:153575114-153575136 GAGACCATTGCAGGATCAAATGG - Intronic
1000306914 5:160003065-160003087 GAGGCAGAGGCCCGATCACATGG + Intergenic
1000350913 5:160352144-160352166 GAGGCCAAGGCAAGAGTACTGGG - Intronic
1001403536 5:171460612-171460634 GATGCCAAGGCAGAATCAGGGGG - Intergenic
1001417449 5:171555934-171555956 GATGCCAAGGCACAATCAGAAGG + Intergenic
1002017606 5:176337657-176337679 CAGGCCAAGGGAGGATGCCAGGG - Intronic
1002993989 6:2265445-2265467 GAGACCAAGGCATGATCAGAGGG - Intergenic
1003485952 6:6579812-6579834 TAGGCAGAGGCAGGGTCACAGGG + Intergenic
1003719240 6:8682011-8682033 GGGGCCAAAGCAGGCACACATGG - Intergenic
1004331233 6:14723422-14723444 GAGGCCAAGGCAGGAGATCAAGG + Intergenic
1004453647 6:15770837-15770859 CAGGCAAAGGCAGGAGCACAGGG + Intergenic
1004680806 6:17892583-17892605 AAGACCAAGGCAGGATTAGAGGG + Intronic
1004931712 6:20468673-20468695 AAAACCAAGGCAGGATCAGAGGG - Intronic
1005820094 6:29591172-29591194 GAGGCTAAGGCAGGAGAACCTGG + Intronic
1006010035 6:31034976-31034998 GAGGCCACGGCAGGACAAGATGG + Exonic
1006034555 6:31201377-31201399 GTGGCCAAGTCAGAACCACAAGG + Intronic
1006182186 6:32160759-32160781 GAGGCCGAGGCATGAGCCCAGGG + Intronic
1006251773 6:32793206-32793228 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1006619345 6:35352106-35352128 GAGGCCAAGGCAGGAATGAATGG - Intronic
1008760084 6:54843656-54843678 GAGGCCGTGGCAGGATCACGAGG - Intergenic
1009039093 6:58156121-58156143 AAGGTCAGGGCAAGATCACAAGG - Intergenic
1009447270 6:63757473-63757495 AAGGGCAAAGCAAGATCACAAGG - Intronic
1010214977 6:73393601-73393623 GAGGCCAAGGCAGGAGGAGTTGG + Intronic
1011410865 6:87064804-87064826 AAGGCCAAGGCAGGCCAACATGG + Intergenic
1013915967 6:115337045-115337067 GGGGCCAGGGCAGGATAATATGG + Intergenic
1014097753 6:117479035-117479057 GAGGCAGAAGCAGGATCTCAGGG - Intronic
1014107655 6:117584913-117584935 AAGGCGAAGGCAGGAGCAGATGG - Intronic
1014183876 6:118413279-118413301 GAGGCCAAGGCAGGTGGCCAAGG + Intergenic
1014669050 6:124277041-124277063 GAATCCAAGGCAAAATCACAGGG + Intronic
1015160037 6:130142751-130142773 CAGGCCATGACAGGATGACAAGG - Intergenic
1016016807 6:139194669-139194691 GAGGCCAAGACAGAAGCAGATGG - Intergenic
1017005961 6:150028243-150028265 GAGGCCATGGCATGATCGCAGGG - Intergenic
1017854610 6:158339331-158339353 AAGGTCAGGGCGGGATCACAAGG + Intronic
1017983337 6:159421753-159421775 CAGGCCACAGCAGGAACACAGGG - Intergenic
1018059825 6:160081445-160081467 AAGGTCAGGGCAGGATCACAAGG + Intronic
1018383825 6:163285059-163285081 GAGGCCAAGGAAGGCTCAAGTGG - Intronic
1019151874 6:170011696-170011718 CAGGCCAAAGCAGGATGAAAAGG + Intergenic
1019432363 7:1005055-1005077 GAGGCCGAGGGCGGATCACAAGG + Intronic
1019737246 7:2656659-2656681 GAGGCCTAGGGAGGGTCACGAGG - Intronic
1020088710 7:5325181-5325203 GAGGGCAAGGCAGGAGCTCGGGG + Exonic
1020334456 7:7052027-7052049 AAGACAAAGGCATGATCACAGGG + Intergenic
1021141458 7:17030637-17030659 GGGGCCAAGGAAGGAGAACAAGG - Intergenic
1021942805 7:25696130-25696152 GAGGCCAAGACAGGAAGATAAGG + Intergenic
1022447015 7:30478871-30478893 GCGGTCAAGGCAGGGTCCCACGG + Intergenic
1022623981 7:32015080-32015102 GAGGGCAAGGCAGGAAGGCAGGG - Intronic
1023106458 7:36767776-36767798 GAGGCCATGGCAGGATTCCTTGG + Intergenic
1023668878 7:42555317-42555339 AAGGTCACGGCAAGATCACAAGG - Intergenic
1023670827 7:42574842-42574864 AAGACCAAGTCAGGAACACAGGG + Intergenic
1024367920 7:48544392-48544414 AAGACCAAGGCAGGATTACAGGG + Intronic
1024552046 7:50570632-50570654 AAGGTCAAGGCGAGATCACAAGG - Intergenic
1024949503 7:54844712-54844734 GAGACGAAGTCAGAATCACAGGG - Intergenic
1025246955 7:57324755-57324777 AAGGTCAGGGCAAGATCACAAGG - Intergenic
1025918580 7:65888562-65888584 GAGGCCAAGGCAGGTGTCCAAGG - Intronic
1026154620 7:67816332-67816354 GAAGCCAGGGCAGAATAACATGG - Intergenic
1026282631 7:68935300-68935322 GAGGCTGAGGCAAGATCACTTGG - Intergenic
1026440578 7:70440141-70440163 GAGGCCAAGGCAGGACAAAGTGG + Intronic
1027182507 7:75950823-75950845 GAGGCCGAGGCAGGATCACGAGG + Intronic
1027642010 7:80747507-80747529 TAGGCCAGGGCAGGAACACAAGG - Intronic
1027672811 7:81123119-81123141 GAGGCCGAGGCAGGATCACGAGG - Intergenic
1028052918 7:86207638-86207660 GAGGCCAAGGCGGGCTCATGAGG - Intergenic
1029073100 7:97915943-97915965 GAGTCCATGGCAGCCTCACATGG - Intergenic
1029263050 7:99316458-99316480 GAGGCTGAGGCAGGGTCACTTGG + Intergenic
1030026587 7:105330103-105330125 GAGGCCACGGGAGGATCACAAGG + Intronic
1030077218 7:105747179-105747201 AAGACCAAGGCAGGATTAGAGGG + Intronic
1031597085 7:123660633-123660655 GAGGACAGGGCAGGGTCCCAGGG + Intronic
1031665520 7:124478392-124478414 GAGGCCAAGGCAGGAGGATCAGG - Intergenic
1031799573 7:126224786-126224808 GAGGCCGAGGCAGGATCATGAGG - Intergenic
1031929572 7:127670747-127670769 GAGGCCAAGGCAAGATCTCTCGG - Intronic
1032138831 7:129307903-129307925 GAGCACCAGGCAGGATCATAAGG - Intronic
1032491896 7:132330053-132330075 GAGGCAAGGGGAGGAGCACAGGG + Intronic
1033002433 7:137521623-137521645 GATGCCAAGTCAGGATCTCTTGG - Intronic
1034659748 7:152759114-152759136 GAGGCTGAGGGTGGATCACAAGG - Intergenic
1035185510 7:157123038-157123060 GAGGCCAAGGCAGGGTCAGCAGG - Intergenic
1036244582 8:7105336-7105358 GAGTCCATGGCAGCCTCACATGG + Intergenic
1036645099 8:10607799-10607821 GAGGCCCAGCCAGAATCAGAAGG - Exonic
1036897246 8:12646093-12646115 GAGTCCATGGCAGCCTCACATGG - Intergenic
1037585972 8:20276302-20276324 AAGACCAAGGCAGGATTAGATGG + Intronic
1037681159 8:21098700-21098722 GAGGCCAAGGCAGGAGGATTGGG + Intergenic
1038739979 8:30208551-30208573 GAGGAGAAGGCAGTGTCACATGG - Intergenic
1038793505 8:30689667-30689689 TAGGCCACGGCAGCATCACTAGG + Intronic
1039116447 8:34096362-34096384 AAGGGCTAGGCATGATCACAAGG + Intergenic
1039334436 8:36574260-36574282 GAGGCCACAGCAGTAACACAGGG + Intergenic
1039780206 8:40777616-40777638 GAGGGCATGGCTGGATCACCTGG + Intronic
1039890085 8:41680041-41680063 CTGGCCAAGACAGGATAACAGGG - Intronic
1039932806 8:42010059-42010081 GAGGCCAAGGCAGAGGCAGATGG + Intronic
1040016247 8:42702528-42702550 GAGGCCAAGGTGGGATCACCAGG + Intronic
1040946159 8:52886671-52886693 GAGACCAAGGCAGGATTGGAGGG + Intergenic
1041218864 8:55629240-55629262 GAGGCCAAGGGTGGATCATGAGG + Intergenic
1041334072 8:56760093-56760115 GAGTTCATGGCAGGAACACAGGG - Intergenic
1042870581 8:73394837-73394859 GAGGCTGAGGCAGGATCACGAGG + Intergenic
1043173018 8:76988953-76988975 GAGGCCAAGGGAGGATTTCTGGG + Intronic
1043205053 8:77427062-77427084 GGGGCCAAGGCAGAATTACATGG + Intergenic
1044170374 8:89043777-89043799 AAGGTCAAGGCAAGATCACAAGG - Intergenic
1044341113 8:91047330-91047352 GAGGAAAAGGCAAGACCACATGG + Intergenic
1044743226 8:95348573-95348595 GAGGCCGAGACCGGATCACGAGG + Intergenic
1045001687 8:97883888-97883910 GAGGCGAAGGCAGGGCAACATGG - Intronic
1045030201 8:98127836-98127858 GAGGCAGAGCCAGGACCACAAGG - Intronic
1045036652 8:98181327-98181349 GAGGCCAAGGCAGGTGCAGGTGG + Intergenic
1045255743 8:100519393-100519415 GAGGGCAGGGCAAGAGCACAAGG + Intronic
1045275289 8:100698775-100698797 GAGGCCAAGGCAGGAGAATCGGG + Intronic
1045331759 8:101161532-101161554 GAGACCAAGGCAGGATTACAGGG + Intergenic
1045771156 8:105742094-105742116 GAGGCCAAGGCAGGATTGGATGG + Intronic
1046082888 8:109393937-109393959 GAGGCCGAGGATGGATCACGAGG + Intronic
1046164587 8:110415319-110415341 GAGGCTGAGGCAGGAGAACAGGG - Intergenic
1047470498 8:125166924-125166946 GAGGCCAAGGCAGGAGTATAAGG + Intronic
1048227567 8:132603523-132603545 GAGGACAAGGGATGATCACCAGG + Intronic
1048878441 8:138854699-138854721 GAGGCCAAGGCTGGGGCAGAAGG - Intronic
1049429696 8:142555008-142555030 AAGACCAAGGCAGCATCAGAGGG + Intergenic
1049872670 8:144993245-144993267 AAGGCCAAGGCACGATTACAGGG + Intergenic
1050175758 9:2868007-2868029 GAGGCAGAGGGTGGATCACACGG - Intergenic
1050264324 9:3874140-3874162 GAGACCAAGGCAGGATTAGAGGG + Intronic
1052055210 9:23898257-23898279 GAGGCTGAGGCAGGAGAACAGGG + Intergenic
1052278774 9:26708655-26708677 GAGACCAAGTCATGACCACATGG + Intergenic
1052798846 9:32948859-32948881 AAGGCCAAGGCATGATTAGAGGG - Intergenic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1053411230 9:37917366-37917388 GAGGCCAAGTCAGGGCCAGAGGG + Intronic
1053702319 9:40707143-40707165 GAGGCCAAGGCAGGCGATCACGG - Intergenic
1053797531 9:41740119-41740141 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1054185943 9:61952171-61952193 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1054412379 9:64830600-64830622 GAGGCCAAGGCAGGCGATCACGG - Intergenic
1054467405 9:65505871-65505893 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1054652563 9:67636348-67636370 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1055159056 9:73102420-73102442 GAGGCTCAGGCAGTATGACAGGG + Intergenic
1055433759 9:76271461-76271483 AAGATCAAGGCAGGAACACATGG + Intronic
1055722932 9:79196053-79196075 GAGGCCAAGGCAGCCTCCAATGG + Intergenic
1055792048 9:79933023-79933045 GAGGCCCAGGCAGGCTCAGATGG - Intergenic
1056495831 9:87154414-87154436 GAGGCCAAAGCAGGACAGCAGGG + Intronic
1057245231 9:93449897-93449919 TAACCCAAGGCAGGTTCACAAGG - Intronic
1057274810 9:93670579-93670601 GAGGCCAGGGCTGCATCCCATGG + Intronic
1057345855 9:94249801-94249823 GTGGCCAAGGCTGGAGCGCAGGG - Intergenic
1057348747 9:94276624-94276646 GAGGCCAAGGATGGATGACGAGG - Intronic
1057542587 9:95989299-95989321 AAGACCAAGGCAGGGTCAGAGGG - Intronic
1057550125 9:96046327-96046349 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1057563888 9:96151293-96151315 GAGGCCCAGGGTGGATCACTAGG + Intergenic
1057711507 9:97449753-97449775 AAGTCCAAGGCAGGATTAGAGGG - Intronic
1059435766 9:114275413-114275435 CAGGCCCAGGCAGGGACACATGG + Intronic
1059901509 9:118932374-118932396 GAGGCCAAGGCAGGTATTCATGG - Intergenic
1060136086 9:121155558-121155580 GAAGCTGAGGCAGGATCACAAGG - Intronic
1060213766 9:121726105-121726127 AAGACCAAGGCAGGATTAGAGGG + Intronic
1060926705 9:127460431-127460453 GAGGCCTTGGGTGGATCACACGG + Intronic
1061265536 9:129502819-129502841 GAGGCCTTGGGTGGATCACAAGG - Intergenic
1061380989 9:130257530-130257552 GAGCCCAGTGCAGTATCACAGGG + Intergenic
1062024921 9:134335867-134335889 GGGACCAAGGCAGGACCACAGGG - Intronic
1062214580 9:135382317-135382339 GAGGCCCAGGCAGAAGCACCGGG + Intergenic
1185516321 X:701719-701741 TAGGGCTGGGCAGGATCACAGGG - Intergenic
1185522863 X:754790-754812 GAGGCTGAGGCAGGAGCCCAGGG - Intergenic
1185550530 X:980215-980237 GAGGCCAAGCCAGGCTCCCTGGG + Intergenic
1186098293 X:6127374-6127396 GAGGCCGAGGGTGGATCACAAGG + Intronic
1187786031 X:22887543-22887565 AAGGCCAAAGCATGATCAGAAGG - Intergenic
1188446202 X:30255684-30255706 AAGGTCAGGGCAAGATCACAAGG + Intergenic
1188612349 X:32116068-32116090 TAGGCAAGGGCAAGATCACACGG - Intronic
1188635801 X:32429450-32429472 GAGGCCAAGGCAGGCAGACCAGG - Intronic
1189066771 X:37818534-37818556 GAGGCCGAGGTGGGATCACGAGG + Intronic
1189299847 X:39944539-39944561 GAGGCCAAGATAGGAACACAAGG + Intergenic
1189516485 X:41717980-41718002 AAGACCAAGGCAGGATGACAAGG + Intronic
1189948432 X:46203914-46203936 AAGACCAAGGCAGGATTAGAGGG + Intergenic
1190885175 X:54525264-54525286 GAGGCTGAGGCAGGAACCCAGGG + Intergenic
1190972548 X:55365575-55365597 GAGGCCAAGGCAGGAGGCCAGGG - Intergenic
1191169954 X:57434176-57434198 GAGGCTGAGGCAGGAAAACAAGG - Intronic
1192675566 X:73192354-73192376 AAGGGCAAAGCAAGATCACAAGG + Intergenic
1193262441 X:79424679-79424701 GAGGGCAGAGCAAGATCACAAGG - Intergenic
1193341725 X:80355971-80355993 GAGGCCAAGGCAGAGCCACCTGG + Intronic
1193753948 X:85383181-85383203 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1194644775 X:96446355-96446377 AATTCCAAGGCAGGCTCACAAGG - Intergenic
1195382967 X:104288479-104288501 AAGGCCAAGGCAGGATTAGAGGG + Intergenic
1196019811 X:110979529-110979551 GAGGCCAAGGCCAGATCACGAGG - Intronic
1196597799 X:117565250-117565272 AAGGGCAAAGCAAGATCACAAGG + Intergenic
1197160454 X:123317275-123317297 GAGGCCAGGGCAGAATGATATGG - Intronic
1197265069 X:124360517-124360539 GAGGCTAAGGCAGGAGGGCAAGG + Intronic
1198736546 X:139792054-139792076 AAGACCAAGGCATGATTACAGGG + Intronic
1200149309 X:153943490-153943512 GTGGCCATGGCAGGGTCGCAGGG + Intronic
1200875176 Y:8147013-8147035 GAGGCCAAGGCAGGCAGATACGG - Intergenic
1201071014 Y:10147352-10147374 GAGGCCTGGGCAGAATGACAGGG + Intergenic
1201467155 Y:14295200-14295222 GAGGCCAAGGCAAGAGGTCAAGG - Intergenic
1201612438 Y:15858241-15858263 AAGACCAAGGCAGGATTAGAGGG - Intergenic
1201792649 Y:17859166-17859188 GAGGGCAATGAAAGATCACAAGG - Intergenic
1201808905 Y:18046820-18046842 GAGGGCAATGAAAGATCACAAGG + Intergenic
1202354184 Y:24028414-24028436 GAGGGCAATGAAAGATCACAAGG - Intergenic
1202516595 Y:25641698-25641720 GAGGGCAATGAAAGATCACAAGG + Intergenic