ID: 1115369109

View in Genome Browser
Species Human (GRCh38)
Location 14:32592191-32592213
Sequence CTAGTTATGTGCTGTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115369106_1115369109 4 Left 1115369106 14:32592164-32592186 CCATGCATTCATTTCCCTGAACA 0: 1
1: 0
2: 0
3: 29
4: 280
Right 1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 247
1115369107_1115369109 -10 Left 1115369107 14:32592178-32592200 CCCTGAACATTTGCTAGTTATGT 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115369109 Original CRISPR CTAGTTATGTGCTGTGTGCC AGG Intronic
900303336 1:1988881-1988903 CGAGTTACCTGCTGTGTCCCGGG + Exonic
900634986 1:3658595-3658617 TTAGTAATGGTCTGTGTGCCAGG - Intronic
900895555 1:5480597-5480619 CTAGCACTGTGCTTTGTGCCTGG - Intergenic
903776374 1:25796707-25796729 CTAAATACCTGCTGTGTGCCAGG - Intergenic
903889506 1:26560237-26560259 CTTAGTGTGTGCTGTGTGCCAGG - Intronic
904270250 1:29345121-29345143 CTAGCTCAGAGCTGTGTGCCTGG - Intergenic
904418834 1:30378631-30378653 ATGGGCATGTGCTGTGTGCCAGG + Intergenic
906633510 1:47391947-47391969 CAAATGATGTGCTGTTTGCCCGG - Intergenic
906865481 1:49413847-49413869 CTAGTTATGTGATCTGTAACAGG + Intronic
907350075 1:53821811-53821833 CTAAATATTTACTGTGTGCCAGG + Intronic
908075128 1:60508726-60508748 CTGAATGTGTGCTGTGTGCCAGG - Intergenic
908084131 1:60612087-60612109 CCTGTTATGTGCTGTGTACTGGG - Intergenic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
908869714 1:68595024-68595046 TTGGTTAAGTGCTGTCTGCCAGG + Intergenic
908952676 1:69580693-69580715 CTAAATATTTACTGTGTGCCAGG + Intronic
909082361 1:71128207-71128229 ATACTAATGTGCTGAGTGCCAGG + Intergenic
910340169 1:86177790-86177812 CTGAGCATGTGCTGTGTGCCAGG - Intergenic
910431023 1:87159865-87159887 CTAGGCATGTGCGCTGTGCCAGG + Intronic
911092724 1:94030597-94030619 CTGGATAGCTGCTGTGTGCCAGG + Intronic
911661265 1:100504081-100504103 ATAGTTATGTGCCCTGTGCATGG + Intronic
912454105 1:109786438-109786460 CTGAGCATGTGCTGTGTGCCAGG + Intergenic
912570107 1:110615215-110615237 CTAGGTAAGTGGTGTGTGGCAGG - Intronic
913282921 1:117202693-117202715 CTAGTTATCCTCTCTGTGCCTGG - Intronic
914050509 1:144126584-144126606 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
914128673 1:144838861-144838883 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
915177412 1:154027777-154027799 CTAGTTACGTTTTGAGTGCCTGG - Intronic
916552896 1:165865959-165865981 CCAGTTATTTGTTGTGTGGCTGG + Intronic
920938502 1:210458338-210458360 CTTGTTTTGTGTTATGTGCCAGG + Intronic
922014870 1:221635130-221635152 CTAAGTATGTGTTATGTGCCAGG + Intergenic
922129403 1:222762126-222762148 CAGGTTCTGTGCTGTGTGCTGGG + Intergenic
923271046 1:232355272-232355294 CTAGTCATGTGCTCAGTGTCTGG - Intergenic
923953758 1:238991430-238991452 TTAATTATGTGTTATGTGCCAGG + Intergenic
924021256 1:239786332-239786354 CTTACAATGTGCTGTGTGCCAGG + Intronic
1063110686 10:3034231-3034253 TAAGTGTTGTGCTGTGTGCCAGG - Intergenic
1063270961 10:4509628-4509650 CCAGTTCTGTGGTTTGTGCCTGG + Intergenic
1066762892 10:38773392-38773414 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1067682350 10:48449068-48449090 CCAGTTGTGTGCTGAGTGCCTGG - Intronic
1069752051 10:70751262-70751284 CTGGATACCTGCTGTGTGCCAGG - Intronic
1070322031 10:75361830-75361852 CCAGGTGGGTGCTGTGTGCCTGG + Intergenic
1071443276 10:85723221-85723243 CGAGTGATGGCCTGTGTGCCTGG - Intronic
1072489542 10:95890310-95890332 CTAGTGTTGAGCTGTATGCCTGG + Intronic
1072521506 10:96233938-96233960 CTTCCTATGTGCTGGGTGCCAGG + Intronic
1073008250 10:100340812-100340834 CTATTTATGTGCACTGTGCTAGG - Intergenic
1075224436 10:120613652-120613674 CTTGTTATATCATGTGTGCCAGG + Intergenic
1077442581 11:2575450-2575472 TGAGTTATGGGCTGTGTTCCTGG + Intronic
1077640934 11:3880906-3880928 CTAGTCATTTCCTGTGTGTCAGG - Intronic
1078448906 11:11425784-11425806 CGTGTTTTGTGCTGAGTGCCTGG - Intronic
1078843836 11:15104284-15104306 CTAGTGATGTGCATGGTGCCAGG + Intergenic
1079115094 11:17635539-17635561 CCAGCAACGTGCTGTGTGCCAGG + Intronic
1085295506 11:75429473-75429495 CAAGTTCTGTGCAGGGTGCCGGG - Intronic
1086720071 11:90109442-90109464 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1087158593 11:94927707-94927729 CTGGGTACCTGCTGTGTGCCAGG - Intergenic
1088011451 11:105006353-105006375 TTAGGTATCTGCTATGTGCCAGG + Intronic
1089741591 11:120588357-120588379 CCAGGTATGTGCTGGGTGACTGG - Intronic
1092137110 12:6157765-6157787 CTAGGCTGGTGCTGTGTGCCTGG - Intergenic
1096321294 12:50615672-50615694 TTGAGTATGTGCTGTGTGCCAGG + Intronic
1096917667 12:55050749-55050771 CTAGTTATCTGCAGTGGGCATGG - Intergenic
1097904447 12:64905569-64905591 GTAGTGATGAGCTGTGAGCCAGG + Intergenic
1097992153 12:65847127-65847149 TGTGCTATGTGCTGTGTGCCTGG + Intronic
1104111871 12:125711728-125711750 CTTGTTTTGTGCTGGGTGCTGGG + Intergenic
1105348483 13:19595583-19595605 CTAGTTTTGTGATGGGTGGCAGG - Intergenic
1106417888 13:29561046-29561068 ACAGTTATGTACTGAGTGCCAGG + Intronic
1106467797 13:30028297-30028319 TTAGTTCTGTGCTATGTTCCAGG + Intergenic
1107382358 13:39870369-39870391 TTAAGTATCTGCTGTGTGCCAGG - Intergenic
1107648933 13:42524829-42524851 CCAGTTGTGTACTGTGTGCTTGG + Intergenic
1110933706 13:81256011-81256033 CTAATTACCTGCTATGTGCCAGG - Intergenic
1112710348 13:102120459-102120481 CTACTTATGTCCTGTGTCCCTGG - Intronic
1114036059 14:18628662-18628684 CCATTTATTTGCTATGTGCCTGG - Intergenic
1114122579 14:19686368-19686390 CCATTTATTTGCTATGTGCCTGG + Intergenic
1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG + Intronic
1115829096 14:37314917-37314939 CCTGTTATGTGCTGTGTGTTGGG + Intronic
1116065319 14:39974491-39974513 TAAGTTATTTGCTGAGTGCCAGG - Intergenic
1119645531 14:76345851-76345873 TTAGGTAGGTACTGTGTGCCAGG + Intronic
1121023004 14:90593242-90593264 CTAGATGTCTGCTCTGTGCCAGG + Intronic
1121837110 14:97102112-97102134 CCAGTTGTATGCTGTGTGCCAGG - Intergenic
1202934220 14_KI270725v1_random:69646-69668 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1123420383 15:20125894-20125916 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1123445476 15:20327630-20327652 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
1123529607 15:21132430-21132452 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1123759432 15:23421165-23421187 ATAGATATTTTCTGTGTGCCAGG - Intergenic
1125677093 15:41507967-41507989 ATAGAGATTTGCTGTGTGCCAGG - Intronic
1126253504 15:46596908-46596930 CTATTTATTTGCTATATGCCAGG + Intergenic
1128874549 15:71191474-71191496 TTAATTATTTGCTGCGTGCCAGG + Intronic
1130318345 15:82816318-82816340 ATACTTAAGTGCTGTGTTCCAGG + Intronic
1130866997 15:87941736-87941758 CTAATTAAGGTCTGTGTGCCTGG + Intronic
1132355562 15:101168862-101168884 TTAGTTGTGAGCTGTGTGCTTGG - Intergenic
1132435489 15:101798057-101798079 TTTATTAAGTGCTGTGTGCCAGG + Intergenic
1134456917 16:14401722-14401744 ATAGATATTTTCTGTGTGCCAGG + Intergenic
1134632922 16:15770037-15770059 TTAAGTATTTGCTGTGTGCCAGG - Intronic
1135474749 16:22764075-22764097 TTTATTGTGTGCTGTGTGCCAGG - Intergenic
1135732620 16:24907342-24907364 ATGGTTATGTGCCCTGTGCCTGG - Intronic
1136721272 16:32320968-32320990 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1136839655 16:33527254-33527276 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1137563086 16:49515619-49515641 CTAGGTCTGTGCTGCGGGCCAGG - Intronic
1137809872 16:51342725-51342747 GTAGCCATGTGCTGGGTGCCAGG - Intergenic
1138813070 16:60173468-60173490 CTAGTCATGTACTTTGTGACAGG + Intergenic
1139353171 16:66350663-66350685 CTTGGTATGTTCTATGTGCCAGG - Intergenic
1140103797 16:71940798-71940820 CTAATTATAAGCTCTGTGCCTGG - Intronic
1140957384 16:79877951-79877973 CCCGTTATGTGCTGAGTGCTGGG + Intergenic
1142216743 16:88833786-88833808 CTAGTCTTGTGCTGGGTGCTGGG + Intronic
1142243747 16:88958997-88959019 ATAGACAAGTGCTGTGTGCCCGG + Intronic
1203005160 16_KI270728v1_random:196802-196824 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
1203136710 16_KI270728v1_random:1732923-1732945 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
1203149821 16_KI270728v1_random:1827539-1827561 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1144354822 17:14435273-14435295 CTAGCTAGGTGGTTTGTGCCAGG + Intergenic
1146784754 17:35709600-35709622 CTATTTATTTGCTGTGTGACTGG + Intronic
1148961788 17:51399419-51399441 TTAAGTATGTACTGTGTGCCAGG + Intergenic
1149303967 17:55331038-55331060 CTAGTTATATGCTTTGCTCCAGG - Intergenic
1150502370 17:65663611-65663633 CTAGTTCTGTGCTGGGTTGCAGG - Intronic
1150932225 17:69597354-69597376 CTGAATATGTGCTGTGTACCAGG + Intergenic
1155612979 18:27689412-27689434 CTGCTTATGTCCTTTGTGCCAGG + Intergenic
1161090705 19:2358628-2358650 CTGAGTATGTGCTGTGTGCCCGG - Intergenic
1162145974 19:8612122-8612144 GTTGTTATGTGCTGGGTTCCAGG + Intergenic
1162985591 19:14267329-14267351 CCAGGTATGTGCTGTGTGCCAGG - Intergenic
1164820846 19:31250053-31250075 CCGGGCATGTGCTGTGTGCCTGG - Intergenic
1166455511 19:42937033-42937055 CAGGTTATATGCTGTGTGCAGGG + Exonic
1166482569 19:43186362-43186384 CAGGTGATGTGCTGTGTGCAGGG + Exonic
1167620518 19:50557502-50557524 CTGGTCACTTGCTGTGTGCCAGG - Intronic
1202689916 1_KI270712v1_random:79222-79244 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
929592787 2:43157966-43157988 CTAGCCATGTGCTGGGTGCGGGG + Intergenic
931887614 2:66634017-66634039 TTTATTATGTGCTGTGTGCCAGG + Intergenic
933956502 2:87376801-87376823 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
934240648 2:90268827-90268849 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
934272544 2:91547932-91547954 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
934307036 2:91834687-91834709 CTAGGTATATGCTGTGTTTCTGG - Intergenic
934326220 2:92018055-92018077 CTAGGTATATGCTGTGTTTCTGG + Intergenic
934746817 2:96764656-96764678 CTAGGTGTGTGCTGTGTCCTGGG - Intronic
935212961 2:100954144-100954166 CTAATTATCTGGTGTCTGCCCGG + Intronic
936148592 2:109997844-109997866 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
936196086 2:110373524-110373546 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
936456461 2:112678650-112678672 TTAATTATTTGCTGTGTCCCTGG - Intergenic
937135523 2:119548398-119548420 CTATGTAAGTGCTTTGTGCCAGG - Intronic
938587700 2:132707604-132707626 TTAGGTATCTCCTGTGTGCCAGG + Intronic
939948531 2:148440355-148440377 CAAGTCATTTTCTGTGTGCCAGG + Intronic
940048282 2:149433659-149433681 CTAGTTTTATGCTGTGAGCCTGG + Intronic
941709529 2:168697427-168697449 CTGATTATTTTCTGTGTGCCAGG + Intronic
943059118 2:183019683-183019705 CTTGTTATCTAATGTGTGCCAGG - Intronic
944161470 2:196664833-196664855 TTTTTTATGAGCTGTGTGCCAGG + Intronic
947395779 2:229685751-229685773 CCAGTTGTTTGCTCTGTGCCTGG - Intronic
948470316 2:238173298-238173320 CTAGGCATGTGCTGTGTGCTGGG - Intronic
948802614 2:240439735-240439757 CTGGTGAGGGGCTGTGTGCCAGG - Intronic
948907236 2:240985767-240985789 CTGGGTGTGTGCTGAGTGCCTGG - Intronic
1171294387 20:24004785-24004807 CTTTTTAGGAGCTGTGTGCCAGG + Intergenic
1171993044 20:31711142-31711164 GTAGTTACTTGCTCTGTGCCAGG - Intronic
1172450492 20:35019211-35019233 CTGGGTTTCTGCTGTGTGCCGGG - Intronic
1172541497 20:35720912-35720934 CTGGTTATGTGCTCAGTTCCAGG - Intronic
1172942390 20:38663499-38663521 CTGGTTATCTGCCATGTGCCAGG + Intergenic
1173857426 20:46259317-46259339 CAAGTTCTGTGCTGGGTCCCTGG + Intronic
1174231879 20:49052230-49052252 CTAAATATGTACTGTGTGCCAGG + Intronic
1174731457 20:52922163-52922185 TTGCATATGTGCTGTGTGCCAGG + Intergenic
1175954692 20:62603307-62603329 GTAGTCACCTGCTGTGTGCCAGG + Intergenic
1176595622 21:8691848-8691870 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1178379776 21:32098278-32098300 CTATGTATTTGCTGTGTGGCAGG - Intergenic
1180278482 22:10668958-10668980 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1180460185 22:15555724-15555746 CCATTTATTTGCTATGTGCCTGG - Intergenic
1180551500 22:16545340-16545362 CCAGGCATGTGCTGAGTGCCTGG + Intergenic
1180585733 22:16887817-16887839 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1181352502 22:22268583-22268605 CCAGGCATGTGCTGAGTGCCTGG - Intergenic
1181966088 22:26657586-26657608 CCAGTTCTGCGCTGTGAGCCGGG + Intergenic
1182678316 22:32057798-32057820 ACAGTTATGTTTTGTGTGCCTGG - Intronic
1182751945 22:32648774-32648796 TTAGTTGTTTGCTGTGAGCCAGG - Intronic
1183512447 22:38244018-38244040 CTTGATACGTGCTGTGTCCCCGG - Intronic
1183606493 22:38869440-38869462 TCAGTTATTTGCTGCGTGCCAGG - Intronic
1183917142 22:41130405-41130427 TTAGTTGTGTGTGGTGTGCCTGG + Intronic
1184040568 22:41940701-41940723 TTTGTTCTGTGCTGTGTCCCTGG + Intronic
1184397082 22:44248687-44248709 CTAAGCATCTGCTGTGTGCCAGG - Exonic
1184724920 22:46338394-46338416 ATAATTAAGTGCTGTGTGCTAGG + Intronic
1185032197 22:48450023-48450045 CTAGTCCTGGGCTGGGTGCCGGG + Intergenic
951551524 3:23879695-23879717 CCAGGTGGGTGCTGTGTGCCTGG + Intronic
952558212 3:34558060-34558082 ATAGGTATCTCCTGTGTGCCAGG + Intergenic
953751206 3:45609871-45609893 CTGGGTACCTGCTGTGTGCCAGG - Intronic
954882346 3:53844682-53844704 CTGATTCTGTGCTGTGGGCCAGG - Intronic
954983659 3:54769878-54769900 GTAATTATGTGCTGTGAGCCAGG + Intronic
955141644 3:56275668-56275690 CTAGCTAAGAGCTGTGTCCCAGG - Intronic
955326761 3:58014574-58014596 CTGGTTTTGTGCTGTGAGGCAGG + Intronic
955410585 3:58653008-58653030 CTAGGCATCTGCTCTGTGCCAGG + Intronic
955708676 3:61755552-61755574 CTAATTGTCTACTGTGTGCCAGG + Intronic
957637063 3:82800141-82800163 CTAGTTGTGTGCTGGGTGGAAGG - Intergenic
957725406 3:84058643-84058665 ATAATTATTTGCTGTGTGCCAGG - Intergenic
960405036 3:117249484-117249506 GTAGTAATTTCCTGTGTGCCTGG + Intergenic
961314454 3:126025161-126025183 CTGGGTGTCTGCTGTGTGCCTGG - Intronic
961380067 3:126491321-126491343 CTTGTTCTCTGCTGTGTCCCTGG + Intronic
961625348 3:128258534-128258556 CTAGCCAGGTGCTGTGTGCATGG + Intronic
961772459 3:129260086-129260108 CTGGGCATCTGCTGTGTGCCAGG - Intronic
962295010 3:134175597-134175619 CTAGTGATGTGGTAAGTGCCGGG - Exonic
963518254 3:146335000-146335022 CTAGATATCTGCTGTGTGGAAGG - Intergenic
964720975 3:159766710-159766732 CCATGTATGTGCTGTGTGCCAGG + Intronic
966435531 3:179879673-179879695 ATAGATAGGTGCTGGGTGCCAGG - Intronic
972441426 4:39097442-39097464 TTGCTTAAGTGCTGTGTGCCAGG - Intronic
972816226 4:42649271-42649293 CTAGTTATATCCTTAGTGCCTGG - Intronic
972951751 4:44334195-44334217 TTGGTTGTCTGCTGTGTGCCAGG + Intronic
973913395 4:55607039-55607061 TTAGCTATATGCTATGTGCCAGG - Intronic
977875940 4:102149932-102149954 CAAGGTATGTGCTGTGGGACTGG + Intergenic
978198334 4:105996038-105996060 TTAGTTATGTGGTCTGTACCTGG - Intronic
979399845 4:120235916-120235938 CTAGTTACGTTCTGTGTTACAGG - Intergenic
980809059 4:137852244-137852266 TTAGGTAAGTGCTGTGTCCCTGG + Intergenic
983403758 4:167299093-167299115 CTAGCTATGTGGTGTTTCCCTGG - Intergenic
983837088 4:172402200-172402222 TTTGTTCTATGCTGTGTGCCTGG + Intronic
984695547 4:182775759-182775781 CTAGTTAGGTGCTGTGTCTTTGG - Intronic
986373270 5:7102657-7102679 CTTGTTATTTGCTATGTGCCAGG - Intergenic
989652892 5:43713274-43713296 TTTGTTATGTGCCATGTGCCAGG + Intergenic
990737617 5:58881091-58881113 CTAGGTATCTACTATGTGCCAGG + Intergenic
990868301 5:60403529-60403551 GTATTCATGTTCTGTGTGCCAGG + Intronic
991024177 5:62011999-62012021 CTACTTAAGGGCTGTGTGACTGG - Intergenic
992503698 5:77365552-77365574 ATAGATATTTTCTGTGTGCCAGG - Intronic
993924311 5:93846559-93846581 TTTATTATGTGCTGTTTGCCAGG - Intronic
994088518 5:95786351-95786373 CCAGTTTTGTACTGTGTGTCAGG + Intronic
994900854 5:105767454-105767476 CTCGATATCTTCTGTGTGCCTGG - Intergenic
997032808 5:130151456-130151478 ATAGTTATTGACTGTGTGCCAGG + Intronic
997127442 5:131242109-131242131 ATAGTTGTGTGATGTATGCCTGG - Intergenic
997822753 5:137080626-137080648 CTGGCTGTGTTCTGTGTGCCTGG - Intronic
998566249 5:143218361-143218383 CTTGTTCTGTGCTATGTGCAAGG + Intronic
1001713389 5:173795365-173795387 CCAGTGCTGTGCTGGGTGCCTGG - Intergenic
1003552517 6:7111161-7111183 TTGGTTACCTGCTGTGTGCCAGG + Intronic
1003697011 6:8418003-8418025 CTAAATATCTGCTGTGTGTCAGG + Intronic
1004239362 6:13904864-13904886 TGAGGTATCTGCTGTGTGCCAGG - Intergenic
1005130179 6:22497957-22497979 CTGGATATTTGCTGTGTGTCAGG + Intergenic
1005296355 6:24431265-24431287 CTTGTTAAGTGCTGTGGACCAGG - Intronic
1006594244 6:35181445-35181467 CTAGTCCTGGGCTGTTTGCCAGG - Intergenic
1007311686 6:40951624-40951646 TTACTTGTTTGCTGTGTGCCAGG - Intergenic
1008001334 6:46363468-46363490 CTAGTTTCTTGCTGTGAGCCTGG - Intronic
1008093726 6:47317317-47317339 CTATGTATCTACTGTGTGCCCGG + Intergenic
1018584708 6:165344570-165344592 CTCCTAATGTGCTGTCTGCCTGG - Intronic
1019036740 6:169067171-169067193 TTGGGTATGTGCTGTGTGCGTGG + Intergenic
1022101264 7:27170200-27170222 CTAGAGATGCGCTGTGGGCCAGG + Intronic
1023723637 7:43120006-43120028 CTAGACATCTGCTGTGTGCCAGG + Intronic
1024560928 7:50644693-50644715 CTAGTTCGGTGCTGTGATCCAGG - Intronic
1024948790 7:54837229-54837251 CCAGTTAAATGCTGTGTGTCTGG - Intergenic
1031089902 7:117341563-117341585 ATAGGTATGAGCTATGTGCCTGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033957787 7:146873465-146873487 TTAATTACTTGCTGTGTGCCAGG + Intronic
1035083631 7:156237839-156237861 CACGGTCTGTGCTGTGTGCCTGG + Intergenic
1035290811 7:157837354-157837376 CTTGTTGTGTGCTGTGGGCCAGG + Intronic
1038729740 8:30116271-30116293 GATGTTATGAGCTGTGTGCCAGG - Intronic
1039557638 8:38488036-38488058 CAAGACATGTGCTTTGTGCCAGG + Intergenic
1040856136 8:51949903-51949925 CTTATTATTTGCTGTGTGCATGG + Intergenic
1041621740 8:59977858-59977880 CTAATTATGTGCAGTTTACCAGG - Intergenic
1042641453 8:70939712-70939734 CTATTTATCAGCTGTGTTCCAGG + Intergenic
1043149279 8:76693458-76693480 GTAGTTATGTGATGTTTCCCAGG - Intronic
1043630757 8:82329412-82329434 CTAGTCATGTGCTGTTTTCTGGG + Intergenic
1044520256 8:93190919-93190941 CTTGTTATGTTCTGGGTGCTGGG - Intergenic
1046643561 8:116759870-116759892 CAAGTGTGGTGCTGTGTGCCTGG - Intronic
1047190343 8:122673728-122673750 CTGATTCTGTTCTGTGTGCCGGG - Intergenic
1049129498 8:140825273-140825295 CCTGTTATCTGCTGTATGCCAGG - Intronic
1050472094 9:6004429-6004451 CAAGTTATATGCTGTGTCCAGGG + Intronic
1051219143 9:14830396-14830418 CTAGTTTTCTACTGTTTGCCTGG + Intronic
1052066054 9:24021682-24021704 CTAGGCATGTGTTGTGTGCCCGG + Intergenic
1052740409 9:32386829-32386851 CCAGTTATGTGCGGGATGCCAGG + Intronic
1053941649 9:43255811-43255833 CTAGGTATATGCTGTGTTTCTGG + Intergenic
1054862597 9:69968972-69968994 ATTATTATGTACTGTGTGCCAGG - Intergenic
1058738767 9:107921722-107921744 TTAATTATGTGCTATATGCCAGG + Intergenic
1059243147 9:112825718-112825740 TTAGACATCTGCTGTGTGCCTGG + Intronic
1060214852 9:121732598-121732620 CTAGTTTTGAGCTGTGTGGGTGG - Intronic
1060573546 9:124666755-124666777 CTTGTTTATTGCTGTGTGCCTGG - Intronic
1060942888 9:127553454-127553476 CTGAGTATTTGCTGTGTGCCAGG + Intronic
1062406061 9:136397248-136397270 GTAGCTTTGTCCTGTGTGCCTGG - Intronic
1185525283 X:773689-773711 CTTGTTATCTTCTGAGTGCCAGG + Intergenic
1186827742 X:13358124-13358146 CAAGTTCCCTGCTGTGTGCCAGG - Intergenic
1186859079 X:13653385-13653407 CTGTTTGTGTGCTGGGTGCCGGG + Intronic
1189014431 X:37081527-37081549 AAAGTTAAGTGCTGTGTTCCTGG + Intergenic
1189406700 X:40731896-40731918 TTAGTTAAGCCCTGTGTGCCAGG + Intronic
1190301047 X:49057802-49057824 CAGGATGTGTGCTGTGTGCCGGG + Intronic
1190421998 X:50294568-50294590 GTAGTTCTGTGCTCTATGCCAGG - Intronic
1190827716 X:54032734-54032756 TCAGATATGTGCTATGTGCCAGG - Intronic
1197217316 X:123879076-123879098 ATAGTTCTGTGCTGTGAGCCAGG + Intronic
1201192473 Y:11457386-11457408 CTAGGTATATGCTGTGTTTCTGG + Intergenic