ID: 1115378433

View in Genome Browser
Species Human (GRCh38)
Location 14:32705341-32705363
Sequence CATTGGGAAGGGAAGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 2, 2: 3, 3: 59, 4: 575}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115378433 Original CRISPR CATTGGGAAGGGAAGAGAGT GGG Intronic
900908633 1:5578402-5578424 CAGTGGGAGGGGGAGAGAGAGGG - Intergenic
901054324 1:6441705-6441727 CAATAGGCAGGGAAGAGAGTGGG + Intronic
901237190 1:7673437-7673459 CCTTGGGAAAGGAAGAGCGAAGG - Intronic
902081484 1:13823872-13823894 CCTTGGGAAGGGCAGGGAATGGG + Exonic
902362192 1:15948004-15948026 CATTGGGAGGGGCAGAGAGTAGG - Intronic
902479984 1:16706629-16706651 CAATAGGCAGGGAAGAGAGTGGG - Intergenic
902710456 1:18235978-18236000 CATGTGGAAGGGATGAGAGAAGG + Intronic
902718656 1:18290015-18290037 CATGGGGTGGAGAAGAGAGTTGG - Intronic
903092003 1:20928885-20928907 GGTTGGGGAGAGAAGAGAGTGGG - Intronic
903190717 1:21654074-21654096 CATTGGCAAGGGATGGGGGTGGG + Intronic
903832257 1:26182409-26182431 CTGTGGGGTGGGAAGAGAGTGGG + Intronic
904055414 1:27666865-27666887 CAATGGGAGGGGAAGAGTGTGGG - Intronic
904123126 1:28216249-28216271 CCTTGGGAAGTTATGAGAGTGGG - Intronic
904123286 1:28217521-28217543 CCTTGGGAAGTTATGAGAGTGGG - Intronic
904123445 1:28218806-28218828 CCTTGGGAAGTTATGAGAGTGGG - Intronic
904198017 1:28800539-28800561 CCTTGGGAAGGGCAGACATTGGG + Intergenic
905026233 1:34851785-34851807 CATTGGGCTGGGAAGAGACGGGG + Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
906097644 1:43235036-43235058 AGTTGGGAATGGAAGAGAGAAGG - Intronic
906220187 1:44072214-44072236 CACTGAGATGGGAAGATAGTGGG + Intergenic
906560370 1:46752251-46752273 GATTGGGAAGGGAAGGGAGGAGG + Intergenic
906822156 1:48940966-48940988 AATTGGGAAAGGAGGGGAGTGGG + Intronic
906949670 1:50323999-50324021 TATTGGGAGTGGAATAGAGTGGG - Intergenic
907283796 1:53367793-53367815 CATGGGGATGGGAAGTGACTGGG - Intergenic
908483965 1:64572202-64572224 AATTGGGAAGAGGAGAGAGCAGG - Intronic
908963980 1:69735801-69735823 GATAGGGAGGGGAAGGGAGTGGG - Intronic
908994539 1:70135480-70135502 CTGTGGGAAGAGAAGAGAGCAGG + Intronic
910688713 1:89943927-89943949 CAATGGAAAGGGAAGAAGGTAGG - Intergenic
911044670 1:93618464-93618486 AATTGGTAAGGGAAGACAGAAGG - Intronic
911656936 1:100454505-100454527 CATGGGGAAGGGAAGAAAATGGG + Intronic
912509434 1:110178517-110178539 CTTTGGGAAGGGAAGGGAATGGG - Intronic
912804973 1:112748506-112748528 TATTGGGAAGAGAAGGGAGGAGG - Intergenic
912806095 1:112758274-112758296 CCTTAGGAAAGGAAGAAAGTAGG - Intergenic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
913522269 1:119656124-119656146 CACTGTGCAGGGAAGAGAGCAGG - Intergenic
914747852 1:150512592-150512614 TTTCGGGAAAGGAAGAGAGTGGG - Intronic
914750340 1:150530780-150530802 AATTGGGAAGGGAAGGGCGAGGG - Intergenic
915285284 1:154848336-154848358 CAGTGGGAAGGGAAGATATGGGG - Intronic
915541089 1:156566679-156566701 CAATGGGCAGAGAAGGGAGTTGG - Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915924187 1:160003819-160003841 CATAGGGAAGGGAAGTGTGCTGG + Intergenic
916328413 1:163589401-163589423 GATTGGGTAGAGAAGTGAGTAGG - Intergenic
916463353 1:165048642-165048664 CATTGGCAAGGCCAGAGAGCGGG - Intergenic
916798455 1:168190193-168190215 AACTGGGAGGGGAAGGGAGTTGG - Intronic
919079402 1:192851744-192851766 CAAAGAGAAGGAAAGAGAGTAGG - Intergenic
919271657 1:195356336-195356358 CATTGGGAAGGTATCAGAGAAGG + Intergenic
919346328 1:196384325-196384347 CATTGGTAAGGGAAGAGTATGGG - Intronic
920956538 1:210624831-210624853 CACTGGGCAGGGAACAGAGCAGG - Intronic
921036767 1:211386998-211387020 CATTTGTGAGGGAGGAGAGTGGG - Intergenic
922000542 1:221473365-221473387 CCTTGGGACTGGAAGAGAGGAGG + Intergenic
922413479 1:225397800-225397822 CTTTGGGAGGCGAAGAGAGACGG + Intronic
923017826 1:230140391-230140413 CACTGGGAAGGGCAGGGACTTGG - Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
923603550 1:235423722-235423744 CAAATGGAAGGGAAAAGAGTCGG - Intronic
923659299 1:235944803-235944825 CATGGGGGAAGGAAGAGAGCTGG - Intergenic
923659373 1:235945177-235945199 CACTGGGATGGGATGGGAGTGGG + Intergenic
924352271 1:243127419-243127441 CATTGGGCAGAGTAGGGAGTTGG + Intronic
924484659 1:244469412-244469434 AATTCAGAAGGGAAGAAAGTGGG - Intronic
924715563 1:246570070-246570092 AATTTAGAAAGGAAGAGAGTAGG + Intronic
1062922871 10:1293127-1293149 CATAGGGAAGGAAAGAGAGAGGG + Intronic
1063333703 10:5188305-5188327 CACTGTGAAGGGAAAAAAGTAGG + Intergenic
1063620649 10:7645036-7645058 CATGAGGAAGGGGAGAGAATGGG + Intronic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1063930200 10:11020174-11020196 CATTTGGAAGAGAAGTGAGGTGG - Intronic
1064189531 10:13193632-13193654 CTTTGGGAAAGTAAGAGAATGGG + Intronic
1064392593 10:14954480-14954502 AATTGGGAACAGAAGAGAGAGGG - Intergenic
1064979249 10:21149532-21149554 CTTTGGGAAGCCAAGAGAGGCGG - Intronic
1065239612 10:23693366-23693388 TAATGGAAAGGGTAGAGAGTGGG - Intergenic
1065385528 10:25129938-25129960 AACTGGGAAGGGAAGAGACATGG + Intergenic
1065520320 10:26565795-26565817 TATGGGGAAGAGGAGAGAGTTGG + Intronic
1065687303 10:28299353-28299375 CCTGGGGAGAGGAAGAGAGTTGG + Intronic
1066021191 10:31304166-31304188 GATGGGGAGGGGAGGAGAGTGGG + Intergenic
1066125260 10:32335535-32335557 CAATGGGAAGCAAGGAGAGTGGG - Intronic
1067190282 10:44062782-44062804 CACTAGGAAGGGATGAGAGTTGG - Intergenic
1067196619 10:44125451-44125473 CATAAAGAAAGGAAGAGAGTTGG + Intergenic
1067551871 10:47242047-47242069 CCTGGGGAGGGGAAGAGAGCAGG + Intergenic
1067568696 10:47356083-47356105 CACTGGGCAGGGAAGATAGATGG - Intronic
1069352328 10:67543883-67543905 TATTTGGCAGGGAAGAGAGGAGG + Intronic
1069635740 10:69923780-69923802 CCTGGGGAAGAGGAGAGAGTTGG - Exonic
1069896547 10:71683686-71683708 CAAAGGGAAGGGCAGAGAGTTGG + Intronic
1070358019 10:75659293-75659315 CAAAGGGAAGGGAAGAAAGCTGG - Intronic
1070380933 10:75879581-75879603 CTGGGGGAAGGGAAGAGACTGGG + Intronic
1070392722 10:75985169-75985191 AAATGGGAAAGGAAGTGAGTAGG + Intronic
1070719184 10:78744690-78744712 CATGGGAAAGGGAAGAAAGCAGG + Intergenic
1071188272 10:83069514-83069536 AAGTGGGAAAGGAAGAGAGAGGG + Intergenic
1071370837 10:84950100-84950122 CATTGGACAGGCAAGACAGTAGG - Intergenic
1071516458 10:86300916-86300938 GAATGGGAAGGGCAGAGAGTGGG + Intronic
1071588323 10:86846851-86846873 CAGTCTGAATGGAAGAGAGTGGG - Intronic
1071922166 10:90362739-90362761 CAGTGAGAAGGGAATAGATTTGG - Intergenic
1072050206 10:91696543-91696565 GCTGGGGAAGGGAAGAGAGAGGG + Intergenic
1072054591 10:91741448-91741470 CATGCCAAAGGGAAGAGAGTAGG + Intergenic
1073059953 10:100727761-100727783 GATTTGCAAGGGAAGAGAGTTGG + Intergenic
1074176437 10:111009301-111009323 CCTTAGGAAGTTAAGAGAGTTGG + Exonic
1074794849 10:116932464-116932486 GACTGGGGAGGGAAGAGGGTGGG - Intronic
1075225876 10:120628514-120628536 CAGGGGCAAGGGAAGAGAGGTGG - Intergenic
1075879373 10:125837186-125837208 CTTTGGGTAGGGGAGAGAGGGGG + Intronic
1076120792 10:127935196-127935218 CAGTGGGAGGGGCAGAGAGCGGG - Intronic
1076145423 10:128115438-128115460 CAAGGGGAAGGGAAGAGACGTGG - Exonic
1076168351 10:128300328-128300350 CAATGGGAAGGTCAGAGAGGTGG + Intergenic
1076765867 10:132632752-132632774 AATTAGGAAGGGATGAGTGTGGG - Intronic
1076930027 10:133525939-133525961 CACTGGAAAGGAAAGAGAGGAGG + Intronic
1077516047 11:3002772-3002794 CAAAGGGAATGGAAGAGGGTCGG - Intronic
1078450190 11:11435250-11435272 AAGTAAGAAGGGAAGAGAGTAGG - Intronic
1078759108 11:14237410-14237432 CATGGGGGAGGGAGGAGAGAAGG + Intronic
1078974593 11:16458146-16458168 GATTGGGAAGGAAAGAGAGGTGG - Intronic
1079085079 11:17439588-17439610 CAGTGGGAGGGGGAGAGAGACGG - Intronic
1079664377 11:23085068-23085090 TATTGGGAATGGAAGAGAGTTGG + Intergenic
1079986910 11:27209408-27209430 CATTGGGAAGGGAAGATTAAAGG - Intergenic
1080783328 11:35451172-35451194 CATTTGGAAAGTAACAGAGTGGG - Intronic
1081579454 11:44342161-44342183 CATTGTAAAGTGAAAAGAGTAGG + Intergenic
1081677325 11:44978127-44978149 CAGTGGGGATGGCAGAGAGTGGG + Intergenic
1081841004 11:46201399-46201421 CCTGGGGAAGGCAAGAGACTGGG - Intergenic
1082187694 11:49204457-49204479 TATTGGGAAAGGAAGAAAGCTGG + Intronic
1082649816 11:55776006-55776028 TATAGGGAAGGGAAAAGAGTAGG + Intergenic
1083312083 11:61789051-61789073 AATGGGAAAGGGAAGAGATTGGG + Exonic
1083367293 11:62148889-62148911 TACTGGGAAGAGAATAGAGTGGG - Intronic
1083995504 11:66269602-66269624 GATTGGGAGGGGAACAGAGAAGG + Intronic
1084112874 11:67024818-67024840 CAATGGGAAGGGTCGGGAGTTGG - Intronic
1085156366 11:74298668-74298690 CACAGGGAAGGGAGGAGACTTGG + Intronic
1085263658 11:75223826-75223848 CAGAGGGAAGGGAAGAGGTTTGG - Intergenic
1085266174 11:75239446-75239468 CAGGGGGTAGGGAAGAGAGAGGG + Intergenic
1085282786 11:75341848-75341870 GGGTGGGAAGGGAAGACAGTTGG - Intronic
1085331337 11:75654346-75654368 CACTGGGAAGGAAAAAGATTAGG - Intronic
1085611123 11:77950415-77950437 CACTGGGGAGGGGAGGGAGTAGG + Intronic
1085937320 11:81163856-81163878 CATGGGGTAGGGAAGAGAAAAGG + Intergenic
1086203566 11:84232621-84232643 CATAGAGAAGAGCAGAGAGTGGG - Intronic
1086483245 11:87268122-87268144 GAGAGGGAAGGGAAGAGAGGGGG - Intronic
1086678624 11:89640940-89640962 TATTGGGAAAGGAAGAAAGCTGG - Intergenic
1087094009 11:94303241-94303263 CATTGATAAGGTAAGAGATTTGG - Intergenic
1087644627 11:100793745-100793767 GATGGGGAAAGGAAGTGAGTAGG + Intronic
1088654736 11:111988385-111988407 CAATAGGAAGAGAAGAGATTGGG + Intronic
1089203991 11:116743570-116743592 CCTTGGGAAGGCGAGACAGTAGG + Intergenic
1089250609 11:117157757-117157779 CTTTGGGAAAAAAAGAGAGTAGG + Intronic
1089615145 11:119690923-119690945 CATTGGCCAGGGGAGAGAATCGG - Intronic
1089724364 11:120462256-120462278 CCAAGGAAAGGGAAGAGAGTTGG + Intronic
1090887408 11:130891363-130891385 CCTCTGGAAGGGAAGAGAGCTGG + Intronic
1091049321 11:132353238-132353260 CATTGGTCAGGGAAGGGTGTGGG + Intergenic
1091192631 11:133707530-133707552 GAAAGGGAAGGGAAGAGAATAGG + Intergenic
1091221237 11:133931144-133931166 CAAGGGGCAGGGAAGAGGGTGGG + Intronic
1091266186 11:134272942-134272964 CCTTGAGAAGGTAAGAGAGGAGG - Intergenic
1092077582 12:5686163-5686185 CAGAGGGAAGTGGAGAGAGTGGG - Intronic
1092255717 12:6925953-6925975 AATTGGGAAGGCCAGAGAATGGG - Intronic
1093018941 12:14185449-14185471 AATGTGGAAGGGAAGAGAGAAGG + Intergenic
1093902412 12:24651054-24651076 GGTTGGGAAGGGAAGTGGGTGGG - Intergenic
1094483158 12:30901082-30901104 CATTGACAAAGGAAGAGAGTTGG + Intergenic
1095633892 12:44408670-44408692 CACTGGGAAAGGAAGCTAGTAGG + Intergenic
1096539138 12:52294470-52294492 CATGGGGAAGGGAGGAGGGGAGG + Intronic
1096606062 12:52767379-52767401 CATTGATCAGGTAAGAGAGTGGG - Intergenic
1096772736 12:53946351-53946373 CAGTGGGAAGGGAAGAGGCAAGG - Exonic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097261920 12:57725285-57725307 AATTGGGGAGGGGAGAGAGGTGG - Intronic
1097282685 12:57854383-57854405 CATTTGGAAGGGAGAAGAGGAGG + Intergenic
1097781705 12:63714220-63714242 CATTGCAAAGGGCAGAGAGAAGG - Intergenic
1097881635 12:64691668-64691690 GGATGGGAAGAGAAGAGAGTTGG + Intronic
1097881644 12:64691700-64691722 GGATGGGAAGAGAAGAGAGTTGG + Intronic
1097990050 12:65824836-65824858 GCTTGGAAAGGGAAGAGACTTGG - Exonic
1098397457 12:70036209-70036231 CTTTGGGAAGAGAAAAGAGCGGG - Intergenic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1099924153 12:88997009-88997031 CATTGGAAAGGGAAAAGAGAGGG + Intergenic
1100289830 12:93202914-93202936 CATGAGGAAGGGAGGAGGGTGGG + Intergenic
1100717879 12:97324860-97324882 CATTTAGAAGAGAAAAGAGTGGG - Intergenic
1100724447 12:97394209-97394231 AATACAGAAGGGAAGAGAGTGGG - Intergenic
1100896179 12:99185555-99185577 CATTGGGACGGTTAGACAGTGGG + Intronic
1101111048 12:101486206-101486228 CATTCGTAAGGGCAGTGAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101823736 12:108204311-108204333 GAGAGGGAAGGGAAGAGAGGGGG - Intronic
1102490120 12:113285617-113285639 CTTTGGGAAGCCAAGAGAGGAGG - Intronic
1102556470 12:113729952-113729974 TATTTGGGAGGGAAGAAAGTGGG - Intergenic
1102786114 12:115606342-115606364 CAGGGGGAAGGGGAGAGAGGAGG + Intergenic
1103403912 12:120661375-120661397 CATGGGGAAGGGATGGGAGATGG - Intronic
1103794551 12:123494415-123494437 AATGGGGCAGGGAAGAGAGGAGG - Intronic
1104739134 12:131159855-131159877 CTTTGGGAAAGGGAGAGGGTGGG - Intergenic
1105860707 13:24409491-24409513 GATAAGGAAGGGAAGAAAGTAGG + Intergenic
1106180963 13:27369036-27369058 AATGGGGAAGGGGTGAGAGTAGG + Intergenic
1106208680 13:27621564-27621586 CACTGGGAAGGGAAGTGATTTGG + Exonic
1107099517 13:36574738-36574760 CATTTGGTATGGAAGAAAGTAGG - Intergenic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1107488365 13:40854448-40854470 GATAAGGAAGGGAAGAAAGTAGG - Intergenic
1107960682 13:45555341-45555363 CATTGAGAAGGGAAGTCTGTGGG - Intronic
1108359352 13:49654969-49654991 CAGTAGAAAGGGAAGAGAGAAGG + Intergenic
1108628182 13:52253532-52253554 GATAAGGAAGGGAAGAAAGTAGG - Intergenic
1108657877 13:52552917-52552939 GATAAGGAAGGGAAGAAAGTAGG + Intergenic
1110075751 13:71240038-71240060 CATTGTTAAGGGAAGTGAGATGG - Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1110481335 13:75980982-75981004 CATTCCAAAGGGAAGAAAGTTGG + Intergenic
1111974387 13:94950686-94950708 CAATGGGAAAGGAATAGAATGGG + Intergenic
1112840548 13:103572262-103572284 CTTAGGAAAGGGAAGAGAGGTGG - Intergenic
1112920535 13:104606069-104606091 GATGGGGAAGGGAATAGAGTGGG + Intergenic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1115633147 14:35265535-35265557 CAGTGGGAAGTGGAGAGAATGGG + Intronic
1116631858 14:47345926-47345948 GGTTGGGAAGGGAAGAGGGAAGG + Intronic
1118063607 14:62166927-62166949 CATAGAGAAGGGAACAGAGCAGG + Intergenic
1118361584 14:65061837-65061859 CATTTGTAAGGGAAAAGAGCTGG + Exonic
1118374718 14:65166872-65166894 GAGTGGAAAGGAAAGAGAGTTGG + Intergenic
1118570657 14:67191499-67191521 CATTGGGAAGGGGAGAGAGTGGG - Intronic
1118583902 14:67332800-67332822 CATTGAGAAGACAAGAGAGATGG + Exonic
1118761823 14:68884882-68884904 CACTGGGGAGGGAAGAGACAAGG + Exonic
1118921941 14:70157374-70157396 GATGGGGAGGGGAAGAGGGTGGG + Intronic
1118923529 14:70171233-70171255 CATGGGGGAGAGAAGAGAGCCGG + Intronic
1119621400 14:76134607-76134629 GATGGAGAAGGGGAGAGAGTCGG - Intergenic
1119635927 14:76273389-76273411 CATTGGGGAGGCTGGAGAGTGGG + Intergenic
1119673843 14:76539191-76539213 CAAAGGGAAGGGAAGGGAGGGGG - Intergenic
1119728298 14:76935591-76935613 AAGTGGGAAGGGAAGGGAGGGGG - Intergenic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1121954998 14:98205532-98205554 GGTTGGGGAGGAAAGAGAGTTGG - Intergenic
1122321104 14:100856358-100856380 CATTGGAGAGGAAGGAGAGTAGG + Intergenic
1122622201 14:103065788-103065810 CATTGGGAAGGGGAGGGAGGAGG - Intergenic
1123126862 14:105953001-105953023 AGTTGGGAAGGAAAGACAGTGGG + Intergenic
1125025971 15:35029733-35029755 CATTGAGAAGATAAGAGAGCCGG - Intergenic
1125475800 15:40047401-40047423 CCTTGGGAAGGGAAGGGCCTGGG + Intergenic
1125503638 15:40254089-40254111 CATTTGGAACCGAAGAGAGTGGG + Intronic
1125737214 15:41935093-41935115 CATTGGCAAAGGCAGAGAGTAGG - Intronic
1126684129 15:51232551-51232573 GTTTGGGAAGGGGAGAGATTAGG - Intronic
1126741900 15:51785665-51785687 GCCTGGGAAGGGAAGGGAGTAGG + Intronic
1127112310 15:55687948-55687970 CAGAGGGGAGGGAAGAGATTGGG - Intronic
1127663007 15:61118179-61118201 TATTGGAAAGGAAAGAGGGTAGG + Intronic
1127669940 15:61185765-61185787 CATGGGGAAGAGATGAGATTAGG - Intronic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128081060 15:64857127-64857149 AAGTGGGAGGGGAAGAGAGGAGG - Intronic
1128403818 15:67314366-67314388 GATTGGGAAGACAAGGGAGTTGG - Intronic
1128682094 15:69659783-69659805 CATTGGGAGGGCAAGAGTGAAGG + Intergenic
1128735772 15:70053195-70053217 CTTTGGGAAGGGAGGAGTCTTGG + Intronic
1129002416 15:72345761-72345783 CTTTGAGAGAGGAAGAGAGTGGG - Intronic
1129016865 15:72475433-72475455 CTTTTGGAAGGGATTAGAGTAGG + Intronic
1129178297 15:73855693-73855715 CATGGGGAAGGGAAGTGTTTTGG + Intergenic
1130361066 15:83186722-83186744 GATTCAGAAGGGAAGAGGGTGGG + Intronic
1130884330 15:88080849-88080871 CATTGGGAAGGAAGGAAAGTGGG + Intronic
1131320651 15:91386925-91386947 GTTTGGGAAGGGTAGATAGTAGG - Intergenic
1131780063 15:95846327-95846349 CAGGGAGAAGGGAAGAGAGGAGG + Intergenic
1132772180 16:1569829-1569851 CATTGGGAGGCCAAGAGAGGTGG - Intronic
1134673848 16:16075675-16075697 CACAGGGAAGGGGAGAGTGTCGG - Intronic
1134887159 16:17803895-17803917 CATTTGGATGAGAAGAGAGAAGG + Intergenic
1136010565 16:27360849-27360871 CATTGGGAAGGTGATAGAATTGG + Intronic
1136070462 16:27784312-27784334 GATAGGGAAGGGGAAAGAGTTGG - Intergenic
1136735530 16:32462953-32462975 CATGGCAAAGGGAACAGAGTGGG - Intergenic
1138036611 16:53613558-53613580 CTTTGGGAAGCCAAGACAGTAGG - Intronic
1138222112 16:55260723-55260745 CTGTGAGAAGGGAAGACAGTAGG - Intergenic
1138959117 16:62007788-62007810 CTGAGGGAAGGAAAGAGAGTAGG - Intronic
1139080643 16:63515060-63515082 CATTTGAAAGGTAAGAGACTTGG - Intergenic
1139478326 16:67214390-67214412 CATCGGGAAGGGAGGAGACCAGG - Intronic
1140204975 16:72926332-72926354 ACTTGGGAAGGGGAGCGAGTGGG - Intronic
1140774089 16:78233972-78233994 CTTTGAGAATGGAAGAGAGCAGG - Intronic
1140899876 16:79357791-79357813 CACTGGGCAGGGAGGAGAATGGG - Intergenic
1140948579 16:79794449-79794471 CATTTGGCAGAGAAGAGAGAAGG + Intergenic
1141110760 16:81269007-81269029 CTTTGGGAGGGGAAGGGAGGAGG - Intronic
1141225570 16:82111588-82111610 AATGGGGAGGGGAAGAGAGAAGG + Intergenic
1141816138 16:86410446-86410468 CATTGGGATGGGATGGGATTAGG + Intergenic
1142259066 16:89033953-89033975 CACTGGTGAGGGAAGAGACTTGG + Intergenic
1142542542 17:671601-671623 CATGCGGAGGGGAAGAGTGTTGG - Intronic
1143015077 17:3887359-3887381 CATGGAGAAAGGAAGAGAGGAGG + Intronic
1143134343 17:4703176-4703198 GATGTGGAGGGGAAGAGAGTGGG - Intronic
1143253741 17:5540820-5540842 CCTTGGGAAGGGCAGAGGTTTGG + Intronic
1143691245 17:8568011-8568033 CAGGGGGAAGGGGAGAGGGTTGG - Intronic
1143720001 17:8802828-8802850 GAGTGGGAAGGGAAGAGACTTGG + Exonic
1143887489 17:10076074-10076096 CCTTGGGAAGGGAAGAGGGAAGG + Intronic
1144396677 17:14850761-14850783 TCTTGGGAAAGGAAGAGACTGGG + Intergenic
1144402440 17:14919195-14919217 AACTGGGATGGGAAGAGAGGGGG - Intergenic
1144813024 17:18013630-18013652 GACTGGGAAGGGTAGAGAGATGG + Intronic
1144858240 17:18282795-18282817 CTTTGGGAATGGGACAGAGTTGG - Exonic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1146054374 17:29573868-29573890 CATAGAGAAGGGGCGAGAGTGGG + Exonic
1146612174 17:34316790-34316812 AATTAGGAAGGGAGGAGAGGGGG - Intergenic
1147000777 17:37360155-37360177 CATTGCGTAGGGAAGAAACTTGG + Intronic
1147016609 17:37497058-37497080 CAGTGGGAAGGGAAGAGAAATGG - Intronic
1147453857 17:40522387-40522409 AATGGGTGAGGGAAGAGAGTGGG + Intergenic
1147978485 17:44261042-44261064 CACTGGGGAGGGAAAGGAGTGGG + Intronic
1149131940 17:53313296-53313318 TGTTGGAAAGGGAAGAGAGAAGG - Intergenic
1149393742 17:56218220-56218242 CATAGGGGAGGGAAGAGGGGAGG - Intronic
1149764352 17:59262551-59262573 CTTAGGGTAGGGTAGAGAGTGGG + Intronic
1149853016 17:60052641-60052663 AATTGTGAAGGGAAAAGAATAGG + Intronic
1150203773 17:63384599-63384621 CACTGGGGAGGGAGGAGAATGGG - Intronic
1150955672 17:69856917-69856939 AAGTGGAAAGGTAAGAGAGTTGG - Intergenic
1150994154 17:70296822-70296844 GCTTGGGAAGGGAGGAGAGAGGG + Intergenic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151714518 17:75824711-75824733 CAGTGGGAAGGGCAGGGAGTGGG - Exonic
1152318954 17:79597311-79597333 CATTGGGAATGAGAGAGTGTTGG + Intergenic
1152939719 17:83161787-83161809 CAATGAGAAGGGAAGGGAGATGG - Intergenic
1152994646 18:395322-395344 TATGAGGAAGGCAAGAGAGTTGG + Intronic
1155645990 18:28078403-28078425 CAATGGGAAAGGTAGAGTGTTGG + Intronic
1155694365 18:28667505-28667527 CATGGTGAAGAGAAGACAGTGGG + Intergenic
1156036999 18:32775344-32775366 GGGTGGAAAGGGAAGAGAGTGGG + Intergenic
1156352364 18:36312031-36312053 CAGGGGGAAGGTAAGACAGTGGG - Intronic
1157937529 18:51889708-51889730 CTTTGAGATTGGAAGAGAGTTGG + Intergenic
1158608021 18:58913107-58913129 CAGTTGGAAGAGAAGAGAGAAGG + Intronic
1158619221 18:59016448-59016470 CTTTGGGAAGGCAAGACAGGTGG - Intergenic
1158796607 18:60853947-60853969 TGTTAGGAAGGGAAGAGACTGGG + Intergenic
1158847938 18:61464369-61464391 CAGTGGGAAGGGGTGAGACTAGG - Intronic
1159855527 18:73583126-73583148 CTTTGGGAAGGGAGGTGAGTAGG + Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1162118873 19:8449464-8449486 TATTGAGAAGGGTAGAGAGGGGG - Intronic
1163787210 19:19280974-19280996 CTCTGGGAAGGGAAAAGATTTGG + Intronic
1164834299 19:31347970-31347992 AAGAGGGAAGGGCAGAGAGTAGG - Intronic
1165025608 19:32959083-32959105 CATGGGGCAGGGATGGGAGTAGG - Intronic
1165331598 19:35143445-35143467 CAATGGTAAGGCAAGGGAGTTGG + Intronic
1165505127 19:36222165-36222187 CTTTGGGAAGCCAAGAGAGGAGG - Intronic
1165636441 19:37344180-37344202 CATAGGGGAGGGAGGAGAGAGGG + Intronic
1166387707 19:42391363-42391385 AATTGGGAAGGGAGGAGGCTGGG + Intergenic
1166672377 19:44718737-44718759 CACTGGGGAGGGCAGGGAGTCGG + Intergenic
1166684805 19:44789981-44790003 CTGGGGGAAGGGAAGAGAGGGGG - Intronic
1166816372 19:45548606-45548628 CATAGGGTGGGGCAGAGAGTGGG + Intronic
1167125938 19:47548749-47548771 CAGAGCGCAGGGAAGAGAGTGGG - Intronic
1167274011 19:48524205-48524227 CATTGGGAAGTGAAGACTATGGG + Intergenic
1167284781 19:48592871-48592893 CCTCGGGAAGGGGAGAGTGTGGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167702792 19:51060390-51060412 CATGGGGTAGGGATGAGAATGGG - Intronic
1168414393 19:56159499-56159521 CATTGGGGTGGGAAGAGGGCTGG - Intronic
1202714021 1_KI270714v1_random:32535-32557 CAATAGGCAGGGAAGAGAGTGGG - Intergenic
925151011 2:1614973-1614995 AATTTGGAAGGGGAGGGAGTGGG + Intergenic
927409466 2:22807672-22807694 CATTGGGAAGTGATTAGACTTGG - Intergenic
927889909 2:26741763-26741785 CCTTAGGAAGGGGAGGGAGTGGG + Intergenic
928055605 2:28051076-28051098 GATTGGGAACTGAAGAGAATGGG - Intronic
928468783 2:31552350-31552372 CATTAGGAGGGGAAGAGAAGTGG + Intronic
931289897 2:60863236-60863258 CATTGGGAAGGAGAGTGAGAGGG + Intergenic
931907605 2:66859249-66859271 CATTGGGCAGGGAAGTTTGTGGG - Intergenic
931946272 2:67311986-67312008 CATGGGAAAGGTAACAGAGTGGG + Intergenic
931957062 2:67439345-67439367 CTTTAGGGAGGGAGGAGAGTAGG - Intergenic
932231567 2:70087827-70087849 CATTGGGAAGAAAGGGGAGTCGG + Exonic
932650165 2:73546902-73546924 CACTGGGCATGGGAGAGAGTTGG + Intronic
932825973 2:74940544-74940566 CAGGGGGATGGGAAGAGAGATGG - Intergenic
933595333 2:84277754-84277776 CAATGGAAAGGCAAGAGAGCAGG - Intergenic
934122347 2:88852601-88852623 AATTGGGAAGGGCAGGGAGGAGG - Intergenic
934989807 2:98913335-98913357 GGGTGGGAAGGGAAGAGAGCTGG + Intronic
935830899 2:106999850-106999872 CAGTTGGTAGGGGAGAGAGTTGG + Intergenic
936380939 2:111985341-111985363 ACCTGGGAAAGGAAGAGAGTGGG + Intronic
936868636 2:117107486-117107508 CAATGGGAAGGGGACAGAGTTGG - Intergenic
936898548 2:117457418-117457440 GACTCGGAAGGGGAGAGAGTGGG - Intergenic
937409962 2:121665911-121665933 CAGTGGGGAGGGAAGAAAATGGG - Intergenic
938444203 2:131364777-131364799 CATTGAGAAGTGGAGAGTGTAGG + Intergenic
938827284 2:135018581-135018603 CTTTGGGAAGCCAAGACAGTAGG - Intronic
938848910 2:135240096-135240118 CATTGGGAAGCCAAGACAGGAGG + Intronic
939702567 2:145411786-145411808 CATTGGGGAGGAAAGACTGTAGG + Intergenic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942184251 2:173408982-173409004 CAGTGGGAGGGCAAGAGAGTGGG + Intergenic
942450655 2:176106481-176106503 CAGAGAGAAGGGAAGAGAGCCGG + Intronic
942541300 2:177017955-177017977 CATGGAGTAGGGAAGAGATTTGG - Intergenic
945042193 2:205751791-205751813 CCCTGGGAAGGGAAGTGAGAAGG + Intronic
945695911 2:213104558-213104580 AATAGGGAAAGGAAGAGAATGGG + Intronic
945912599 2:215666750-215666772 CCTTGGGAAGGGAAGTAAGAAGG - Intergenic
946400073 2:219463876-219463898 CTTTGGGAAGCCAAGAGAGGAGG + Intronic
946411356 2:219516828-219516850 CATTGTGCAGGGAGAAGAGTCGG + Intronic
946766617 2:223046544-223046566 AAGTGGGGAGGGAAGAGAGATGG - Intergenic
946961852 2:224993717-224993739 CATTGGGTAGGGGACAGAGTGGG - Intronic
947144902 2:227055623-227055645 CAGGGGGTAGGGATGAGAGTGGG + Intronic
947239430 2:227978173-227978195 CACTGTGAAAGGAAGACAGTGGG + Intergenic
947544521 2:231001426-231001448 GATTGGGTAGGGAAGAGGCTGGG - Intronic
947815184 2:233032079-233032101 CAGTGGGAAAGGAAGAGACAGGG - Intergenic
948621998 2:239241255-239241277 AACTGGGAGGGGAAGGGAGTGGG + Intronic
1169058496 20:2643011-2643033 GATTGAGAAGGGAAGGGATTTGG - Intergenic
1169652519 20:7885424-7885446 AATTTGAAAGGGAAGAGTGTGGG - Intronic
1169857628 20:10120908-10120930 CATTGGCAAGGGTAGAGAATTGG + Intergenic
1170249269 20:14262295-14262317 AATTGGGAAGGTGAGAGAATAGG + Intronic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1171100576 20:22379803-22379825 CATAGGGAAGGAAATAGATTTGG + Intergenic
1172013592 20:31860729-31860751 CACAGGGAAGGGAAGGGAGTCGG + Intronic
1172630895 20:36377619-36377641 CAATGAGAAGGGCAGAAAGTGGG - Intronic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173465445 20:43277391-43277413 CCTTGGGAAGGGGAAAGAGAAGG - Intergenic
1174190341 20:48735849-48735871 CATAGGGTAGGGATGGGAGTGGG + Intronic
1174301886 20:49588376-49588398 AACTGGGAACTGAAGAGAGTTGG - Intergenic
1174701589 20:52614597-52614619 TATTGGAAAGGGAAGAGAAGGGG - Intergenic
1175284669 20:57830155-57830177 GCTTGTTAAGGGAAGAGAGTAGG + Intergenic
1176087118 20:63302792-63302814 CACTGGCAAGAGAAGAAAGTGGG - Intronic
1176289783 21:5037854-5037876 CAGTGGAGAGGGAAGACAGTGGG - Intronic
1176986458 21:15442957-15442979 CATGGAGATGGGAAGAGAGGGGG + Intergenic
1178526048 21:33330298-33330320 CATGGGGCAGGGGAGTGAGTGGG - Intronic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179215896 21:39366892-39366914 GAGAGGGAAGGGAAGAGAGGAGG - Intergenic
1179401553 21:41089312-41089334 CTTTGAGAAGGGTAGAGAGAGGG + Intergenic
1179580811 21:42343019-42343041 CTTTGGGAAGCCAAGAGAGGAGG - Intergenic
1179867447 21:44225733-44225755 CAGTGGAGAGGGAAGACAGTGGG + Intronic
1181112657 22:20611071-20611093 CATCTGGAAGGGCAGTGAGTTGG - Intergenic
1181156814 22:20927597-20927619 CATTGGGAAGCCAAGACAGGTGG + Intronic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1182086332 22:27563635-27563657 CCTTGGGGAGGGCAGAGAGGGGG - Intergenic
1182336776 22:29588830-29588852 CTTTGGGAAGGGAAGAGGGCAGG - Intergenic
1182362630 22:29755926-29755948 CAGTGGGATGGAGAGAGAGTGGG - Intronic
1182366250 22:29781354-29781376 CAGGGGAAAGGGAAGAGAGTAGG - Intergenic
1182457323 22:30460270-30460292 CATGGGGAAGGGAAGAGGCGTGG - Intronic
1182468123 22:30530833-30530855 CTCTGGGAAGGGCTGAGAGTAGG - Intronic
1182741415 22:32570668-32570690 CAGTGTGAAGGGACGTGAGTTGG + Intronic
1183078476 22:35441563-35441585 TATTGGGAAGTGGAGTGAGTGGG + Intergenic
1183759475 22:39802915-39802937 CACTGGCAATGGAAGAAAGTGGG - Intronic
1184459009 22:44626668-44626690 GGTGGGGAAGGGAAGAAAGTTGG - Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
951937940 3:28042864-28042886 CATTAGTAAAGGAAGACAGTAGG + Intergenic
952820376 3:37481213-37481235 CATTGGGAAGGAAAGAAACAAGG - Intronic
953371482 3:42392260-42392282 CATGGGGAATGGCAGAGTGTGGG + Intergenic
956178196 3:66493988-66494010 AAGAGGGAAGGGAAGGGAGTGGG + Intronic
956334046 3:68143657-68143679 CCTTGGGTGGGGAAGAGAGTGGG + Intronic
956991505 3:74771724-74771746 GATGGGGAAGGGAGGAGAGTGGG + Intergenic
957038926 3:75321174-75321196 CTTAGGGAGAGGAAGAGAGTGGG + Intergenic
957662939 3:83184458-83184480 GATTTGGGAGGGAACAGAGTTGG + Intergenic
958591640 3:96166230-96166252 AACTGGGAAGGGAAGAAATTAGG - Intergenic
958958011 3:100482166-100482188 CAATGAGAAGGGAGGAGAGCTGG - Intergenic
959197225 3:103199919-103199941 CATTGGGAAGGGAATGAACTTGG + Intergenic
959204257 3:103284545-103284567 AACTGGAAAGGGAATAGAGTGGG + Intergenic
959825020 3:110783901-110783923 CATTGGTAAGGGTGGAGAATTGG - Intergenic
960361604 3:116718854-116718876 CATAGGCAAGGCAAGGGAGTAGG - Intronic
960637174 3:119795296-119795318 CAGGGGGATGGGAAGAGGGTGGG + Intronic
960650488 3:119942864-119942886 TAATGGGAAGGTAAGAGAGGAGG + Intronic
961973166 3:130991587-130991609 AAATGGGAAGGGAAGAGAAGTGG + Intronic
962062556 3:131945665-131945687 AAGTGGGAAGAGAACAGAGTAGG - Intronic
962273759 3:133997042-133997064 CATTGGTAAGCCAAGACAGTCGG - Intronic
962353135 3:134670425-134670447 CAGTGTGAAGAGAACAGAGTGGG + Intronic
962423342 3:135247839-135247861 CATTTGGAAGAGAAGAGAAAGGG - Intronic
962538220 3:136350571-136350593 CTTTGAGCAGGGGAGAGAGTAGG - Intronic
962752271 3:138442049-138442071 CATGGGCAAAGGAATAGAGTGGG - Intronic
964088111 3:152842685-152842707 CTTTGGGAATGGAAGTGGGTAGG + Intergenic
965268790 3:166585688-166585710 CTTTGGGAGGGGAAGAAACTTGG - Intergenic
965447364 3:168791673-168791695 GACTGGGAAGGGAAGAGGGATGG + Intergenic
967241869 3:187447360-187447382 CAGTGAGAAGGGGAGAGAGCTGG + Intergenic
967364343 3:188669098-188669120 AATTGAGAAGGGAAGTGAGTGGG + Intronic
967605636 3:191442361-191442383 CATTGAAAAGGGAGGAGATTTGG + Intergenic
968186680 3:196637596-196637618 CATTGGACAGGGATGAGATTAGG + Intergenic
969361969 4:6670226-6670248 CATTGGTAAGGGAAGAATGAAGG + Intergenic
969487173 4:7478771-7478793 CACTGGGAAGGGGACAGAGTGGG + Intronic
969857937 4:10014937-10014959 CATAGGGAGGGGAAGAGTTTGGG + Intronic
969987669 4:11228127-11228149 TAATGGGAAGGGAGGAGAGCAGG + Intergenic
971314201 4:25553624-25553646 CATTTGTAAGGGAGGAGAGGAGG + Intergenic
972428933 4:38961781-38961803 GGTTGGGAAGGGTAGAGAGAGGG - Intergenic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
973090492 4:46130008-46130030 CATTGAGAAGAGGAGAGAGCTGG - Intergenic
973957913 4:56081565-56081587 CATTGGTAAGGGAAGACTGTGGG + Intergenic
974580435 4:63792930-63792952 CAATGAGAAGTGAAGAGAATCGG - Intergenic
974752822 4:66163796-66163818 AATTGGGTTGGGAAGAGAGAGGG - Intergenic
975612025 4:76213221-76213243 CACTGTAAAGGGAACAGAGTCGG + Intronic
975823317 4:78293634-78293656 CATTCAGAAGGGAAGACAATAGG + Intronic
976105004 4:81606916-81606938 CCTTGGGAAGGGAGGAGAACTGG + Intronic
976357425 4:84135364-84135386 GATTGGGAGGTGAACAGAGTAGG - Intergenic
978701642 4:111653644-111653666 AATAGGGAAGGGAGGAGAGGGGG + Intergenic
978900769 4:113947235-113947257 CATTGGGAAGCCAAGGGAGGAGG + Intronic
979249673 4:118553106-118553128 CATTGGGCAGAGTAGGGAGTTGG - Intergenic
980244780 4:130224620-130224642 CAGTGGGAAGGGAACAGTGTTGG + Intergenic
981295282 4:143124456-143124478 TGAAGGGAAGGGAAGAGAGTGGG - Intergenic
981651316 4:147062251-147062273 CATGGGGGTGGGGAGAGAGTGGG - Intergenic
981938526 4:150257999-150258021 CAGCAGGAAGGGCAGAGAGTTGG + Intergenic
982445803 4:155489498-155489520 TAGTAGGAAGGGAAGAAAGTGGG + Intergenic
983826468 4:172268340-172268362 GATTGGGAAGAGCAGAAAGTTGG + Intronic
986503922 5:8429929-8429951 CTTTGGGAACGGAAGAGTGCAGG - Intergenic
986639347 5:9857135-9857157 GGTTGGGAAGGGAAGTGAGAAGG + Intergenic
987000372 5:13654165-13654187 CTTTGGGAAGCCAAGGGAGTTGG + Intergenic
987231456 5:15897864-15897886 CAATGGGAATGGACTAGAGTTGG + Intronic
989223213 5:38993449-38993471 CATTGGAAGGGGGAGAGAGAAGG + Intronic
990217508 5:53550426-53550448 CTTTGGGAAGCCAAGATAGTTGG - Intergenic
990842013 5:60092284-60092306 CATTGGGAAGGGAAGCAGGGAGG + Intronic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
991068269 5:62447828-62447850 CTTTGGGAGGCCAAGAGAGTTGG - Intronic
991546888 5:67792210-67792232 GAGTGGTAAGGGCAGAGAGTTGG + Intergenic
991646676 5:68807978-68808000 GAGTGGGAAGGGAAGGGAGGGGG + Intergenic
991985483 5:72281618-72281640 CAGTGGGGAGGGAAGAGCATAGG + Intronic
994116719 5:96069742-96069764 CATTGGGAAGTGAAGGCAGGAGG - Intergenic
994480299 5:100326079-100326101 GATTGGTAAGGGAAGAGAGAAGG + Intergenic
995175912 5:109176471-109176493 GACTGGGAAGGGTAGAGAGGTGG + Intronic
996354886 5:122584828-122584850 GAGTGGGAAGGGAAGGGGGTTGG + Intergenic
996387536 5:122925098-122925120 AAAGGGGAAGGGAAGAGAGAGGG - Intronic
996462141 5:123758097-123758119 CATTGGGAAGGGTAGTAGGTAGG - Intergenic
996497768 5:124181418-124181440 CCTTGGTAGGGAAAGAGAGTGGG - Intergenic
997119441 5:131158925-131158947 AATTTGGAAGGGATGAAAGTAGG - Intergenic
997255286 5:132423670-132423692 CATTAGGGAGAGAGGAGAGTGGG + Intronic
997604482 5:135164198-135164220 GGTTGGGGAGGGAAGAGAGGAGG + Intronic
997886697 5:137636981-137637003 GTTGGGGAAGGGAAGGGAGTAGG - Intronic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
999594282 5:153184805-153184827 CATTGGGAAGTGAAGAGAAAGGG + Intergenic
1000486772 5:161855794-161855816 CATAGGGTAGGGAGGAGATTAGG - Intronic
1000817021 5:165936162-165936184 CAGTGTGAAGGGAAGAGAAGAGG + Intergenic
1001085508 5:168697412-168697434 CATGCGGAAGGGATGGGAGTCGG + Intronic
1001170298 5:169413173-169413195 CACTGGGATGGGTAGAGAGTTGG + Intergenic
1001253509 5:170166485-170166507 CAAGGGGAAGGGAAGGGAGAGGG + Intergenic
1001766832 5:174255703-174255725 TATTAGGAAGGGAGGAGGGTGGG + Intergenic
1001809502 5:174617203-174617225 CTTTGGGAAGCCAAGAGAGGCGG - Intergenic
1002365832 5:178710071-178710093 AATTGGGAAGGGGATGGAGTTGG - Intergenic
1002442086 5:179269801-179269823 CCTTGGGAAGGGCAGAGAACAGG + Intronic
1002586184 5:180250118-180250140 CACTGGGGAGGGAAGAGAGGTGG - Intronic
1002990988 6:2238553-2238575 CAGTGGGAAGGAATGAGAGAAGG - Intronic
1003121802 6:3324181-3324203 AACTGGGAAGGGAAGTGAGACGG + Intronic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003647131 6:7922065-7922087 CATGAGCAAAGGAAGAGAGTTGG - Intronic
1004387744 6:15187154-15187176 CATTGGGAGGTGAGGTGAGTAGG + Intergenic
1004556927 6:16707278-16707300 AATTTGGGAGGGAAGAGAATAGG + Intronic
1004583095 6:16973387-16973409 CTTTGGGACTGGAAGACAGTGGG - Intergenic
1004883421 6:20030718-20030740 CATTGTTAAGGGAAGGGATTGGG + Intergenic
1005015932 6:21375530-21375552 CATGGGGAAGGGCAGAGATATGG + Intergenic
1005043662 6:21621648-21621670 CAGAAGGAAGGGAAGAGACTGGG - Intergenic
1005178564 6:23076496-23076518 TTCTGGGAAGGGAAGAGGGTGGG + Intergenic
1005748547 6:28862540-28862562 AATTGGGAAGAGAAGGGAGTGGG + Intergenic
1005991922 6:30908539-30908561 ACTTGGGAAGGGAAAAGAGGTGG + Intronic
1006276075 6:33006631-33006653 GAATGGGAAGGGAAGCTAGTAGG + Exonic
1007088562 6:39167646-39167668 CAGCGGGAAGGGAAGAGTGAGGG + Intergenic
1007283590 6:40730882-40730904 CAGTGTGAAGGGAACAGTGTTGG - Intergenic
1007514373 6:42399705-42399727 CATGGGGAAGGAGAGGGAGTAGG + Intronic
1007532293 6:42553900-42553922 CATTGGGAAGTACTGAGAGTGGG - Intergenic
1007545423 6:42689866-42689888 GATAGGTAAGGGAAGAGAATAGG + Intronic
1007764891 6:44154544-44154566 CATGGGGGCGGGAAGAGAGCTGG + Intronic
1008149839 6:47937403-47937425 CTTTGTGAAGGAAAGAGAGCTGG + Intronic
1008427453 6:51376088-51376110 CCTTGAGATGGGAAGAGAGGTGG + Intergenic
1008465517 6:51825826-51825848 AAGTGGGAAGGGAAGAAATTTGG - Intronic
1008898151 6:56581168-56581190 AACTGGAAATGGAAGAGAGTTGG + Intronic
1008962338 6:57278405-57278427 CACATGGAAGGGAAGAGAGATGG - Intergenic
1009878195 6:69532639-69532661 CATTGGGAGGTGAACAGAGAAGG - Intergenic
1010475160 6:76277541-76277563 GATTGTGAAGGGTAGAGAGGAGG - Intergenic
1011547101 6:88493572-88493594 CATTGGGGAGGGAGGGGTGTTGG - Intergenic
1012252996 6:96999967-96999989 CATGGGGAGGGAAAGAGAGCAGG + Intronic
1012637372 6:101561369-101561391 GACTGGGAGGGGAAGAGAGAAGG + Intronic
1013309235 6:108878375-108878397 CCGTGGAAAGGGGAGAGAGTGGG + Intronic
1015145514 6:129981188-129981210 CATTGGTAGGGGTAGAGGGTGGG + Intergenic
1015516045 6:134083548-134083570 CATTGCGGAGGGGAGAGACTCGG + Intergenic
1015821700 6:137267812-137267834 CAATGGGAAGGGAAAAGAAGAGG - Intergenic
1016221496 6:141676803-141676825 CATTGGGAATGGAACCTAGTTGG + Intergenic
1016370129 6:143365196-143365218 AAGCTGGAAGGGAAGAGAGTTGG - Intergenic
1017313722 6:153003506-153003528 CTTTGGAAAGGGATGAGGGTTGG - Intergenic
1017524551 6:155231141-155231163 TACTGGTAAGGGAAGAAAGTAGG - Intronic
1017882918 6:158573902-158573924 GATGGGGAGGGGAGGAGAGTGGG + Intronic
1018069726 6:160153742-160153764 CATAGGGAAGGGTAGATAGAAGG - Intronic
1018165398 6:161089585-161089607 TATTGGGAAGAGAGGTGAGTGGG - Intronic
1018318137 6:162577683-162577705 CTTTGGGAAGCCAAGAGAGAAGG + Intronic
1018906541 6:168079197-168079219 CACTGGGAAGGGAATTGAGAGGG + Intronic
1019301940 7:309792-309814 CGCTGGGCAGGGAAGAGGGTGGG + Intergenic
1020523618 7:9228187-9228209 GATTGGGAAGGGTAGTGAGAAGG + Intergenic
1020968710 7:14905862-14905884 CATTGGGAAGATAAGTGAGCTGG + Intronic
1021278761 7:18690031-18690053 CCTTGGGAAAGGAACAGAGGCGG + Intronic
1021503682 7:21357258-21357280 CATTGGGGAAGGAAGACAGGAGG + Intergenic
1022644553 7:32218209-32218231 AAGTGGGAAAGGAACAGAGTGGG - Intronic
1023348910 7:39300030-39300052 CTTTGGGAGGGGAAGAGATGTGG - Intronic
1023379682 7:39594482-39594504 CATTGAGAAGGGACCAAAGTAGG - Intronic
1023836624 7:44072459-44072481 CAGTGAGAAGGGGAGGGAGTTGG + Exonic
1023977736 7:45043774-45043796 CATTGGGAAGAGTAAAGAATAGG - Intronic
1024528684 7:50372334-50372356 TGGTGGGAAGGGAACAGAGTGGG - Intronic
1025139466 7:56450083-56450105 CAAGGGGAAGGGAAGAGAAGGGG - Intergenic
1025841973 7:65158655-65158677 CACTGGGGAGGGGAGGGAGTAGG - Intergenic
1025881074 7:65537327-65537349 CACTGGGGAGGGGAGGGAGTAGG + Intergenic
1025892365 7:65665288-65665310 CACTGGGGAGGGGAGGGAGTAGG - Intergenic
1026218197 7:68368252-68368274 CAGTGGGGAAGGAAGAGAGTAGG - Intergenic
1027124973 7:75549917-75549939 CATTGGGAAGCCAAGACAGGAGG - Intronic
1027981672 7:85232138-85232160 CATTGGGAGGAGGAGTGAGTTGG + Intergenic
1028671051 7:93400368-93400390 CATTGGGAAGGCACAAGAGCAGG - Intergenic
1029238334 7:99142454-99142476 CAGGGGGAAGTGAAGAGAGCAGG + Intronic
1030478743 7:110074794-110074816 CAATGGGAAGGAAATAAAGTAGG - Intergenic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031046768 7:116898222-116898244 CAGTGAGAAGAGAAGAGAATTGG - Intronic
1031956608 7:127948808-127948830 AACTGGGAACGGAAGAGGGTTGG - Intronic
1032112752 7:129090896-129090918 CATTGGGAAAGGAAAAGTGAAGG + Intergenic
1032432531 7:131873466-131873488 AATTGGGAAGGAAAGAAAGGAGG - Intergenic
1032875092 7:136029909-136029931 CATTAGGAAGGTAAGACAGATGG + Intergenic
1033024339 7:137758103-137758125 TATTTGGAAGGAAAGAGATTTGG + Intronic
1033027792 7:137793257-137793279 GATTGGAAGGGGAAGAGAATGGG - Intronic
1034076754 7:148239398-148239420 CTATGGGAAGAGAAGAGAGAGGG + Intronic
1034885980 7:154799221-154799243 AGTTGGGAAGAGAAGAGAGGAGG - Intronic
1035238994 7:157517786-157517808 CTTTGGGGCAGGAAGAGAGTAGG + Intergenic
1035287068 7:157813363-157813385 CGGTGGGGAGGGAAGAGGGTGGG + Intronic
1035988810 8:4465007-4465029 CCTTGGGAAAGGAAGAAAATAGG + Intronic
1036570927 8:9979374-9979396 CCTTGGGGAGGGAAGAGGGCAGG - Intergenic
1036755991 8:11471474-11471496 CATTGGGACGGCAATAGAGGTGG + Intronic
1036771653 8:11582670-11582692 GATGGGGAAGGGAAGACAGTGGG - Intergenic
1037385099 8:18331009-18331031 GATGGGGAAGGGAAGGGAGCAGG + Intergenic
1037774356 8:21823144-21823166 CTCTAGGAAGGGAAGTGAGTGGG - Intergenic
1037792119 8:21954390-21954412 CATTGGGAAGCCAAGACAGGCGG + Intronic
1038254054 8:25934489-25934511 CATTTGGAAGGGAAGAGAGTTGG + Intronic
1038428024 8:27477748-27477770 TTTGGGGAAGGGGAGAGAGTGGG + Intronic
1038548029 8:28441160-28441182 CATTAGGTAGGGGAGAGAGGCGG - Intronic
1038746672 8:30260884-30260906 CCTTGGGAAGGGAACAGACTTGG + Intergenic
1039079920 8:33723807-33723829 AATTGGAGAGGGAAGAGAGTAGG + Intergenic
1039516994 8:38142471-38142493 CATTGGGATGGGAGGGGGGTAGG - Intronic
1039743292 8:40401557-40401579 CAGGGGGAAGGAAAGGGAGTAGG - Intergenic
1040909600 8:52504104-52504126 CATTGGGAGGGGTAGATATTTGG + Intergenic
1041738283 8:61133677-61133699 GATTGGGAAGGGGAAAGATTGGG + Intronic
1041895853 8:62924106-62924128 GGTTGGGGAGGGAGGAGAGTAGG - Intronic
1042066893 8:64887448-64887470 CATGGAGAAGAGAAGAGAGTAGG - Intergenic
1042100351 8:65269827-65269849 CATGGGTAGGGGAAGAGAATTGG - Intergenic
1042212468 8:66394284-66394306 CATTGGGAAAGTGAGACAGTGGG - Intergenic
1042605930 8:70546580-70546602 CTTTGGGAAGGAAACAGAATGGG + Intergenic
1042760425 8:72266485-72266507 CATGGGGAAGGAGAGAGAGAGGG + Intergenic
1043134752 8:76507266-76507288 AATTGGGATGGGATGAAAGTGGG - Intergenic
1043485502 8:80695262-80695284 CTCTGGGAAGGGCAGACAGTTGG - Intronic
1044571067 8:93719767-93719789 CGTTTGGAAGGTAAGAGGGTTGG - Intronic
1045844143 8:106613780-106613802 CATTTTCAGGGGAAGAGAGTAGG - Intronic
1046614864 8:116464972-116464994 CTTTGGGAAGGCAAGACAGGTGG + Intergenic
1046860707 8:119088157-119088179 TAGTGGGAAGGAAGGAGAGTGGG + Intronic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1048824823 8:138413932-138413954 TATTGGGAAGTGAAGGGTGTAGG - Intronic
1049567706 8:143350049-143350071 CAGTGGGGAGAGAAGAGGGTGGG - Intronic
1050420148 9:5455474-5455496 GAGTGGGAAGGGGAGAGAGTTGG - Intronic
1051101071 9:13522429-13522451 CCTTAGGAAGGGAAGGAAGTCGG - Intergenic
1051718153 9:20007388-20007410 CCTTGGCAAGGGAAGGGGGTGGG + Intergenic
1052736486 9:32347595-32347617 CATTGGGAACAGATGAGAGCTGG - Intergenic
1052760137 9:32581822-32581844 CAGTGGGCAGGGAAGAGATGGGG + Intergenic
1053008416 9:34619885-34619907 GATTAGGAAGGGAAGAGACTGGG - Intronic
1053180718 9:35966769-35966791 GATGGGGAAGGGAGGGGAGTAGG - Intergenic
1055128929 9:72752477-72752499 TAGTGGGATGGGATGAGAGTGGG + Intronic
1055700153 9:78935742-78935764 AATTGGTAAGTGAACAGAGTTGG + Intergenic
1055944376 9:81679761-81679783 CAATGGGGAGGGGAGAGGGTAGG + Intronic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1056688035 9:88782860-88782882 AATGGGGAAGGGAAGAGTGGAGG + Intergenic
1057299217 9:93867259-93867281 GACTGGGGAGGGAAGAGAGTGGG - Intergenic
1057909112 9:99004467-99004489 CACTGGGCTAGGAAGAGAGTGGG + Intronic
1057925347 9:99142077-99142099 CAGTGGGAATGGAAGAGTATGGG - Intronic
1058142494 9:101372118-101372140 CATTGGGAACAGAAGACACTGGG + Intronic
1058647039 9:107140430-107140452 CACTGGGAAGGCTAGAGAATTGG + Intergenic
1058747783 9:108008513-108008535 CATGGGAAAGAGAAGAGAATAGG + Intergenic
1059511292 9:114850559-114850581 CTTTGGGAAAGGAATGGAGTAGG + Intergenic
1060540844 9:124429129-124429151 CCTTGGGAACGGAAGACATTTGG - Intergenic
1061207880 9:129174940-129174962 CACTGGGGAGGGAAGAGCGGCGG + Intergenic
1062213046 9:135374894-135374916 CAGTGGGAATGAAACAGAGTGGG - Intergenic
1062476996 9:136733160-136733182 CATGGGGAAGGGGAGAGTGCTGG + Intergenic
1186087520 X:6006305-6006327 CAGTGGGAAGGAAAAAGTGTGGG + Intronic
1186501315 X:10053015-10053037 CACAGGCAAGGGAAGAGAGAAGG + Intronic
1186893799 X:13986469-13986491 CATTGAGACGAGAAGAGTGTGGG - Intergenic
1187090332 X:16089441-16089463 AAATGGGAAGTGAAGAGAGGAGG - Intergenic
1187353228 X:18541761-18541783 CTTTGGGAAGGCAAGACAGGAGG - Intronic
1188451378 X:30310657-30310679 CATGGGGCAGGGAAGGGTGTTGG + Intergenic
1189425981 X:40900284-40900306 CATTGGCAAGGGAAGGGGGTGGG - Intergenic
1189629168 X:42933718-42933740 CATTGAGTACGGAAGAGAATGGG + Intergenic
1189926159 X:45957825-45957847 AATTCAGCAGGGAAGAGAGTAGG + Intergenic
1190287988 X:48973158-48973180 GAATGGGAAGGGTAAAGAGTGGG - Intergenic
1190371646 X:49748355-49748377 TGTTGGGAATGTAAGAGAGTTGG - Intergenic
1190437525 X:50440621-50440643 CTTTGGGAAGCTAAGAGAATTGG + Intronic
1190690322 X:52908185-52908207 CAGCAGGAAGGGAAGAGAGATGG - Exonic
1190695661 X:52947607-52947629 CAGCAGGAAGGGAAGAGAGATGG + Exonic
1191725196 X:64271887-64271909 CCCTGGGAAGGGAAAAGAGTTGG + Intronic
1191904918 X:66077293-66077315 TATTGGGAAGGGAAGGGAAGGGG - Intergenic
1191975899 X:66870603-66870625 CATTGGGAATGAAAGAAAGCAGG - Intergenic
1192370251 X:70507004-70507026 CTTTGGGAAGGTGAGACAGTAGG - Intergenic
1193344967 X:80395020-80395042 GACTGGGGAGGGAAGAGAGCAGG - Intronic
1193584968 X:83310583-83310605 CACTGGGATAGGGAGAGAGTAGG + Intergenic
1193760014 X:85452959-85452981 CATAGGAAAGGAAGGAGAGTTGG + Intergenic
1193877095 X:86873881-86873903 CCTTGGGAAAGGATGAGAGAAGG - Intergenic
1194084900 X:89514783-89514805 TGTTGGGAAGGGGTGAGAGTGGG - Intergenic
1194909073 X:99616551-99616573 GATTGAGAAGGGGAGAGTGTGGG - Intergenic
1195114820 X:101686768-101686790 CATTTGCATGGGAAGAGGGTAGG - Intergenic
1196326801 X:114414932-114414954 CATTGGCAAGGGAACAAAGAAGG + Intergenic
1197707603 X:129646026-129646048 CGTGGGGAAGGGGAGAAAGTGGG - Exonic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1199322306 X:146455205-146455227 CATTGAGAAGGGAAGACAGTGGG + Intergenic
1199683379 X:150242952-150242974 TATTGGAAAGGGAAGGGTGTGGG - Intergenic
1201792086 Y:17853087-17853109 CTTTGTGAAGGAAAGTGAGTTGG + Intergenic
1201809468 Y:18052902-18052924 CTTTGTGAAGGAAAGTGAGTTGG - Intergenic
1202353685 Y:24022701-24022723 CTTTGTGAAGGAAAGTGAGTTGG + Intergenic
1202517094 Y:25647414-25647436 CTTTGTGAAGGAAAGTGAGTTGG - Intergenic
1202597576 Y:26558326-26558348 GATAAGGAAGGGAAGAAAGTAGG + Intergenic