ID: 1115369862

View in Genome Browser
Species Human (GRCh38)
Location 14:32601020-32601042
Sequence GGTGGGGGACAGTACTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115369851_1115369862 22 Left 1115369851 14:32600975-32600997 CCAAGTTTTCCAGGAAGAGGTCT 0: 1
1: 0
2: 2
3: 25
4: 291
Right 1115369862 14:32601020-32601042 GGTGGGGGACAGTACTTTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 104
1115369852_1115369862 13 Left 1115369852 14:32600984-32601006 CCAGGAAGAGGTCTTTTTTTGAA 0: 1
1: 0
2: 1
3: 27
4: 296
Right 1115369862 14:32601020-32601042 GGTGGGGGACAGTACTTTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115369862 Original CRISPR GGTGGGGGACAGTACTTTAA GGG Intronic
900094172 1:933698-933720 GGTGGGAGTAAGTACTTTATGGG - Intronic
901064519 1:6488596-6488618 GGTGGGGGACTGTTCCTTAGGGG + Intronic
901149743 1:7093295-7093317 GGTCTGGGACTGTACTTTGAGGG + Intronic
901350091 1:8587705-8587727 GGTGGGGGATAGAACTGGAAAGG - Intronic
901763938 1:11488199-11488221 GGAGGGGGTCAGTACTTGAGGGG + Intronic
903666826 1:25013143-25013165 GGTGGGGGTCTGGACTTTGACGG + Intergenic
906737515 1:48145434-48145456 TGTGGGGGAGAGTTCTGTAAAGG - Intergenic
911043373 1:93609191-93609213 GGTAGGGGAAATGACTTTAAAGG + Intronic
911337811 1:96602218-96602240 GGTGGGAGATAGTTATTTAAAGG + Intergenic
915012391 1:152699482-152699504 GCTGGGGCACTGGACTTTAAGGG - Intergenic
915609861 1:156983177-156983199 GGTGTGGGAGAGTCCTTAAAGGG - Intronic
916434160 1:164761130-164761152 GTGAGGGGACAGTACTTTTAAGG - Intronic
917740086 1:177953459-177953481 GGTGAGGGACCCTCCTTTAAGGG - Intronic
921937695 1:220809986-220810008 TGTGGTGCACAGCACTTTAACGG + Intronic
924148324 1:241100713-241100735 GGTGGGGTAAAGTATTTTAAGGG + Intronic
924289016 1:242519184-242519206 TGTGGGGTACAGTATTTTCATGG + Intronic
924406014 1:243746902-243746924 GGTGGGGGGCAGTACAGGAAAGG + Intronic
924947614 1:248856899-248856921 GATGGGGGACAGTATTGGAAAGG - Intronic
1063846443 10:10133307-10133329 GGTGTGGGTCAGTGCCTTAAAGG + Intergenic
1072241991 10:93505343-93505365 GGTGGGGGACCCTACCCTAAAGG - Intronic
1073875613 10:107918389-107918411 GTTGGGGGCCCGTGCTTTAAAGG + Intergenic
1074167031 10:110889793-110889815 GGAAGAGGACAGTACTATAATGG + Intronic
1074594378 10:114847728-114847750 GGTGGGGGAGGGAACTTTGAGGG - Intronic
1079922241 11:26447229-26447251 GGTGGGGGGGGGTACTTTTATGG + Intronic
1081081538 11:38746589-38746611 GGTGGGGGACAGATGTTTACAGG + Intergenic
1086399595 11:86449660-86449682 GGTGGGGGACAAGACTAGAAGGG + Intronic
1087038965 11:93780403-93780425 GGTTGGAGACAGTCCTTTAGAGG - Intronic
1089974138 11:122717807-122717829 GGTGGGGGACAGTAGGGGAAGGG - Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092922297 12:13243405-13243427 GGTAGGTGACAGTACTTTGCAGG - Intergenic
1094149916 12:27271346-27271368 GGTGGGGTCCAGTACTTTTAAGG + Intronic
1097052115 12:56229991-56230013 GGGGAGGGACACTACCTTAAAGG - Intergenic
1107249761 13:38345632-38345654 GGTGGAGCACAGAACTTTCAGGG + Intergenic
1108695157 13:52896540-52896562 ACTTGGGGACAGTTCTTTAAAGG + Intergenic
1110604616 13:77417727-77417749 TGTGGGGTACAGTTCTTTCATGG - Intergenic
1112562254 13:100525450-100525472 GGTGGTGGACAGGAGCTTAAGGG - Intronic
1115369862 14:32601020-32601042 GGTGGGGGACAGTACTTTAAGGG + Intronic
1115977149 14:39009266-39009288 GGTGGGGGACAGATGTTTACAGG - Intergenic
1120793589 14:88607791-88607813 GGTGGGGGATGGTACTTGCAGGG - Intronic
1121836663 14:97098431-97098453 GGAGGGGGACAGGGCTTTAATGG + Intergenic
1126351893 15:47752596-47752618 GCTGATGGACAGTACTTAAATGG + Intronic
1126961908 15:54005946-54005968 GGTGGAGGATATTACTTTAGGGG + Intergenic
1129779352 15:78259982-78260004 GGGGGGGACCAGTACTTCAAGGG - Intergenic
1133830625 16:9320245-9320267 GGTGGGAGACAGGACTGGAAAGG - Intergenic
1135258877 16:20964086-20964108 GGAGGAGGACAGAACTTTGATGG + Exonic
1135651970 16:24214172-24214194 GCTGGAGGACAGCACTTTGAGGG + Intronic
1140644003 16:77010357-77010379 GGTGGGGGACAGTTTCCTAAGGG - Intergenic
1141428569 16:83959196-83959218 GGTGGGGGACACTACTGTGGAGG - Intronic
1142207924 16:88792751-88792773 GGTGGGGGACAGCATTCCAAGGG - Intergenic
1144103509 17:11964834-11964856 GGTGGGGAACAGGGCTTTGAAGG - Intronic
1146151456 17:30476728-30476750 AGTGGGGGAAAGAACTTTACAGG + Intergenic
1149492686 17:57096489-57096511 GGTGGGGGACAGTCCTAGACAGG + Intronic
1156339140 18:36195723-36195745 TGTGGGGGACAGTGCTATAATGG + Intronic
1156601660 18:38614603-38614625 GGTGGGGGAGAGAACAATAAAGG - Intergenic
1157094107 18:44671368-44671390 GGTAGAGGACAGTTTTTTAATGG - Intergenic
1159209893 18:65305033-65305055 GGTGGGGAAAAGGTCTTTAAAGG - Intergenic
1163899667 19:20090383-20090405 AGTGGGGGAGAGTACTTAAGTGG + Intronic
1167300480 19:48674713-48674735 TGTTGGGGAGAGTTCTTTAAGGG + Intergenic
928203808 2:29269787-29269809 GGGGGGGGACTGTTCATTAAGGG - Intronic
928262593 2:29781288-29781310 GCTGGGGTACAGTTCTTTGAGGG - Intronic
932027619 2:68151447-68151469 GGTGAGTGACAGTAATTTAGGGG - Intronic
933669793 2:84996274-84996296 GTTGGGTGACATTACTTTAGAGG - Intronic
942725302 2:178999890-178999912 GATGGTGGAAAGTGCTTTAAAGG - Intronic
944852622 2:203735406-203735428 AGTGGGAGACAGTGTTTTAATGG - Exonic
946173516 2:217909107-217909129 GGTGGGCGACACTGCTTTAGCGG - Intronic
948956020 2:241292170-241292192 GGTGGGGGGCAGTGGTTTCAAGG - Intronic
1173216503 20:41089946-41089968 GGTGGGGCAAAGAACTTGAATGG - Intronic
1174936004 20:54869516-54869538 GGTAGAGAACAGTATTTTAAAGG - Intergenic
1179278162 21:39910574-39910596 GGTTGGGGAAAGTGCTTTGAAGG + Intronic
1183350236 22:37330848-37330870 GGTGGGGGTCACTACTTCAGTGG + Intergenic
1183590127 22:38775195-38775217 GGTGGGGGACACTGGTTTGAGGG + Intronic
951722414 3:25714429-25714451 AGTGGGAGCCAGTATTTTAATGG - Intergenic
953387011 3:42512509-42512531 GGTGGGGGACCTTCCTTTAAGGG - Intronic
954077347 3:48190550-48190572 TGTGAGGGACAGTTCTTGAAAGG + Intergenic
955259800 3:57376009-57376031 GATGGGAGACAGTAATATAAAGG + Intronic
959250004 3:103929895-103929917 GGTGGGGGATAGTAAATAAAAGG - Intergenic
962267131 3:133951863-133951885 GTTGGGAGGCAGTAGTTTAATGG - Intronic
964107272 3:153052671-153052693 TGTGGGAGAAAGTAGTTTAAGGG - Intergenic
967187806 3:186960324-186960346 GTTGGGGGACAGTGCAGTAAGGG + Intronic
967633268 3:191771952-191771974 GGTACGGGACACTAGTTTAAAGG - Intergenic
967906391 3:194504462-194504484 GGTGGGGGTCAGTTTTTCAAGGG - Intergenic
975832323 4:78382563-78382585 GGAGAGGGACAGGACTTAAATGG + Intronic
975988186 4:80226145-80226167 GATATGGGACAGTACTTAAAAGG - Intergenic
983217103 4:165012160-165012182 TGTGGGAGACAGTTCTCTAAAGG + Intergenic
983943843 4:173564483-173564505 CATGGTGGGCAGTACTTTAAGGG + Intergenic
984329375 4:178295980-178296002 GGTGGGTGACAATACTCTCAGGG + Intergenic
984846005 4:184108147-184108169 AGTGGGGGACAGGACTCTAGTGG + Intronic
988627216 5:32890284-32890306 GGTGGGAGATAGAAATTTAATGG + Intergenic
992306009 5:75438511-75438533 TTTTGGGGACAGTACTTTAAAGG + Intronic
993626182 5:90227605-90227627 GTTGGGGGACTGTAGTTCAAAGG - Intergenic
994933614 5:106221983-106222005 GGTGGGGGACAGTAGCTGGAAGG + Intergenic
998306899 5:141087175-141087197 GGTGGGGGGCGGTCCTATAATGG + Intergenic
999628024 5:153540703-153540725 GATGGGGGAAAGTGCTTTAGAGG + Intronic
1004112907 6:12738014-12738036 GGAGGAGGAAAGTGCTTTAAAGG - Intronic
1004205673 6:13589678-13589700 GGTGGGGGTCATTACCTTAAAGG + Intronic
1013985044 6:116181790-116181812 GGTGGAAGACAGTATTTTAAAGG + Intronic
1020625178 7:10569228-10569250 AGAGGGGAAAAGTACTTTAATGG + Intergenic
1021555511 7:21914406-21914428 GGTGAGGGTCAGTGCTCTAAGGG + Intronic
1021834822 7:24659625-24659647 GGTGGGGTACAATACTTAGAAGG - Intronic
1022984364 7:35636429-35636451 GGTGAGTTACATTACTTTAAAGG + Intronic
1025779197 7:64584611-64584633 GGTGGGGGACAGTACAATGTAGG - Intergenic
1027480270 7:78687074-78687096 GGTGTGGGTCAGTCCTTGAAGGG - Intronic
1034872230 7:154694955-154694977 GGTGGGGAACAGTGAATTAATGG - Intronic
1036273715 8:7332255-7332277 GGTGGGGGTGAGTTCTATAAGGG + Intergenic
1036274296 8:7336983-7337005 GGTGGGGGTGAGTTCTATAAGGG + Intergenic
1036347631 8:7978095-7978117 GGTGGGGGTGAGTTCTATAAGGG - Intergenic
1040957206 8:52991553-52991575 GTTGGGGGAAAGTTCTTGAATGG + Intergenic
1055360287 9:75482522-75482544 GATGGGGGACAGAATATTAAAGG + Intergenic
1059341728 9:113601196-113601218 GGGAGGGGACAGTAGGTTAAGGG - Intergenic
1059366648 9:113791611-113791633 GCTGGGGCACAGTCCTTTCATGG + Intergenic
1190291358 X:48994620-48994642 GTTGAGGGATACTACTTTAAAGG - Intronic
1193750904 X:85342309-85342331 CTTTGGGGAAAGTACTTTAAAGG + Intronic
1196783274 X:119400995-119401017 GGTGGGGGGCAGAACTTCAAAGG + Intronic
1197750419 X:129960064-129960086 GGTGGGAGACAGGACCCTAATGG - Intergenic