ID: 1115368768

View in Genome Browser
Species Human (GRCh38)
Location 14:32588424-32588446
Sequence AGGCAGACACAAATGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115368768_1115368773 25 Left 1115368768 14:32588424-32588446 CCTTGTCCCATTTGTGTCTGCCT 0: 1
1: 0
2: 2
3: 27
4: 338
Right 1115368773 14:32588472-32588494 TAATCAATCTGTCCACTTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 133
1115368768_1115368772 24 Left 1115368768 14:32588424-32588446 CCTTGTCCCATTTGTGTCTGCCT 0: 1
1: 0
2: 2
3: 27
4: 338
Right 1115368772 14:32588471-32588493 GTAATCAATCTGTCCACTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115368768 Original CRISPR AGGCAGACACAAATGGGACA AGG (reversed) Intronic
900003779 1:30553-30575 AGGCGGACAAAACTGGGAGAGGG - Intergenic
900023499 1:201067-201089 AGGCGGACAAAACTGGGAGAGGG - Intergenic
900778812 1:4603918-4603940 AGGCAGGCATAAACTGGACACGG + Intergenic
900912714 1:5613109-5613131 AGGCAGACACCTATGAGCCAAGG + Intergenic
902696033 1:18141511-18141533 AGGCTGACACACAGAGGACAGGG + Intronic
903415348 1:23178515-23178537 ACCCAGAAACAAATGAGACAAGG - Intergenic
905006472 1:34714034-34714056 AGGGAGACACAACTGGTACCAGG + Intronic
905234108 1:36533930-36533952 TGGCAGTCCCAACTGGGACATGG + Intergenic
905411470 1:37772419-37772441 AGAAAGAGACATATGGGACATGG + Intergenic
905460333 1:38118659-38118681 AGGGAGAGAAAAAAGGGACAAGG - Intergenic
905856243 1:41316674-41316696 AGGGAGTCACTGATGGGACAGGG - Intergenic
905909467 1:41643858-41643880 AGGCAGACACAATTTGGGGAGGG - Intronic
906447738 1:45917929-45917951 AGACAGAAAGAAATGGGAGAAGG - Intronic
906509811 1:46404631-46404653 AGGCAGACAGAAACCAGACAGGG - Intronic
906875176 1:49529778-49529800 AGGCAGTTACAAATGGGGTATGG + Intronic
907030595 1:51167286-51167308 AGGCATAAACAAATTGCACAAGG - Intergenic
907856176 1:58306044-58306066 GGGCAGACACACATTGGTCAGGG + Intronic
907907702 1:58799494-58799516 ATGGAGACACTACTGGGACAGGG + Intergenic
911175413 1:94812709-94812731 AGGCAGAAACAAAAGAAACAAGG + Intergenic
914887123 1:151594610-151594632 AGGCAGACTAAACTAGGACACGG - Intergenic
914961626 1:152214269-152214291 AGCCAGACTCATATGGGCCACGG + Exonic
914961874 1:152215679-152215701 AGCCAGACTCATATGGGCCACGG + Exonic
914962120 1:152217089-152217111 AGCCAGACTCATATGGGCCACGG + Exonic
914962371 1:152218499-152218521 AGCCAGACTCATATGGGCCACGG + Exonic
914962614 1:152219897-152219919 AGCCAGACTCATATGGGCCACGG + Exonic
915283735 1:154839809-154839831 AGACAAACACAGACGGGACAAGG + Intronic
916248696 1:162714321-162714343 AGGCCTGCACAAATGAGACATGG - Intronic
916264367 1:162876064-162876086 AGGCTGAGACAAATGGGTTAGGG - Intergenic
916769522 1:167894560-167894582 AGGGAGACAGAAATGGCAAAGGG + Intronic
918000949 1:180495039-180495061 AGGGAGATAAAACTGGGACAAGG + Intronic
918296467 1:183161655-183161677 AGGTAGACCAAAGTGGGACAAGG + Intergenic
918465832 1:184820573-184820595 GTGCATACACGAATGGGACATGG - Intronic
918472061 1:184884981-184885003 AGGCAGACCGCAGTGGGACAGGG - Intronic
919315609 1:195967865-195967887 AGGCAGGCTCTAATGGGTCAGGG - Intergenic
919658249 1:200218131-200218153 AGGCAGACACAAAAGGGAATTGG + Intergenic
923048260 1:230371275-230371297 AGGAACACAGCAATGGGACAAGG + Intronic
923255871 1:232220942-232220964 AGGCACACACAGCTGGGCCATGG + Intergenic
924254221 1:242166179-242166201 AGGCAGGCATAAACTGGACATGG + Intronic
924814853 1:247432613-247432635 AGGCAGACACAAACAGGGAAGGG + Intronic
1063685658 10:8235326-8235348 AGGCAGACAGAAACGGAAAAAGG + Intergenic
1064009656 10:11725517-11725539 TGGCAGACACAAAAGTGACTGGG + Intergenic
1064817535 10:19283577-19283599 AGGAAGACAGAAAGGGGAAAGGG - Intronic
1067202354 10:44184507-44184529 AGGGAGACACATAAGGTACATGG - Intergenic
1067287075 10:44914520-44914542 AAGCAGACACAGCTGGGAAATGG + Intronic
1067467750 10:46513642-46513664 ATGCAGACACATATGGAACCAGG + Intergenic
1067619436 10:47870963-47870985 ATGCAGACACATATGGAACCAGG - Intergenic
1069546095 10:69329982-69330004 ATGCAGACAAGAATGGGAGAGGG - Intronic
1069685628 10:70316617-70316639 AGGTGGACACAAGTGGGGCAGGG + Intronic
1070598583 10:77849715-77849737 AGGCAGACAGGAAAGGGAGAGGG + Intronic
1071379766 10:85046647-85046669 AGGGAGACAGATATGGGAGAAGG + Intergenic
1073112793 10:101072493-101072515 AGGCAGAGAGAGATGGGAAAAGG + Intergenic
1073559971 10:104488191-104488213 GGGGAGAGACAAACGGGACAGGG + Intergenic
1073998772 10:109346097-109346119 AGGGAGAGAAAAATGGAACAAGG + Intergenic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1075973140 10:126672313-126672335 AGATAGACACAAATGGGAGCTGG - Intergenic
1076111781 10:127865289-127865311 TGGCAGAGACACATAGGACAAGG - Intergenic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1078016759 11:7621574-7621596 AGGAAGAAACAAAGGGGACAGGG - Intronic
1078146985 11:8728813-8728835 ATGCAGAGGCAAATAGGACATGG - Intronic
1079578755 11:22035611-22035633 AGGAAGAGACAAAGGGGTCAAGG - Intergenic
1080382537 11:31788454-31788476 AGGGAGACAGAAAAGGGAGAGGG + Exonic
1081717791 11:45263135-45263157 AGGCAGAGACAGATGGCACGGGG + Intronic
1082030406 11:47599459-47599481 AGGAAGAGACAGATGGGAGAGGG + Intergenic
1082200365 11:49359012-49359034 AGGCAGACACACAAGGGAAAGGG - Intergenic
1082212082 11:49517514-49517536 TGGTAGAAATAAATGGGACAAGG + Intergenic
1083529350 11:63404776-63404798 AGGCAGACATAAACTGTACATGG - Intronic
1084313236 11:68328797-68328819 AGGCAGACAGAAAAGGAAAAGGG - Intronic
1084453537 11:69254201-69254223 AGGAAGACAGAAACGGGAAATGG - Intergenic
1086655308 11:89347195-89347217 ATGCAGACACACAAGGGAAAGGG + Intronic
1087750554 11:102002509-102002531 AGGCAGGCATAAACTGGACATGG + Intergenic
1088166399 11:106943592-106943614 ACGCAGACATAAATAGGGCAAGG - Intronic
1089773458 11:120819620-120819642 CGCCAGACACCAATGGGAGAAGG - Intronic
1090030577 11:123202737-123202759 TGGCAGAAACAGGTGGGACAGGG + Intergenic
1090041017 11:123291489-123291511 AGCCAGAAACATATGGGAAAAGG + Intergenic
1091377198 12:32605-32627 AGGCGGACAAAACTGGGAGAGGG - Intergenic
1091752740 12:3032826-3032848 AGGAAGACACATATGTGACGGGG + Intronic
1092198908 12:6567926-6567948 TGGCAGGCAGAAATGGGAGAAGG + Intronic
1095544843 12:43354089-43354111 AGGCAGAGACATATTGGACATGG + Exonic
1096543307 12:52320780-52320802 AGAAAGACAAAAATGGGACCGGG - Intronic
1096907597 12:54949203-54949225 AGGCAGAGACAAAAGGGCTAGGG - Intronic
1097378328 12:58864161-58864183 AGGCAGGCTCAAACTGGACACGG + Intergenic
1100223284 12:92530315-92530337 AGGTTGGCACAAATGGGAGATGG - Intergenic
1101070797 12:101073634-101073656 TCACAGACACAAAAGGGACAGGG - Intronic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1104860335 12:131920146-131920168 AGACAGACACCAGTGGGGCAGGG + Intronic
1106591794 13:31104647-31104669 ATGCAGATGGAAATGGGACAAGG - Intergenic
1107711173 13:43151888-43151910 AGACAGACAAAAATGAGAGACGG + Intergenic
1107944986 13:45410191-45410213 AGGAAGTCACAAATGGGAACTGG + Intronic
1109863376 13:68229041-68229063 AGGCAGACAGTAATGGAGCAGGG + Intergenic
1110401921 13:75101999-75102021 AGGCAGAGAAAAGTGAGACATGG - Intergenic
1110905849 13:80888304-80888326 GGGCAGACACAAAAGGGGCGTGG - Intergenic
1111895257 13:94134135-94134157 AGGCAGTGACAAATTGGAAATGG + Intronic
1112072823 13:95873825-95873847 AGGCAAACATAAACTGGACATGG + Intronic
1113765324 13:112877476-112877498 TGGCAGACACACATGTAACAAGG + Intronic
1114675580 14:24437954-24437976 AGGCAGACACACCTGAGACTTGG - Exonic
1114835398 14:26197640-26197662 AGACAGACTCAAATAGAACATGG - Intergenic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1118554815 14:67006283-67006305 AGGCAGACAGAAATAGGACAAGG - Intronic
1118718101 14:68574618-68574640 AGGCCCACTCTAATGGGACAGGG + Intronic
1120249437 14:82044458-82044480 AGGCAGTGAAAAAGGGGACAGGG + Intergenic
1120530576 14:85626126-85626148 AGGCTGTAACAAATGGGAGACGG - Exonic
1122655207 14:103254124-103254146 AGCCAGACACAAAGAGTACATGG - Intergenic
1122867137 14:104611552-104611574 AGGCAGACACACATGGGATTTGG - Intergenic
1123112022 14:105876525-105876547 TGGAAGACACAAATAGGACATGG - Intergenic
1123803560 15:23848297-23848319 AGGGAGAAAGAAATGAGACAAGG - Intergenic
1124018161 15:25895948-25895970 AGTCAGACTCACATGGGACCGGG + Intergenic
1124140564 15:27073381-27073403 AAGCAGAAGCAAATGGCACATGG - Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1125645554 15:41269475-41269497 AGACAAACAGAAATGAGACAAGG - Intronic
1126676783 15:51166170-51166192 AGGCAAACACAAAATTGACAAGG + Intergenic
1126735311 15:51726899-51726921 AGACAGAAACAGATGGGACCAGG + Intronic
1127294247 15:57595908-57595930 AGTCAGGCAGCAATGGGACATGG - Intronic
1128798047 15:70479200-70479222 AGGCAGGAACAAAAGAGACACGG + Intergenic
1129001620 15:72340027-72340049 AGGCAGACACAGATGGGAAGGGG - Intronic
1129182448 15:73885709-73885731 GGGCAGAGCCAACTGGGACAAGG - Intronic
1129600867 15:76997230-76997252 AGCCAGACACAGAGGAGACAAGG - Intronic
1129920524 15:79315751-79315773 AGGCAGGCACAGATGGTTCAAGG - Intronic
1131244966 15:90783240-90783262 AGGCAGACAGGCTTGGGACAAGG - Intronic
1131342943 15:91619778-91619800 AGACAGAAACAAATGGAACCAGG - Intergenic
1131958822 15:97766674-97766696 AGTCAGAAACAACTGTGACAGGG - Intergenic
1132449723 15:101960387-101960409 AGGCGGACAAAACTGGGAGAGGG + Intergenic
1132959751 16:2615212-2615234 AGGAACCCACATATGGGACATGG - Intergenic
1133062758 16:3185474-3185496 AGGCATACACAAAGGGAAGATGG + Intergenic
1133401860 16:5493888-5493910 AGACAGCTACAAATGAGACAGGG - Intergenic
1133720221 16:8487831-8487853 AGGCAGACACAAAAGGAAGGGGG + Intergenic
1133880676 16:9778800-9778822 AGGCAGACATAAACTGGACATGG - Intronic
1134507981 16:14823508-14823530 AGGGACACACAAATGGGAAGTGG + Intronic
1134695683 16:16222271-16222293 AGGGACACACAAATGGGAAGTGG + Intronic
1134818601 16:17227284-17227306 AGGCAGACACACTTGGGGAAGGG + Intronic
1134976145 16:18572415-18572437 AGGGACACACAAATGGGAAGTGG - Intergenic
1138109418 16:54311793-54311815 TGGCAGAGAGAAATGGGATAAGG - Intergenic
1138199354 16:55077604-55077626 AGGCCAACCAAAATGGGACAAGG + Intergenic
1138413672 16:56858953-56858975 AGGCAGAAAGAAATGGGGCCAGG - Intergenic
1138874379 16:60931346-60931368 ACTCAGACAGAGATGGGACATGG + Intergenic
1140721860 16:77779393-77779415 AGGCAGACACATAGAGAACATGG - Intergenic
1140881695 16:79204323-79204345 GGGCAGGCACAAATGGAAGATGG + Intronic
1141656958 16:85421673-85421695 AGGCAGGAACAAATGGTACCTGG - Intergenic
1143088043 17:4431471-4431493 AGGGGGACAAAAATGGGCCAAGG - Intergenic
1143432587 17:6898174-6898196 TGGAAGAAAGAAATGGGACATGG - Intronic
1143510736 17:7393942-7393964 AGGCAGAGAAAGATGGGGCAGGG + Intronic
1144090590 17:11852490-11852512 AGGCAGGCATAAACTGGACATGG - Intronic
1144142463 17:12362996-12363018 AGGCAGGCATAAACTGGACATGG - Intergenic
1144946116 17:18970353-18970375 ACACAGACACAGATGGGCCAGGG + Exonic
1145306440 17:21677890-21677912 AGGAAGCCAGAAATGGGAGATGG - Intergenic
1146977144 17:37123255-37123277 TGGAAAAGACAAATGGGACAAGG + Intronic
1147572319 17:41579076-41579098 AGGCTGCCACAAAGGGGACCAGG - Intergenic
1147952130 17:44113125-44113147 AGGCAGAGAGAGCTGGGACAGGG - Intronic
1148193402 17:45696069-45696091 AGGAAGACACAAATGTGTGATGG - Intergenic
1150514849 17:65797377-65797399 AGGCAGTAACAAATGAGCCAGGG - Intronic
1150614246 17:66756599-66756621 ATGCAGACTCAAATGTGGCAAGG + Intronic
1151498846 17:74475931-74475953 ATGCAGAGACACATAGGACAAGG + Intronic
1152043424 17:77920007-77920029 AAACAGACACAGATGTGACATGG + Intergenic
1152575590 17:81139421-81139443 AGGAAGACACAAGTTGCACACGG + Intronic
1153757203 18:8296237-8296259 ATGCCGACAGAAATGAGACAAGG - Intronic
1154031271 18:10756185-10756207 AGGCAGAGGCAAAGGGGATAAGG + Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1156655218 18:39276895-39276917 AAGCAACCACAAATGGCACATGG + Intergenic
1157161225 18:45316086-45316108 AGGGAGGCACAAATGGCATAGGG - Intronic
1157224194 18:45848150-45848172 ACCCAGACACAAATGGAAGATGG + Exonic
1157692471 18:49694802-49694824 GGCCAGAGACACATGGGACATGG + Intergenic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1158884638 18:61815688-61815710 AGACAGACACAAAGGGCAGAAGG - Exonic
1160635532 19:72160-72182 AGGCGGACAAAACTGGGAGAGGG - Intergenic
1161292660 19:3503539-3503561 AGACAGACACACAGGGGTCAAGG - Intergenic
1161980290 19:7626699-7626721 AGGCTGACCCAAAGGGGCCAAGG - Intronic
1163320621 19:16572457-16572479 AGGCAGCGACCAATGGGAAACGG - Intronic
1164633235 19:29775187-29775209 AACAAGACACAAATGGAACAAGG + Intergenic
1166090431 19:40504972-40504994 AGGCAGACACAAAGGTGACATGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168352144 19:55682286-55682308 TGGCAGACAGAAATCAGACACGG - Intronic
926058381 2:9789935-9789957 AAGCAGACACAAATGAGGGAGGG - Intergenic
927099165 2:19774718-19774740 AGACAGAGTAAAATGGGACAAGG - Intergenic
927497578 2:23561161-23561183 AGGCAGAGACAGAGGGGAGAGGG - Intronic
927827781 2:26321378-26321400 AGGCAGTCTCAGATGGGCCAAGG + Intronic
929118697 2:38466042-38466064 AGGCCCAAACTAATGGGACAAGG + Intergenic
929275834 2:40023641-40023663 AGGCAGGCATAAACTGGACATGG + Intergenic
931332266 2:61299950-61299972 AGGAAGACAGAAATGGCACTGGG - Intronic
933251870 2:80038273-80038295 AGGAAGATAGAAATGGGAGATGG + Intronic
935675245 2:105589584-105589606 AGGGAGACACATAGGAGACAGGG - Intergenic
936565950 2:113582887-113582909 AGGCGGACAAAACTGGGAGAGGG + Intergenic
936794470 2:116188885-116188907 GATCAGACACAAATGGAACATGG + Intergenic
938553006 2:132398017-132398039 AAGCAGACACAGATGAGACATGG - Intergenic
939697632 2:145346236-145346258 AGGTAAATACAAATGGGAAATGG + Intergenic
942395914 2:175549321-175549343 AGAGAGAGACAAATGGGACCTGG - Intergenic
942821357 2:180119600-180119622 AGGAAGAGACAAATAGGAAAAGG - Intergenic
943095833 2:183428271-183428293 AGGCAGATGCAAACTGGACATGG + Intergenic
943334728 2:186599968-186599990 AGGGAGAAAAAAATGGAACAAGG - Intronic
944873080 2:203933675-203933697 AGACAGACCAAAATGGGACAAGG + Intergenic
945097159 2:206230811-206230833 AGTAAGACACAAAGGGGACCAGG + Intergenic
945417279 2:209590040-209590062 AGGCAGACACCCATGGGAATGGG + Intronic
947787179 2:232833688-232833710 AGACAAACATAAATGAGACAAGG + Intronic
948254113 2:236553419-236553441 AGGCAGAAAAAAACAGGACATGG + Intergenic
948509768 2:238455989-238456011 AGGCAGTGACAAATGGGGGAGGG + Intergenic
948607398 2:239144744-239144766 AGGCAGACACCACTGGCTCAAGG + Intronic
948703372 2:239774648-239774670 ACACAGACACAGATGTGACATGG - Intronic
1170101229 20:12701490-12701512 AGTCAGACATCAATGGTACATGG + Intergenic
1173303762 20:41828669-41828691 AGGCAGACAGAGATGGGTCCTGG + Intergenic
1173305874 20:41848718-41848740 ATGTGGAAACAAATGGGACAGGG + Intergenic
1173434165 20:43017473-43017495 AGACAGACATAACAGGGACAAGG - Intronic
1173761298 20:45562820-45562842 ATGAAGACACATATGGGAAATGG - Intronic
1174485197 20:50856582-50856604 TACCAGACACAAAAGGGACAAGG - Intronic
1174691990 20:52515760-52515782 AGGCACACACAAAGAGGACTGGG + Intergenic
1175161492 20:57011384-57011406 AGGAAGGCACAAACCGGACACGG - Intergenic
1175266015 20:57703954-57703976 AGGGGGGCACAAAGGGGACACGG + Intronic
1175268267 20:57715425-57715447 AGGCAGCCAAAAATGGGATTTGG - Intergenic
1175430857 20:58902092-58902114 AGGCAGAAACCAATGGGAGATGG - Intronic
1175653234 20:60747133-60747155 AGGCATACAGGAATTGGACAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176040206 20:63061137-63061159 ACGCAGACACAAACAGGACACGG - Intergenic
1177671863 21:24242273-24242295 AGGCAGACACAAAGAGGAGTGGG - Intergenic
1178405263 21:32318106-32318128 AGGAAGGCACAAAGGGGACCTGG + Intronic
1178440377 21:32593565-32593587 CGTCAGACACAAAGGGGATAAGG + Intronic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1179009919 21:37548546-37548568 AGGCAGACACACAAGAGGCAAGG - Intergenic
1179252764 21:39686821-39686843 AGCCAGACACAAAGGGCACAAGG + Intergenic
1179301745 21:40117989-40118011 ATGCAGACACATATGAGACATGG + Intronic
1179396553 21:41045552-41045574 AGGGAGACAGAAAGAGGACAGGG + Intergenic
1179656370 21:42847625-42847647 AAGCAGACACAGATAAGACATGG + Intronic
1179726262 21:43343089-43343111 AGGCAGACAGTCACGGGACACGG + Intergenic
1180917986 22:19502890-19502912 AAGCAGACAGAAAAGAGACAGGG + Intronic
1181307547 22:21925533-21925555 AGGCCGACCCAAGTGGGAGAAGG - Intronic
1181475859 22:23167431-23167453 AGGCAGGCACCCAGGGGACAGGG - Intergenic
1182842010 22:33398778-33398800 AGACAGACACAAAGGGAAGAGGG + Intronic
1183494364 22:38134071-38134093 AGGCAGAAAAAAATGTGAAAAGG + Intronic
1184350417 22:43939853-43939875 AGGCACTCACAAAAGCGACAAGG - Intronic
949422361 3:3879515-3879537 AGGAGGACACAATTGGGAAAGGG + Intronic
950118645 3:10467500-10467522 TGGCAGACACAGTTGGCACATGG + Intronic
951045330 3:18031389-18031411 AGGCAGACACAGCTGGGAACTGG - Intronic
951425009 3:22534266-22534288 AGGCAGAAGCAGATGAGACAGGG + Intergenic
952231307 3:31433597-31433619 AGGCAGGCATAAAGTGGACATGG + Intergenic
953511619 3:43546765-43546787 AGGCTGACAAAAATTGAACAGGG + Intronic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
955941442 3:64150126-64150148 AGGCAGACATCACAGGGACATGG + Intronic
956203811 3:66735593-66735615 AGGCAAATACAAAAGTGACACGG - Intergenic
956307877 3:67846739-67846761 AAGTAGAGACAAATGTGACATGG + Intergenic
956655401 3:71545817-71545839 ATGCAGCAACAAAAGGGACATGG - Intronic
956846988 3:73192886-73192908 AGGGAGAAACAAATGGGACTTGG + Intergenic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
960010200 3:112825552-112825574 AGGGAGACACAAATGAGTTAAGG + Intronic
960369664 3:116818167-116818189 AGGCAGACACAGATGAGAAAGGG - Intronic
960396971 3:117149681-117149703 AGGCAGACACAGAGGGGACTTGG + Intergenic
960521653 3:118662236-118662258 AGGCAGGCATAAACTGGACATGG - Intergenic
961042229 3:123685738-123685760 AGGCAGAGGCAGATGGGGCAGGG - Intronic
961868865 3:129974312-129974334 AGACACACACGAAAGGGACACGG - Exonic
962929209 3:140021953-140021975 CGGCAGACAGAACTGGGACCTGG + Intronic
963574948 3:147048409-147048431 AGGCAGACACAGGAGGCACAAGG + Intergenic
965442365 3:168730133-168730155 AGGCATACACATCTGGGCCATGG + Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966455766 3:180114279-180114301 AGGAAGAAAGAAATAGGACAGGG - Intergenic
968568301 4:1326582-1326604 AGGCAGACACATGTGGGACTTGG + Intronic
968694461 4:2016195-2016217 AGGCAGACACAAAGTCAACAGGG - Intronic
970011295 4:11462356-11462378 AGGCAAAAACAAATGGTAGAAGG + Intergenic
971188668 4:24405865-24405887 AGGAAGACAGAAATGGAAGAAGG - Intergenic
971725003 4:30300228-30300250 GTGCAGACACCCATGGGACATGG - Intergenic
973531005 4:51836764-51836786 AGGCAGACAGCAATAGGAAATGG - Intergenic
974377297 4:61095190-61095212 AGGCAGGCATAAAGTGGACATGG - Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
975718985 4:77232286-77232308 AGGGAGACAGAAGTGAGACAAGG + Intronic
976401841 4:84615590-84615612 AGGCAGACACACCTGTGGCAGGG - Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
978437894 4:108705327-108705349 AGAAAGACACTAATGGAACAAGG + Intergenic
979139828 4:117157869-117157891 ATGGAGACAAAAATGGGAGATGG - Intergenic
982044194 4:151425827-151425849 AGGCAGAAAGAAATTAGACAGGG - Intronic
982658031 4:158173199-158173221 AAGAAGACAGAAAGGGGACAGGG + Intronic
982986892 4:162221191-162221213 AGGATGAAACAAATGGAACAGGG + Intergenic
986980043 5:13437128-13437150 AGGCAGACACCCATGAGCCAAGG - Intergenic
987002239 5:13671579-13671601 AGGCAGAAAAAAATGTGAAAAGG - Intergenic
987038279 5:14038949-14038971 AGACAGAGACAGATGGGAGAAGG - Intergenic
987065097 5:14281950-14281972 AGGTTGACACAAGCGGGACAAGG + Intronic
987450203 5:18074069-18074091 ATGCAGACATAAGTGGGAGACGG - Intergenic
988739209 5:34053412-34053434 AGACAGGAACCAATGGGACATGG - Intronic
989566833 5:42909429-42909451 AAGCAGACAGAAAGGGGGCAGGG - Intergenic
989567563 5:42916260-42916282 AAGCAGACAGAAAGGGGACAGGG + Intergenic
989573953 5:42971821-42971843 AAGCAGACAGAAAAGGGGCAGGG + Intergenic
993225101 5:85159604-85159626 AGGCAGTCACAAAGGGAAGATGG - Intergenic
994287173 5:97983083-97983105 AGACATACACAAAAGGCACATGG + Intergenic
995329589 5:110932509-110932531 AGGCAGACAGAATTGAGAAAAGG - Intergenic
1000993487 5:167935090-167935112 AGCTAGACAGCAATGGGACAAGG + Intronic
1001649330 5:173304249-173304271 AGGCAGACAGAAATAGGTGAAGG - Intergenic
1002044486 5:176534291-176534313 AGGCAGAAACAAGTGGGACCAGG - Intronic
1002167921 5:177359521-177359543 AGGCTGACACAGAAGGGGCAGGG - Intronic
1003465617 6:6377203-6377225 TTGCAGACCCAAATGTGACATGG + Intergenic
1003789094 6:9522344-9522366 ATGCAGCCACATCTGGGACAAGG + Intergenic
1004678209 6:17865104-17865126 AGGCAGACACCTATGGCCCATGG + Intronic
1006140698 6:31927893-31927915 AGGAAGACACAGATGAGAAAAGG - Intronic
1007757314 6:44108393-44108415 AGGCAGGTACACATGGGTCAGGG - Intergenic
1007899653 6:45399290-45399312 AGGAAGACAAAAAAGGGAAAGGG - Intronic
1008186593 6:48400021-48400043 AGGGAGACAAAAATGGGAGCTGG - Intergenic
1009338658 6:62526384-62526406 AGGCAGACAGACATGGACCAAGG - Intergenic
1010721091 6:79283877-79283899 AGGCAGAGTTAAATGGGACAGGG + Intergenic
1012627885 6:101426671-101426693 AGGCAGGCACAAATATGACAGGG - Intronic
1013184324 6:107744887-107744909 GGGCAGAGACACCTGGGACAGGG + Intronic
1013717943 6:112985810-112985832 ATGCTGACACACATGTGACAGGG + Intergenic
1014314144 6:119842521-119842543 AGGCAGGCTCAAATGGAACCAGG - Intergenic
1014461213 6:121698028-121698050 AGTCAGACACAAGGGGGACTGGG - Intergenic
1015785425 6:136917980-136918002 AACCAGACAAAAATTGGACAAGG + Intergenic
1015932633 6:138376700-138376722 AGGAACACATAAATGGAACAAGG + Intergenic
1015992893 6:138966287-138966309 AAGCAGGAGCAAATGGGACAGGG + Intronic
1016321694 6:142853725-142853747 AGCAAGACACAGATGGGCCAGGG + Intronic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1016705437 6:147101469-147101491 AGGTAGAAAGAAATGGGACCTGG + Intergenic
1016890331 6:149000051-149000073 TGGCAGCCAGAAATAGGACAAGG + Intronic
1017228859 6:152050806-152050828 AGTCAGAAACAAATGGGTCCTGG + Intronic
1018525039 6:164700917-164700939 AGCCAGACACAAAGGCCACATGG - Intergenic
1018824493 6:167398910-167398932 AGTCAGATACAAAGGGGATAAGG + Intergenic
1019611525 7:1939229-1939251 AGGCACACACACACGGGCCAGGG + Intronic
1020923061 7:14289719-14289741 AGGCAAACATAAATCAGACATGG + Intronic
1022101733 7:27173286-27173308 AGGCAGACACAAGGAGGAGAAGG - Intronic
1022174967 7:27863887-27863909 TGGCAGAGAGAAATGTGACAGGG - Intronic
1022336152 7:29423862-29423884 ATGCAGCTACAAATGGGGCATGG - Intronic
1022489946 7:30808968-30808990 AGAAAGAGACAAATGGGAAAAGG + Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1026287184 7:68973619-68973641 GGGCAGACACAGTTGGGAAAGGG - Intergenic
1026738009 7:72961037-72961059 AAGCAGACACAGGTGGCACAGGG + Intronic
1026789046 7:73319832-73319854 AAGCAGACACAGGTGGCACAGGG + Intronic
1027105725 7:75404031-75404053 AAGCAGACACAGGTGGCACAGGG - Intronic
1028763835 7:94527547-94527569 ATGCAAATACAAGTGGGACAAGG + Intronic
1028938653 7:96494041-96494063 AGGAAGACACAAATTGCAAAAGG + Intronic
1029577613 7:101413801-101413823 AGGAGGACAGAACTGGGACATGG - Intronic
1030217791 7:107063774-107063796 TGGGAGAAACAAATGGGAAAAGG - Intronic
1032748258 7:134809889-134809911 ATACAGACAGAAATGGGACATGG + Intronic
1035047034 7:155974396-155974418 AGGCAGACGTAAATGGGTCCAGG + Intergenic
1035250498 7:157593966-157593988 AGGCAGACACAAAGGGCAGGAGG + Intronic
1035480920 7:159184038-159184060 AGGCAAAGACAAATGAGAGATGG - Intergenic
1036435192 8:8726407-8726429 AGGCATACACCAATGGGCCCAGG + Intergenic
1037188743 8:16096843-16096865 AGGAAGAGACAAATGAGACTAGG - Intergenic
1037306674 8:17512092-17512114 AGACATACACAAAAAGGACATGG + Intronic
1037467492 8:19174225-19174247 AGACTGACCCACATGGGACATGG + Intergenic
1037852192 8:22340585-22340607 ATGCAGACACAGACGGGAGAAGG + Intronic
1038379403 8:27078669-27078691 AGGAAAAAACAAATGGGAAAGGG + Intergenic
1040299093 8:46178728-46178750 AGGCAGACAGAAGGGAGACATGG - Intergenic
1041391906 8:57354395-57354417 AGGCAGACAGAAATGAGCCTTGG - Intergenic
1041826649 8:62102268-62102290 AGTCAGGCATAAATGGAACATGG - Intergenic
1042712449 8:71733633-71733655 AGGCGGATACAGATGGGACATGG + Intergenic
1043427625 8:80164057-80164079 AGACAGACAGAAAGGGGAAAGGG + Intronic
1044837362 8:96309440-96309462 AGGCAGCCTGACATGGGACAAGG + Intronic
1046118299 8:109811713-109811735 ATGCAGACTCACATGGGAGAAGG + Intergenic
1047679893 8:127243907-127243929 GGGCAGAAAGAAAAGGGACAAGG + Intergenic
1049886476 9:30331-30353 AGGCGGACAAAACTGGGAGAGGG - Intergenic
1052413947 9:28153894-28153916 AAGCAAATACAATTGGGACAAGG + Intronic
1054929123 9:70618072-70618094 AGACAGAAAAAAATGGGAGATGG - Intronic
1055903615 9:81268660-81268682 AGGCAGAAAAAAATGTGAAAAGG - Intergenic
1056670104 9:88620167-88620189 AGGTAGGCATAAATTGGACAAGG - Intergenic
1057410497 9:94813015-94813037 AGGCAAAAAAAAAGGGGACAAGG + Intronic
1057494803 9:95552728-95552750 AGGAAGACACAAATTCAACAGGG - Intergenic
1059754794 9:117282446-117282468 TGGCCCACACTAATGGGACAGGG + Intronic
1060783290 9:126429779-126429801 AGGCAGACACACAGGGCACTTGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1187429324 X:19207243-19207265 AGGCAGCTACAAATAGGAAAAGG + Intergenic
1187788508 X:22921107-22921129 AGGCACACACAAAGGGTAGAAGG + Intergenic
1189339745 X:40195820-40195842 AGGCAGACTCAAGTAGGCCAAGG + Intergenic
1189535178 X:41927890-41927912 AGGCACACAGAAATGGGAAAGGG - Intergenic
1190150591 X:47944295-47944317 AGGGAGGCAGAAATGGGTCAGGG - Intronic
1190877659 X:54471103-54471125 AGGTAGACACAAAGGGGCTAAGG + Intronic
1191662718 X:63667559-63667581 AGGCAAACACAAATCAGGCAGGG + Intronic
1192914114 X:75635642-75635664 GGTCCCACACAAATGGGACATGG + Intergenic
1195367319 X:104138904-104138926 AGGCAGACACACATGTGGCTGGG - Intronic
1195888396 X:109666599-109666621 AGGCAGACACAGCTGTTACAAGG + Intronic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198223859 X:134627545-134627567 AAGCAGTCACAAAAGGTACAAGG + Intronic
1198829085 X:140729839-140729861 AGGCATATATAAATGGCACATGG - Intergenic
1199548170 X:149030122-149030144 AGGAAGACAGCAATGAGACATGG + Intergenic
1199671345 X:150150848-150150870 AGGGAGCCTCAGATGGGACATGG + Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200766518 Y:7084840-7084862 AGGCAGACACACATGTGCAAGGG - Intronic